ID: 912879148

View in Genome Browser
Species Human (GRCh38)
Location 1:113391005-113391027
Sequence GTCTCCCCCATGGTGCAGCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 117}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912879140_912879148 -5 Left 912879140 1:113390987-113391009 CCCGGCCGCCCGCGCGGGGTCTC 0: 1
1: 0
2: 1
3: 18
4: 160
Right 912879148 1:113391005-113391027 GTCTCCCCCATGGTGCAGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 117
912879135_912879148 7 Left 912879135 1:113390975-113390997 CCGGAGCGGCGCCCCGGCCGCCC 0: 1
1: 0
2: 2
3: 38
4: 378
Right 912879148 1:113391005-113391027 GTCTCCCCCATGGTGCAGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 117
912879131_912879148 24 Left 912879131 1:113390958-113390980 CCCGGGCTGAGACGGGGCCGGAG 0: 1
1: 0
2: 3
3: 19
4: 286
Right 912879148 1:113391005-113391027 GTCTCCCCCATGGTGCAGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 117
912879142_912879148 -10 Left 912879142 1:113390992-113391014 CCGCCCGCGCGGGGTCTCCCCCA 0: 1
1: 0
2: 0
3: 7
4: 164
Right 912879148 1:113391005-113391027 GTCTCCCCCATGGTGCAGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 117
912879141_912879148 -6 Left 912879141 1:113390988-113391010 CCGGCCGCCCGCGCGGGGTCTCC 0: 1
1: 0
2: 4
3: 14
4: 193
Right 912879148 1:113391005-113391027 GTCTCCCCCATGGTGCAGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 117
912879128_912879148 26 Left 912879128 1:113390956-113390978 CCCCCGGGCTGAGACGGGGCCGG 0: 1
1: 0
2: 1
3: 14
4: 168
Right 912879148 1:113391005-113391027 GTCTCCCCCATGGTGCAGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 117
912879139_912879148 -4 Left 912879139 1:113390986-113391008 CCCCGGCCGCCCGCGCGGGGTCT 0: 1
1: 1
2: 4
3: 15
4: 195
Right 912879148 1:113391005-113391027 GTCTCCCCCATGGTGCAGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 117
912879132_912879148 23 Left 912879132 1:113390959-113390981 CCGGGCTGAGACGGGGCCGGAGC 0: 1
1: 0
2: 3
3: 23
4: 206
Right 912879148 1:113391005-113391027 GTCTCCCCCATGGTGCAGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 117
912879130_912879148 25 Left 912879130 1:113390957-113390979 CCCCGGGCTGAGACGGGGCCGGA 0: 1
1: 0
2: 0
3: 10
4: 94
Right 912879148 1:113391005-113391027 GTCTCCCCCATGGTGCAGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912879148 Original CRISPR GTCTCCCCCATGGTGCAGCG GGG Exonic