ID: 912873566

View in Genome Browser
Species Human (GRCh38)
Location 1:113331990-113332012
Sequence ACCGATGAGTTTTGTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912873566_912873570 24 Left 912873566 1:113331990-113332012 CCATGCCCACAAAACTCATCGGT No data
Right 912873570 1:113332037-113332059 TCTTCTGAATACTAGTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912873566 Original CRISPR ACCGATGAGTTTTGTGGGCA TGG (reversed) Intergenic
No off target data available for this crispr