ID: 912879124

View in Genome Browser
Species Human (GRCh38)
Location 1:113390950-113390972
Sequence CCGTCTCAGCCCGGGGGCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 253}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912879124_912879146 30 Left 912879124 1:113390950-113390972 CCAGGGCCCCCGGGCTGAGACGG 0: 1
1: 1
2: 1
3: 14
4: 253
Right 912879146 1:113391003-113391025 GGGTCTCCCCCATGGTGCAGCGG 0: 1
1: 0
2: 2
3: 9
4: 167
912879124_912879138 10 Left 912879124 1:113390950-113390972 CCAGGGCCCCCGGGCTGAGACGG 0: 1
1: 1
2: 1
3: 14
4: 253
Right 912879138 1:113390983-113391005 GCGCCCCGGCCGCCCGCGCGGGG 0: 1
1: 1
2: 8
3: 52
4: 391
912879124_912879144 22 Left 912879124 1:113390950-113390972 CCAGGGCCCCCGGGCTGAGACGG 0: 1
1: 1
2: 1
3: 14
4: 253
Right 912879144 1:113390995-113391017 CCCGCGCGGGGTCTCCCCCATGG 0: 1
1: 0
2: 1
3: 15
4: 118
912879124_912879134 -4 Left 912879124 1:113390950-113390972 CCAGGGCCCCCGGGCTGAGACGG 0: 1
1: 1
2: 1
3: 14
4: 253
Right 912879134 1:113390969-113390991 ACGGGGCCGGAGCGGCGCCCCGG 0: 1
1: 0
2: 1
3: 24
4: 210
912879124_912879136 8 Left 912879124 1:113390950-113390972 CCAGGGCCCCCGGGCTGAGACGG 0: 1
1: 1
2: 1
3: 14
4: 253
Right 912879136 1:113390981-113391003 CGGCGCCCCGGCCGCCCGCGCGG 0: 1
1: 0
2: 3
3: 66
4: 434
912879124_912879137 9 Left 912879124 1:113390950-113390972 CCAGGGCCCCCGGGCTGAGACGG 0: 1
1: 1
2: 1
3: 14
4: 253
Right 912879137 1:113390982-113391004 GGCGCCCCGGCCGCCCGCGCGGG 0: 1
1: 1
2: 5
3: 59
4: 421

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912879124 Original CRISPR CCGTCTCAGCCCGGGGGCCC TGG (reversed) Exonic
900100371 1:959888-959910 CTGTCCAGGCCCGGGGGCCCGGG - Intergenic
900292568 1:1929751-1929773 CAGTCTCAACCTGGGAGCCCTGG + Intronic
900349299 1:2227376-2227398 CCGTCTCGGCGCAGGGTCCCTGG + Intergenic
900793521 1:4694154-4694176 CCAGCTCAGCCCAGGGGCACGGG + Intronic
901007653 1:6179694-6179716 GCGTCGCCGCCCGGGGGGCCCGG + Intronic
901373263 1:8818049-8818071 CCGGCCCAGCCCGGGGGGCGCGG - Intergenic
901551112 1:9997080-9997102 CCGCCTCAGCCCGGTGCTCCTGG - Intergenic
901664115 1:10816828-10816850 CGGTCTGAGGCCGGGGGCCTGGG + Intergenic
901743153 1:11355618-11355640 CCCTCCCAGCCCGGGGGGCACGG - Intergenic
903142074 1:21345004-21345026 CCGACCCAGCCCGGCTGCCCTGG + Intronic
903543240 1:24108413-24108435 CCTCCTCAGACTGGGGGCCCTGG + Intronic
904013840 1:27405681-27405703 CCTCCTCAGCTCGGGGGGCCGGG - Exonic
904044577 1:27602173-27602195 CCCTCCCAGCTTGGGGGCCCTGG - Intronic
909590325 1:77341406-77341428 TCCTCTCAGCCCTCGGGCCCGGG + Intronic
