ID: 912873568

View in Genome Browser
Species Human (GRCh38)
Location 1:113331996-113332018
Sequence CTTGACACCGATGAGTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912873568_912873570 18 Left 912873568 1:113331996-113332018 CCACAAAACTCATCGGTGTCAAG No data
Right 912873570 1:113332037-113332059 TCTTCTGAATACTAGTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912873568 Original CRISPR CTTGACACCGATGAGTTTTG TGG (reversed) Intergenic
No off target data available for this crispr