ID: 912873245

View in Genome Browser
Species Human (GRCh38)
Location 1:113328888-113328910
Sequence TGAGAGAATTATATGTTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912873245_912873256 13 Left 912873245 1:113328888-113328910 CCCAAGAACATATAATTCTCTCA No data
Right 912873256 1:113328924-113328946 CCATCCATTGCCAGGGGGATGGG No data
912873245_912873264 29 Left 912873245 1:113328888-113328910 CCCAAGAACATATAATTCTCTCA No data
Right 912873264 1:113328940-113328962 GGATGGGGAAGGGGTGGTGTTGG No data
912873245_912873259 18 Left 912873245 1:113328888-113328910 CCCAAGAACATATAATTCTCTCA No data
Right 912873259 1:113328929-113328951 CATTGCCAGGGGGATGGGGAAGG No data
912873245_912873257 14 Left 912873245 1:113328888-113328910 CCCAAGAACATATAATTCTCTCA No data
Right 912873257 1:113328925-113328947 CATCCATTGCCAGGGGGATGGGG No data
912873245_912873263 23 Left 912873245 1:113328888-113328910 CCCAAGAACATATAATTCTCTCA No data
Right 912873263 1:113328934-113328956 CCAGGGGGATGGGGAAGGGGTGG No data
912873245_912873251 6 Left 912873245 1:113328888-113328910 CCCAAGAACATATAATTCTCTCA No data
Right 912873251 1:113328917-113328939 CATTTGGCCATCCATTGCCAGGG No data
912873245_912873261 20 Left 912873245 1:113328888-113328910 CCCAAGAACATATAATTCTCTCA No data
Right 912873261 1:113328931-113328953 TTGCCAGGGGGATGGGGAAGGGG No data
912873245_912873247 -10 Left 912873245 1:113328888-113328910 CCCAAGAACATATAATTCTCTCA No data
Right 912873247 1:113328901-113328923 AATTCTCTCACCATGCCATTTGG No data
912873245_912873254 12 Left 912873245 1:113328888-113328910 CCCAAGAACATATAATTCTCTCA No data
Right 912873254 1:113328923-113328945 GCCATCCATTGCCAGGGGGATGG No data
912873245_912873250 5 Left 912873245 1:113328888-113328910 CCCAAGAACATATAATTCTCTCA No data
Right 912873250 1:113328916-113328938 CCATTTGGCCATCCATTGCCAGG No data
912873245_912873260 19 Left 912873245 1:113328888-113328910 CCCAAGAACATATAATTCTCTCA No data
Right 912873260 1:113328930-113328952 ATTGCCAGGGGGATGGGGAAGGG No data
912873245_912873253 8 Left 912873245 1:113328888-113328910 CCCAAGAACATATAATTCTCTCA No data
Right 912873253 1:113328919-113328941 TTTGGCCATCCATTGCCAGGGGG No data
912873245_912873252 7 Left 912873245 1:113328888-113328910 CCCAAGAACATATAATTCTCTCA No data
Right 912873252 1:113328918-113328940 ATTTGGCCATCCATTGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912873245 Original CRISPR TGAGAGAATTATATGTTCTT GGG (reversed) Intergenic
No off target data available for this crispr