ID: 912873243

View in Genome Browser
Species Human (GRCh38)
Location 1:113328882-113328904
Sequence AATTATATGTTCTTGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912873243_912873252 13 Left 912873243 1:113328882-113328904 CCCTCTCCCAAGAACATATAATT No data
Right 912873252 1:113328918-113328940 ATTTGGCCATCCATTGCCAGGGG No data
912873243_912873253 14 Left 912873243 1:113328882-113328904 CCCTCTCCCAAGAACATATAATT No data
Right 912873253 1:113328919-113328941 TTTGGCCATCCATTGCCAGGGGG No data
912873243_912873257 20 Left 912873243 1:113328882-113328904 CCCTCTCCCAAGAACATATAATT No data
Right 912873257 1:113328925-113328947 CATCCATTGCCAGGGGGATGGGG No data
912873243_912873256 19 Left 912873243 1:113328882-113328904 CCCTCTCCCAAGAACATATAATT No data
Right 912873256 1:113328924-113328946 CCATCCATTGCCAGGGGGATGGG No data
912873243_912873250 11 Left 912873243 1:113328882-113328904 CCCTCTCCCAAGAACATATAATT No data
Right 912873250 1:113328916-113328938 CCATTTGGCCATCCATTGCCAGG No data
912873243_912873247 -4 Left 912873243 1:113328882-113328904 CCCTCTCCCAAGAACATATAATT No data
Right 912873247 1:113328901-113328923 AATTCTCTCACCATGCCATTTGG No data
912873243_912873263 29 Left 912873243 1:113328882-113328904 CCCTCTCCCAAGAACATATAATT No data
Right 912873263 1:113328934-113328956 CCAGGGGGATGGGGAAGGGGTGG No data
912873243_912873254 18 Left 912873243 1:113328882-113328904 CCCTCTCCCAAGAACATATAATT No data
Right 912873254 1:113328923-113328945 GCCATCCATTGCCAGGGGGATGG No data
912873243_912873260 25 Left 912873243 1:113328882-113328904 CCCTCTCCCAAGAACATATAATT No data
Right 912873260 1:113328930-113328952 ATTGCCAGGGGGATGGGGAAGGG No data
912873243_912873251 12 Left 912873243 1:113328882-113328904 CCCTCTCCCAAGAACATATAATT No data
Right 912873251 1:113328917-113328939 CATTTGGCCATCCATTGCCAGGG No data
912873243_912873261 26 Left 912873243 1:113328882-113328904 CCCTCTCCCAAGAACATATAATT No data
Right 912873261 1:113328931-113328953 TTGCCAGGGGGATGGGGAAGGGG No data
912873243_912873259 24 Left 912873243 1:113328882-113328904 CCCTCTCCCAAGAACATATAATT No data
Right 912873259 1:113328929-113328951 CATTGCCAGGGGGATGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912873243 Original CRISPR AATTATATGTTCTTGGGAGA GGG (reversed) Intergenic
No off target data available for this crispr