ID: 912873567

View in Genome Browser
Species Human (GRCh38)
Location 1:113331995-113332017
Sequence TTGACACCGATGAGTTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912873567_912873570 19 Left 912873567 1:113331995-113332017 CCCACAAAACTCATCGGTGTCAA No data
Right 912873570 1:113332037-113332059 TCTTCTGAATACTAGTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912873567 Original CRISPR TTGACACCGATGAGTTTTGT GGG (reversed) Intergenic
No off target data available for this crispr