910251458 1:85201794-85201816 CCGTCGCGGCCCGGGGCTCCGGG - Intergenic
912879124 1:113390950-113390972 CCGTCTCAGCCCGGGGGCCCTGG - Exonic
915238582 1:154502931-154502953 CCCTCTGAGCCCGGGGGCACGGG - Intronic
915949804 1:160181583-160181605 CTGACTCAGCCCAGGGGTCCTGG + Intronic
916204029 1:162298127-162298149 CCGGCTCAGCCACGGGGGCCTGG - Intronic
918649698 1:186946068-186946090 CTGTCTAAGCGCGGGGGCTCTGG - Intronic
921010378 1:211134477-211134499 CTGTTTCAGGCCGGGGCCCCCGG + Intergenic
922586404 1:226737536-226737558 CCGGCTCAGCCCCGGAGGCCCGG + Exonic
922985870 1:229865563-229865585 CCCTCACAGCCCGGGGCCGCAGG - Intergenic
1064231093 10:13529362-13529384 CCCTCACATCCCGGGCGCCCCGG + Intergenic
1066046899 10:31602905-31602927 CCGGCTCAGCCTGGGAGCCCAGG - Intergenic
1067061377 10:43079674-43079696 CCCTCTCTGCCCCTGGGCCCCGG + Intronic
1067139928 10:43648535-43648557 CCGCCTCAGGCCCCGGGCCCCGG + Intronic
1068218101 10:54009820-54009842 CCGTGTCAGCCTGGAGGCACCGG - Intronic
1069474566 10:68721385-68721407 CCGTCGCCGCCCGGGGCCGCCGG - Intronic
1069995932 10:72342221-72342243 CCGTCCCGGCTAGGGGGCCCTGG - Intronic
1071309482 10:84328905-84328927 CCGCCTCAGCCCGGGAGTTCGGG - Intronic
1072654308 10:97319672-97319694 CCGCCGCAGCCAGGGGCCCCGGG - Exonic
1072656578 10:97334332-97334354 CCGCCGCAGCCAGGGGCCCCGGG + Exonic
1074169754 10:110920062-110920084 CGGACTGGGCCCGGGGGCCCAGG - Intronic
1075885350 10:125895770-125895792 CCATTTCAGGCAGGGGGCCCGGG - Intronic
1076433659 10:130424890-130424912 ACGTGTCAGCCTGTGGGCCCAGG + Intergenic
1076554185 10:131311464-131311486 CCGGCTCAGCGCGGGGGTCGTGG - Exonic
1076594577 10:131617804-131617826 CCGGCTCAGCCAGGGAGCCATGG + Intergenic
1077328410 11:1973478-1973500 CCGTTGCACCCCGGAGGCCCAGG + Intronic
1077419824 11:2444956-2444978 CCGGCCCAGCCCGGGCGCTCGGG - Intronic
1077511116 11:2963660-2963682 CCATCTCAGCACTGGGGCCTGGG - Intronic
1077630575 11:3808607-3808629 CCGGCGGAACCCGGGGGCCCAGG - Exonic
1082986086 11:59172383-59172405 CGGTCCCAGCCAGGCGGCCCCGG + Intronic
1083330805 11:61897596-61897618 CCGTCTCAGCCCTGTGCTCCTGG - Exonic
1083618440 11:64037316-64037338 CTGTCTCTGCCCGGCGGCCGCGG + Intronic
1083888815 11:65585620-65585642 CCGCCGCAGCGCGGGGTCCCGGG + Intronic
1084184387 11:67464077-67464099 CCGTCTCTGTCTGGTGGCCCTGG - Exonic
1087890921 11:103537141-103537163 CTGTCTCAGCCCGGGTGAGCTGG + Intergenic
1090306264 11:125693720-125693742 CTGTCTCAGCCCAGGGCCACAGG - Intergenic
1090832393 11:130428411-130428433 CCGACTCGGCCCGCGGGGCCCGG + Exonic
