ID: 912879137

View in Genome Browser
Species Human (GRCh38)
Location 1:113390982-113391004
Sequence GGCGCCCCGGCCGCCCGCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 1, 2: 5, 3: 59, 4: 421}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912879122_912879137 13 Left 912879122 1:113390946-113390968 CCGCCCAGGGCCCCCGGGCTGAG 0: 1
1: 0
2: 3
3: 38
4: 442
Right 912879137 1:113390982-113391004 GGCGCCCCGGCCGCCCGCGCGGG 0: 1
1: 1
2: 5
3: 59
4: 421
912879124_912879137 9 Left 912879124 1:113390950-113390972 CCAGGGCCCCCGGGCTGAGACGG 0: 1
1: 1
2: 1
3: 14
4: 253
Right 912879137 1:113390982-113391004 GGCGCCCCGGCCGCCCGCGCGGG 0: 1
1: 1
2: 5
3: 59
4: 421
912879131_912879137 1 Left 912879131 1:113390958-113390980 CCCGGGCTGAGACGGGGCCGGAG 0: 1
1: 0
2: 3
3: 19
4: 286
Right 912879137 1:113390982-113391004 GGCGCCCCGGCCGCCCGCGCGGG 0: 1
1: 1
2: 5
3: 59
4: 421
912879117_912879137 27 Left 912879117 1:113390932-113390954 CCGGGCTGCGCGGGCCGCCCAGG 0: 1
1: 0
2: 2
3: 26
4: 293
Right 912879137 1:113390982-113391004 GGCGCCCCGGCCGCCCGCGCGGG 0: 1
1: 1
2: 5
3: 59
4: 421
912879130_912879137 2 Left 912879130 1:113390957-113390979 CCCCGGGCTGAGACGGGGCCGGA 0: 1
1: 0
2: 0
3: 10
4: 94
Right 912879137 1:113390982-113391004 GGCGCCCCGGCCGCCCGCGCGGG 0: 1
1: 1
2: 5
3: 59
4: 421
912879123_912879137 10 Left 912879123 1:113390949-113390971 CCCAGGGCCCCCGGGCTGAGACG 0: 1
1: 0
2: 0
3: 8
4: 144
Right 912879137 1:113390982-113391004 GGCGCCCCGGCCGCCCGCGCGGG 0: 1
1: 1
2: 5
3: 59
4: 421
912879128_912879137 3 Left 912879128 1:113390956-113390978 CCCCCGGGCTGAGACGGGGCCGG 0: 1
1: 0
2: 1
3: 14
4: 168
Right 912879137 1:113390982-113391004 GGCGCCCCGGCCGCCCGCGCGGG 0: 1
1: 1
2: 5
3: 59
4: 421
912879132_912879137 0 Left 912879132 1:113390959-113390981 CCGGGCTGAGACGGGGCCGGAGC 0: 1
1: 0
2: 3
3: 23
4: 206
Right 912879137 1:113390982-113391004 GGCGCCCCGGCCGCCCGCGCGGG 0: 1
1: 1
2: 5
3: 59
4: 421

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912879137 Original CRISPR GGCGCCCCGGCCGCCCGCGC GGG Exonic