ID: 912873247

View in Genome Browser
Species Human (GRCh38)
Location 1:113328901-113328923
Sequence AATTCTCTCACCATGCCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912873240_912873247 27 Left 912873240 1:113328851-113328873 CCAGTGCAAATTCCCACAATTAC No data
Right 912873247 1:113328901-113328923 AATTCTCTCACCATGCCATTTGG No data
912873245_912873247 -10 Left 912873245 1:113328888-113328910 CCCAAGAACATATAATTCTCTCA No data
Right 912873247 1:113328901-113328923 AATTCTCTCACCATGCCATTTGG No data
912873243_912873247 -4 Left 912873243 1:113328882-113328904 CCCTCTCCCAAGAACATATAATT No data
Right 912873247 1:113328901-113328923 AATTCTCTCACCATGCCATTTGG No data
912873241_912873247 15 Left 912873241 1:113328863-113328885 CCCACAATTACTGCATTCTCCCT No data
Right 912873247 1:113328901-113328923 AATTCTCTCACCATGCCATTTGG No data
912873242_912873247 14 Left 912873242 1:113328864-113328886 CCACAATTACTGCATTCTCCCTC No data
Right 912873247 1:113328901-113328923 AATTCTCTCACCATGCCATTTGG No data
912873244_912873247 -5 Left 912873244 1:113328883-113328905 CCTCTCCCAAGAACATATAATTC No data
Right 912873247 1:113328901-113328923 AATTCTCTCACCATGCCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912873247 Original CRISPR AATTCTCTCACCATGCCATT TGG Intergenic
No off target data available for this crispr