ID: 912873250

View in Genome Browser
Species Human (GRCh38)
Location 1:113328916-113328938
Sequence CCATTTGGCCATCCATTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912873246_912873250 4 Left 912873246 1:113328889-113328911 CCAAGAACATATAATTCTCTCAC No data
Right 912873250 1:113328916-113328938 CCATTTGGCCATCCATTGCCAGG No data
912873244_912873250 10 Left 912873244 1:113328883-113328905 CCTCTCCCAAGAACATATAATTC No data
Right 912873250 1:113328916-113328938 CCATTTGGCCATCCATTGCCAGG No data
912873241_912873250 30 Left 912873241 1:113328863-113328885 CCCACAATTACTGCATTCTCCCT No data
Right 912873250 1:113328916-113328938 CCATTTGGCCATCCATTGCCAGG No data
912873242_912873250 29 Left 912873242 1:113328864-113328886 CCACAATTACTGCATTCTCCCTC No data
Right 912873250 1:113328916-113328938 CCATTTGGCCATCCATTGCCAGG No data
912873243_912873250 11 Left 912873243 1:113328882-113328904 CCCTCTCCCAAGAACATATAATT No data
Right 912873250 1:113328916-113328938 CCATTTGGCCATCCATTGCCAGG No data
912873245_912873250 5 Left 912873245 1:113328888-113328910 CCCAAGAACATATAATTCTCTCA No data
Right 912873250 1:113328916-113328938 CCATTTGGCCATCCATTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912873250 Original CRISPR CCATTTGGCCATCCATTGCC AGG Intergenic
No off target data available for this crispr