1202811388 11_KI270721v1_random:28657-28679 CCGTTGCACCCCGGAGGCCCAGG + Intergenic
1092229012 12:6766650-6766672 CCGTCTCGGCCCCGGGACCCCGG + Exonic
1096879810 12:54658472-54658494 CCGTGTCAGCCCAAGGGCACTGG - Intergenic
1102766808 12:115440567-115440589 ATGTGTCAGCTCGGGGGCCCAGG - Intergenic
1102997380 12:117360959-117360981 CGGCCTCAGGCCGGGGGCTCCGG - Intronic
1103942122 12:124506839-124506861 CCGTCACAGCCCAGGGGCACGGG - Intronic
1104439691 12:128784805-128784827 CCATCTCAGCCCTGGGGCATAGG + Intergenic
1104775743 12:131389267-131389289 CCAGCTCAGCCCGGGGCCTCAGG - Intergenic
1105031481 12:132887401-132887423 CCGCCCCACCCCGCGGGCCCCGG + Intronic
1108642394 13:52395041-52395063 CCATCTCTGCACTGGGGCCCAGG - Intronic
1113378887 13:109786004-109786026 CCGTCTCCGCTCGCCGGCCCGGG + Exonic
1114655328 14:24312163-24312185 CCTCCTCAGCCCAGGTGCCCTGG + Intronic
1115203239 14:30875076-30875098 CCCTCGCTGCCCGCGGGCCCCGG - Exonic
1115850736 14:37588152-37588174 GCGCCCCAGCCCGGGCGCCCGGG + Intergenic
1115852409 14:37598666-37598688 CCGTCTGGGCCCGGGGCCCGAGG - Intronic
1118439334 14:65798686-65798708 ACGGCTCAGCCCCGGGTCCCAGG - Intergenic
1120070871 14:80100783-80100805 TGCTCTCAGCCCTGGGGCCCTGG + Intergenic
1121127608 14:91417965-91417987 CGGTGCCAGCCCGGGAGCCCGGG + Intergenic
1121137378 14:91510623-91510645 CGGCCTCTGCCCGCGGGCCCCGG + Intergenic
1121733822 14:96204652-96204674 CCCTCTGAGCCCTGGGGGCCAGG - Intergenic
1122115149 14:99523778-99523800 GGGTCTCAGCACGGGGGCCTTGG + Intronic
1122627438 14:103091596-103091618 GCGTCTCCGCCCGCGGGCTCTGG - Intergenic
1122785357 14:104160950-104160972 CCGTGTCAGCCTGGATGCCCAGG + Intronic
1123000933 14:105293720-105293742 CAGTCTCTGCTCGGGTGCCCCGG + Intronic
1202872704 14_GL000225v1_random:178157-178179 CCATTTCAGGCAGGGGGCCCAGG + Intergenic
1123474927 15:20582601-20582623 GCTTCTCAGCCTGGGCGCCCTGG - Intergenic
1123643084 15:22417756-22417778 GCTTCTCAGCCTGGGCGCCCTGG + Intergenic
1124583570 15:30984798-30984820 CAGCCTCAGCACAGGGGCCCAGG + Intronic
1125518385 15:40335424-40335446 CGGTCTGAGGCCTGGGGCCCAGG - Exonic
1125720125 15:41841355-41841377 CTGCCTCAGCCTGGGGACCCTGG + Intronic
1127207204 15:56733368-56733390 CCGCCTCACTCCGGGGGCGCTGG - Intronic
1129711032 15:77820267-77820289 CCGGCCCCACCCGGGGGCCCCGG + Intronic
1129723252 15:77889203-77889225 GCCTCTGAGCCCTGGGGCCCTGG + Intergenic
1129850240 15:78789623-78789645 CCCTCGCAGCCTGGGGGCACCGG - Intronic
1130540466 15:84817705-84817727 CCCTCTCAGCCCCAAGGCCCAGG + Intronic
1130546095 15:84858307-84858329 CGGTTTCCCCCCGGGGGCCCAGG + Exonic
