ID: 912873570

View in Genome Browser
Species Human (GRCh38)
Location 1:113332037-113332059
Sequence TCTTCTGAATACTAGTTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912873566_912873570 24 Left 912873566 1:113331990-113332012 CCATGCCCACAAAACTCATCGGT No data
Right 912873570 1:113332037-113332059 TCTTCTGAATACTAGTTCTGTGG No data
912873564_912873570 25 Left 912873564 1:113331989-113332011 CCCATGCCCACAAAACTCATCGG No data
Right 912873570 1:113332037-113332059 TCTTCTGAATACTAGTTCTGTGG No data
912873568_912873570 18 Left 912873568 1:113331996-113332018 CCACAAAACTCATCGGTGTCAAG No data
Right 912873570 1:113332037-113332059 TCTTCTGAATACTAGTTCTGTGG No data
912873567_912873570 19 Left 912873567 1:113331995-113332017 CCCACAAAACTCATCGGTGTCAA No data
Right 912873570 1:113332037-113332059 TCTTCTGAATACTAGTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912873570 Original CRISPR TCTTCTGAATACTAGTTCTG TGG Intergenic
No off target data available for this crispr