ID: 912873564

View in Genome Browser
Species Human (GRCh38)
Location 1:113331989-113332011
Sequence CCGATGAGTTTTGTGGGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912873564_912873570 25 Left 912873564 1:113331989-113332011 CCCATGCCCACAAAACTCATCGG No data
Right 912873570 1:113332037-113332059 TCTTCTGAATACTAGTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912873564 Original CRISPR CCGATGAGTTTTGTGGGCAT GGG (reversed) Intergenic
No off target data available for this crispr