1132487662 16:203699-203721 CCGTCTCAGGGCGGGGGGCGGGG + Intronic
1133045534 16:3086601-3086623 TCCCCTCAGGCCGGGGGCCCAGG - Intergenic
1139476099 16:67203272-67203294 CCCTGGCAGCCCCGGGGCCCAGG - Intronic
1139517336 16:67459711-67459733 CCATCTGAGCCTGGGAGCCCTGG - Intronic
1139599492 16:67978054-67978076 CCATCACAGCCTGGGGGCCCTGG + Intronic
1139661505 16:68424077-68424099 CAGTCTTAGCCAGGGGGCCTAGG + Intronic
1140410536 16:74738165-74738187 CCGTCTCAGCCCAGAGACACAGG + Intronic
1141636731 16:85317897-85317919 CTGCCTCAGCCCGGGGTTCCTGG + Intergenic
1142132223 16:88436328-88436350 CAGGCTGAGGCCGGGGGCCCAGG - Exonic
1142132230 16:88436338-88436360 CGGCCTCAGCCTGTGGGCCCTGG + Exonic
1142231171 16:88900964-88900986 CCGGCTGAGCACGGGGGCCAGGG - Intronic
1142384004 16:89750916-89750938 CAGTCTCAGTCCGGTTGCCCAGG + Intronic
1142396916 16:89837319-89837341 CCGTGTCAGCCCTGGAGCCAAGG + Intronic
1142474271 17:180410-180432 CCCTCTCTGCCCGGGGGCCGCGG + Intronic
1143405490 17:6674801-6674823 CTGGCTCAGCCCCGAGGCCCAGG - Intergenic
1143512875 17:7405588-7405610 CTGGCTCAGCCCTGGGGCCGTGG - Intronic
1145269276 17:21396083-21396105 CTGCCTGCGCCCGGGGGCCCAGG - Intronic
1146492402 17:33292325-33292347 CCGCCTCAGCCCGCAGCCCCTGG + Exonic
1146956266 17:36937949-36937971 CCGCTCCAGCCCGGGGCCCCGGG + Exonic
1147987615 17:44315419-44315441 CCGGCTCAGCCCGGGCGGCTGGG - Intronic
1148593150 17:48831405-48831427 CCGTCCCCTCCCGCGGGCCCAGG + Intronic
1149602872 17:57904530-57904552 CCTTATAAGCCCTGGGGCCCAGG + Intronic
1150267774 17:63842306-63842328 CCGCCGCAGCCCGAGGGTCCCGG + Intronic
1152198938 17:78934077-78934099 CCGTCTCTGCTCGCTGGCCCTGG - Intergenic
1152745584 17:82037236-82037258 CTTTCTGAGCCCGGGGGCCCCGG + Intronic
1152906831 17:82974916-82974938 CCGGCTCTGTCCTGGGGCCCTGG - Intronic
1155055256 18:22176877-22176899 CCGCGTCACCCCGGGGACCCCGG - Intronic
1157464471 18:47931344-47931366 CCCTCTCCGCCCGTGAGCCCCGG - Intergenic
1160700886 19:506795-506817 AGGTGCCAGCCCGGGGGCCCTGG + Intergenic
1160923044 19:1529503-1529525 CCGTCCCAGCCCGGGGCTGCAGG + Intronic
1161723309 19:5915329-5915351 CCGGCTCAGCCCTGCTGCCCTGG + Exonic
1161964542 19:7540945-7540967 CCGTGTCTGCCCGGGCGGCCCGG + Exonic
1161998971 19:7731224-7731246 CCCTCACGCCCCGGGGGCCCAGG + Intronic
1162327614 19:10008150-10008172 CCATCTCAGCCTGGGGCCCAGGG + Intronic
1162378047 19:10316600-10316622 CCATCTCTGCACGGAGGCCCGGG + Exonic
1162392163 19:10396197-10396219 CCGTCCCTGCCCGCAGGCCCGGG - Exonic
1162502244 19:11060475-11060497 CGGCCTCAGCCCAGGAGCCCTGG - Intronic
1162921617 19:13906463-13906485 GCGCCTCTGCCCGGGGGTCCCGG - Exonic
1163263219 19:16203830-16203852 CCTCTTCAGCCCAGGGGCCCAGG + Intronic
1163275790 19:16283502-16283524 CCCTCCCAGCCTGGGAGCCCTGG + Intergenic
1163470926 19:17496547-17496569 CAGGCTCAGCCAGGGGGCTCTGG + Intronic
1163622620 19:18369843-18369865 CCTTCTCCGCCTGGGGGGCCCGG - Exonic
1164594885 19:29526256-29526278 CAGTCTCTGCCCGGCGGGCCGGG - Intergenic
1165149432 19:33752143-33752165 CTGCCTGAGCCCGGGAGCCCTGG + Intronic
1165448238 19:35868517-35868539 CCGGCGCAGCCCGGGGGCGGCGG + Exonic
1166737231 19:45093295-45093317 CCGCCTCCTCACGGGGGCCCCGG - Exonic
1167353507 19:48990280-48990302 CCGTCTTCACCCTGGGGCCCTGG + Intronic
1168292390 19:55362883-55362905 CCCTCTCAGCCCCGGGGCACTGG + Intronic
925008968 2:467898-467920 CCCACTCACGCCGGGGGCCCAGG + Intergenic
925985024 2:9207736-9207758 CCGCCTCAGCCAGGGCGGCCTGG + Intronic
927213157 2:20650968-20650990 GCCTCTCCGCCCGGGCGCCCCGG + Intronic
927696439 2:25242634-25242656 CAGTCTCAACCCAGGGACCCTGG - Intronic
927990297 2:27442576-27442598 CAGACGCCGCCCGGGGGCCCAGG + Exonic
928998668 2:37324585-37324607 CCGCCTCAGCCCGACGGGCCGGG + Intronic
930045110 2:47163948-47163970 CCGTCTCAGGCCGGGCGCGGTGG + Intronic
932191074 2:69741980-69742002 CCGTCCCGGCCCGGGGCCCCAGG + Exonic
937121129 2:119440562-119440584 TCCTCTCAGCCTGGGGGCCAGGG - Intronic
938210115 2:129459998-129460020 CAGTCTCAGCTGGAGGGCCCAGG - Intergenic
938302842 2:130228694-130228716 CTGTCCAGGCCCGGGGGCCCGGG + Intergenic
938453827 2:131445528-131445550 CTGTCCAGGCCCGGGGGCCCGGG - Intergenic
945234899 2:207625086-207625108 CCCTTCCTGCCCGGGGGCCCCGG + Exonic
946277589 2:218643012-218643034 CAGCCCCAGCCCGTGGGCCCCGG - Exonic
946370662 2:219279533-219279555 CCGGGTCAGGCTGGGGGCCCTGG + Intronic
947749169 2:232523869-232523891 CCGCCTGTGCCCGGGGTCCCAGG + Exonic
948302717 2:236920047-236920069 TCATCTAAGCCCGGGGGCACAGG + Intergenic
948352180 2:237350146-237350168 CCGTCTCCCCACGAGGGCCCCGG + Exonic
948403538 2:237701533-237701555 CCGGCTCAGGCTGGGGGCTCAGG - Intronic
948981933 2:241498899-241498921 GCGGCACAGCCCGGAGGCCCAGG - Intronic
1168904525 20:1392749-1392771 CCGTCGAGGCCTGGGGGCCCGGG - Intronic
1169120547 20:3093157-3093179 CCGTCTGAGCCCCAGGCCCCAGG + Intergenic
1172106770 20:32521805-32521827 CAGTCTCAGCCCAGGGAACCTGG - Intronic
1172644536 20:36461583-36461605 CCTCCTCAGCCCGGACGCCCGGG + Intronic
1172694935 20:36816007-36816029 CCATCTCAGCCCGCAGGCCTCGG + Exonic
1175264650 20:57695335-57695357 CAGCCCCAGCCAGGGGGCCCAGG - Intronic
1175305941 20:57975620-57975642 CTGTCCCAGCCAGGGGGCCTGGG - Intergenic
1175892135 20:62320630-62320652 CCGTCTCATGGCGGGGGCCCAGG + Exonic
1176077277 20:63254244-63254266 CCGTAGCAGCCCGGGGTCCGAGG + Intronic
1176146083 20:63566160-63566182 CCTGCTCAGCCCTGGGGCACTGG - Exonic
1178457734 21:32771443-32771465 CGGCCTCAGCCCCGAGGCCCGGG + Exonic
1180079032 21:45477918-45477940 CCGTCCCTCCCCGGAGGCCCTGG - Exonic
1180285401 22:10741341-10741363 CCATTTCAGGCAGGGGGCCCTGG - Intergenic
1181573668 22:23781052-23781074 CTATCCCAGCCTGGGGGCCCAGG - Exonic
1182295831 22:29310927-29310949 TCATCTCAGGCCGGGAGCCCCGG - Exonic
1182483754 22:30626900-30626922 CCTCCTCAGCCCGGGGGCTATGG + Exonic
1183912793 22:41091945-41091967 TCGCCTCAGCCCGTGCGCCCCGG - Exonic
1183931073 22:41236615-41236637 CCTTTTCAGGCCTGGGGCCCGGG - Exonic
1184807139 22:46802564-46802586 ACTTCTCAGCCCTGGGGACCTGG - Intronic
1185329177 22:50244463-50244485 CCTTCTCAGCTCCGGGCCCCCGG + Exonic
953916436 3:46923737-46923759 CCGTCTCTCCCTGGGGGCCACGG - Intronic
954367817 3:50155523-50155545 CCGCCGCCGCCCGGGCGCCCAGG + Exonic
954705893 3:52480341-52480363 CCAGCCCAGCCAGGGGGCCCAGG - Intronic
955387436 3:58491349-58491371 CCGTCTTGCCCCGGTGGCCCCGG + Intergenic
961028916 3:123585122-123585144 CCGGCTCCGCCCCGCGGCCCTGG - Exonic
962209677 3:133466920-133466942 CTGTCTCAGCCTGGAGGCTCTGG - Exonic
962247274 3:133806075-133806097 CCCTCTCAGCCCCGCGTCCCCGG - Intronic
964743233 3:159988759-159988781 CCGGCTAAGGCCGGGGACCCAGG + Exonic
966200949 3:177359323-177359345 CTGTCGCAGCCTGGGGGCACTGG - Intergenic
968448426 4:663916-663938 CCGTGTCTGCCGGGGGTCCCAGG - Intronic
968453189 4:684613-684635 GCGTCTCAGCCCCGGAGCCCGGG + Intronic
968656941 4:1782788-1782810 CGGTCCCAGCCCGGAGGACCGGG - Intergenic
969370241 4:6727317-6727339 CCGTGCCAGCCCGGGAGCCGGGG + Intergenic
969671594 4:8592983-8593005 CCGTCGCTTCCCAGGGGCCCGGG + Intronic
969682225 4:8649748-8649770 CAGCCTCTGCCCGGGGCCCCCGG + Intergenic
972543122 4:40056637-40056659 CCGCCTCGGCGCGGCGGCCCGGG - Intergenic
973613556 4:52658895-52658917 CCGTCTCAGCCCCGGGACCTCGG - Intronic
975977559 4:80116163-80116185 CCCACTCAGCCTGTGGGCCCTGG + Intronic
981033691 4:140151072-140151094 CCCTCCCAGCCCAGCGGCCCCGG + Intronic
984963896 4:185124851-185124873 CCATCTCAGCACTGCGGCCCTGG + Intergenic
986721772 5:10565008-10565030 CCGTCTCAGGCTGGGGGACGCGG + Intronic
998041865 5:138955599-138955621 CCAGCTCGGCCAGGGGGCCCAGG + Intronic
999251544 5:150185336-150185358 CCTTCTCTCCCCGGGGGCTCTGG + Intergenic
1000945715 5:167420432-167420454 CCTTCTCAGCAGGGGAGCCCTGG + Intronic
1001950828 5:175815278-175815300 CCTTTTCAGCCCTGGGGCCAAGG - Intronic
1002449055 5:179308801-179308823 CCTTCCCACCCCAGGGGCCCTGG + Intronic
1002561155 5:180083204-180083226 CTGGCTCAGCTCAGGGGCCCAGG - Intergenic
1002679329 5:180948856-180948878 ACGTCACAGAGCGGGGGCCCAGG - Intronic
1002685207 5:181004353-181004375 ACGTCACAGAGCGGGGGCCCAGG - Intronic
1006808627 6:36805642-36805664 CCGTCCCAGCCCTGGGGCCCAGG - Intronic
1018942633 6:168319590-168319612 CGGTCCCAGCCCGCGGACCCCGG + Exonic
1018984459 6:168625707-168625729 CCGTGTGAGCCCTGGGCCCCAGG + Intronic
1019102122 6:169640035-169640057 CCATCCCAGCCCGGGTGCTCAGG - Intronic
1019184346 6:170212455-170212477 CCGCCTCTGCCCCGGAGCCCAGG + Intergenic
1019348758 7:543338-543360 GCGTGGCAGCCGGGGGGCCCGGG + Intergenic
1019428599 7:988455-988477 CCGTCCCACCCCTGGAGCCCTGG - Intronic
1019563948 7:1670579-1670601 CCGACAAAGCCCGGGGGCCCGGG + Intergenic
1019724489 7:2593579-2593601 CCGGCCCGGCCCGGGGACCCTGG + Intronic
1023823829 7:43995342-43995364 CCAGGTCAGCCCTGGGGCCCTGG + Intergenic
1024580885 7:50799900-50799922 ACGTCTCAGCCAGAGTGCCCGGG - Intergenic
1024587377 7:50853764-50853786 CGGTATCAGTCCAGGGGCCCTGG - Intergenic
1025819061 7:64946448-64946470 CCTTCCCAGCCCAGGGGCACAGG - Intergenic
1026589316 7:71681593-71681615 CCGGCACAGCCATGGGGCCCAGG - Intronic
1026867476 7:73832457-73832479 CCGCTTCAGCCCAGGGCCCCTGG + Exonic
1027138290 7:75639439-75639461 CCGTGCGAGCCCGGGGGCCGCGG - Intronic
1028752765 7:94400202-94400224 CCATCTCTGCCTGGGGGGCCTGG - Exonic
1029752098 7:102548755-102548777 CCAGGTCAGCCCTGGGGCCCTGG + Intronic
1029770050 7:102647849-102647871 CCAGGTCAGCCCTGGGGCCCTGG + Intronic
1031972326 7:128073824-128073846 CTGTCTCATCCCGAGGACCCAGG - Intronic
1032174435 7:129611968-129611990 CCGCCTCGGGCGGGGGGCCCCGG + Intronic
1033405662 7:141070519-141070541 CCGTCTTAGCCCCGAGGACCAGG + Intergenic
1033732783 7:144195500-144195522 CCGTCTCGGCCCTGGGCTCCCGG - Intronic
1033743634 7:144294080-144294102 CCGTCTCGGCCCTGGGCTCCCGG - Intergenic
1033750268 7:144355517-144355539 CCGTCTCGGCCCTGGGCTCCCGG + Intronic
1034254038 7:149714819-149714841 CCGTTTCCGCCCGGAGCCCCCGG - Intronic
1034467859 7:151240296-151240318 CTGCCCCAGCCCCGGGGCCCTGG - Intronic
1034622010 7:152463849-152463871 CCGCCTCAGCCCAGAGGACCCGG - Intergenic
1034885301 7:154794278-154794300 TCGTCTCAGCCCTCGGGCCTGGG + Intronic
1035245707 7:157561011-157561033 CCAGCTCAGCCACGGGGCCCAGG - Intronic
1035670025 8:1409861-1409883 CAGTCTAAGCCCGAAGGCCCCGG - Intergenic
1040467065 8:47705087-47705109 CGGTCTCAGCCAGAGGGCCGTGG - Intronic
1043847294 8:85177532-85177554 CCGCCGCAGCTCGGGGGCGCCGG + Exonic
1045017077 8:98009550-98009572 CCATCTCATCCCAGGGCCCCTGG - Intronic
1048865303 8:138756378-138756400 CCGTCATAGCCCAGGGGACCTGG - Intronic
1048868863 8:138780943-138780965 CCGTCTCTCCCAGGGGGGCCGGG + Exonic
1049036106 8:140077513-140077535 CTGCCTCAGCCCTGGGGCTCAGG - Intronic
1049109608 8:140635144-140635166 CGGCCCCAGCCCGCGGGCCCCGG + Intronic
1049218900 8:141420019-141420041 CCCTCTGAGTCCAGGGGCCCAGG + Intronic
1049279736 8:141738171-141738193 CCGTCTCCCCCCGGGGCTCCTGG - Intergenic
1049310793 8:141932806-141932828 CCTGCTCAGCCTGGGGGCCCTGG - Intergenic
1049346806 8:142143581-142143603 CCGTCTCAGGCAGGGGGGCGAGG + Intergenic
1049745174 8:144260248-144260270 CCCTCACAGCCCAGTGGCCCTGG + Exonic
1053022101 9:34701794-34701816 CCGGCCCAGCCCGGTGGCCGGGG + Intergenic
1053482065 9:38423451-38423473 CCTTCCCACACCGGGGGCCCTGG + Intronic
1057279025 9:93697392-93697414 CCGACTAAGCCTGGGGACCCTGG - Intergenic
1057368898 9:94451886-94451908 CCTCCTCAGCTCAGGGGCCCTGG + Intronic
1058908592 9:109500026-109500048 CCTGCTGAGCCCGGGGGCGCTGG - Intergenic
1061481177 9:130898411-130898433 CCATCTAAGCCCGGGTCCCCTGG + Intergenic
1061884271 9:133583741-133583763 CCGGCTCAGGCCAGGTGCCCAGG + Intronic
1062126250 9:134864562-134864584 TCGGCTCAGCCCTGGGGCTCTGG - Intergenic
1062268202 9:135696935-135696957 CAGCCTCTGCCCAGGGGCCCTGG + Intronic
1062398850 9:136363640-136363662 CCGCCTCAGGCAGGGCGCCCGGG + Exonic
1062525046 9:136974811-136974833 CTGTCTCCACCCTGGGGCCCCGG - Intergenic
1203731757 Un_GL000216v2:98396-98418 CCATTTCAGGCAGGGGGCCCAGG - Intergenic
1185661762 X:1734051-1734073 CCGTCTCAGGCCGGGCGCGGTGG - Intergenic
1187172918 X:16869749-16869771 CCGCCTCCGCCCCGGGGCCGAGG + Exonic
1190137090 X:47807262-47807284 CCTCCTCAGCTCGGGGGGCCGGG + Intergenic
1192577533 X:72255034-72255056 CCGGCTCAGGGCGGGGGTCCGGG + Intronic
1196734749 X:118974091-118974113 CAGTCCCAGCCCGAGAGCCCTGG - Intergenic
1198158854 X:133987294-133987316 CCTTCTCAGCCCATGGGTCCTGG - Intergenic
1198310242 X:135422553-135422575 CGGTCTCAGCCCGGGGGCCCTGG + Intergenic
1199305600 X:146263993-146264015 CCCTCTCAGCTTGGGGGACCAGG + Intergenic
1200045892 X:153400937-153400959 CCCTCTCCGCCCAGGGACCCAGG + Intergenic
1200215922 X:154368241-154368263 CCCTCTCTGCCCAGGGTCCCAGG + Intronic
1200237043 X:154472760-154472782 AGGGCTCAGCCCGGGGACCCAGG - Exonic
1201351510 Y:13047702-13047724 AAGTCACAGCCCGGGGGCACGGG + Intergenic