ID: 912881555

View in Genome Browser
Species Human (GRCh38)
Location 1:113421634-113421656
Sequence TGTTATGTGAAGCTTGTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 76}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912881552_912881555 5 Left 912881552 1:113421606-113421628 CCCTACCTTTCTTCAGTATTTTA 0: 1
1: 1
2: 6
3: 54
4: 523
Right 912881555 1:113421634-113421656 TGTTATGTGAAGCTTGTACCAGG 0: 1
1: 0
2: 0
3: 10
4: 76
912881553_912881555 4 Left 912881553 1:113421607-113421629 CCTACCTTTCTTCAGTATTTTAA No data
Right 912881555 1:113421634-113421656 TGTTATGTGAAGCTTGTACCAGG 0: 1
1: 0
2: 0
3: 10
4: 76
912881554_912881555 0 Left 912881554 1:113421611-113421633 CCTTTCTTCAGTATTTTAATAAA 0: 1
1: 0
2: 2
3: 70
4: 787
Right 912881555 1:113421634-113421656 TGTTATGTGAAGCTTGTACCAGG 0: 1
1: 0
2: 0
3: 10
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912881555 Original CRISPR TGTTATGTGAAGCTTGTACC AGG Intronic
903392602 1:22975201-22975223 TTTTATGTCAAACTTCTACCTGG + Intergenic
904826783 1:33278521-33278543 TATTATTTGAATCTTTTACCTGG - Intronic
904843821 1:33392998-33393020 TGCTATCTGAAGCATGTGCCTGG - Intronic
910767566 1:90797555-90797577 TTTTATGTGAAGCTTGTAATTGG - Intergenic
911880646 1:103234812-103234834 TGTTATGTGCTGCTTTTAGCTGG - Intergenic
912518453 1:110230071-110230093 TGTTGTGTAAAGCCTGTGCCCGG + Intronic
912881555 1:113421634-113421656 TGTTATGTGAAGCTTGTACCAGG + Intronic
912993140 1:114509438-114509460 TGTTATGTGAGACTTTTATCAGG - Intronic
916855380 1:168743926-168743948 AGTTATGTGAATCCTATACCTGG + Intergenic
919040232 1:192377867-192377889 TGTTATGTGTAGCTTGTAGAGGG - Intergenic
921945962 1:220886354-220886376 TGTTATCTGTATCTTGTATCTGG - Intergenic
924131044 1:240908601-240908623 TCTTAGGTGGAGCTTTTACCTGG - Intronic
1082943333 11:58731986-58732008 TGTAATGTGGACCTTGTACTAGG + Intergenic
1086147550 11:83569593-83569615 TGTTATGTAATGATTGTTCCAGG + Intronic
1092933790 12:13341260-13341282 TGCTATGTGAAGCTTGAAAAGGG - Intergenic
1100112203 12:91259511-91259533 TGTCAAGTGAAGGTTGTACTGGG - Intergenic
1103397097 12:120616432-120616454 TGTTATGTGAATCTTGTCTCAGG - Intergenic
1104079123 12:125414964-125414986 TGTTCTGTGAACATTGTACCAGG + Intronic
1107819603 13:44274285-44274307 AGTGAAGTGAAGCTTCTACCTGG - Intergenic
1109098863 13:58152741-58152763 TTTTATGTGATCCTTGTGCCAGG + Intergenic
1115372598 14:32634843-32634865 TATTAAGTGAGGCTTGTACTGGG + Intronic
1119653557 14:76400521-76400543 TATAATGTGATGCTTGTACTAGG + Intronic
1120227691 14:81809532-81809554 TGTTATGTGCAGCTGGAGCCTGG + Intergenic
1121882878 14:97516020-97516042 TGTGTTTTGAAGTTTGTACCAGG - Intergenic
1122207495 14:100155278-100155300 TGTGAGGAGAAGCTTGTCCCAGG - Intronic
1126150269 15:45517578-45517600 TGTTATGTGAAGAATGGATCGGG - Intronic
1130082959 15:80750652-80750674 AGTTTTGTGCAGTTTGTACCAGG + Intronic
1134772113 16:16818235-16818257 TGTTATGTGAGCCTTCCACCTGG + Intergenic
1203172057 17_GL000205v2_random:157520-157542 TGTTTTGTGATGCTTCTGCCTGG - Intergenic
1203173663 17_GL000205v2_random:175216-175238 TGTTTTGTGATGCTTCCACCTGG + Intergenic
1155891451 18:31275700-31275722 TGATATGGGAAGCTTGGACCAGG - Intergenic
1163328522 19:16620914-16620936 TGTTATGTGAAGCTTCCAGAAGG + Intronic
926220092 2:10930454-10930476 GGTTTTGTGAAGCCTGAACCTGG + Intergenic
927416759 2:22888326-22888348 TGTTTTATAAAGCTTGTCCCAGG + Intergenic
940979328 2:159983760-159983782 TTTTATGTTTATCTTGTACCAGG - Intronic
940991407 2:160100267-160100289 TGTAATGTGAAGCTTTTACTAGG - Exonic
943257105 2:185609304-185609326 TGTTATGTAAATATTTTACCAGG - Intergenic
1173919737 20:46734722-46734744 TATAATGGGAAGCCTGTACCAGG + Exonic
1175545890 20:59777494-59777516 TGTGCTGTGAAGCTTGGACTTGG + Intronic
1176328041 21:5519357-5519379 TGTTTTGTGATGCTTCTGCCTGG - Intergenic
1176329652 21:5536862-5536884 TGTTTTGTGATGCTTCCACCTGG + Intergenic
1176398105 21:6284089-6284111 TGTTTTGTGATGCTTCCACCTGG - Intergenic
1176399716 21:6301594-6301616 TGTTTTGTGATGCTTCTGCCTGG + Intergenic
1176437441 21:6687510-6687532 TGTTTTGTGATGCTTCTGCCTGG - Intergenic
1176439052 21:6705015-6705037 TGTTTTGTGATGCTTCCACCTGG + Intergenic
1176461703 21:7014580-7014602 TGTTTTGTGATGCTTCTGCCTGG - Intergenic
1176463314 21:7032084-7032106 TGTTTTGTGATGCTTCCACCTGG + Intergenic
1176485264 21:7396358-7396380 TGTTTTGTGATGCTTCTGCCTGG - Intergenic
1176486875 21:7413863-7413885 TGTTTTGTGATGCTTCCACCTGG + Intergenic
1177531595 21:22365698-22365720 TGTTATATGTATCTTGGACCAGG - Intergenic
1178078410 21:29035089-29035111 TATTATGAGAAGCTTTTACTTGG + Intronic
949373491 3:3361508-3361530 TGTTCCGTGAAGCATATACCAGG + Intergenic
956187079 3:66573042-66573064 TGTTATGTAGAGCTGGTACCTGG + Intergenic
957390784 3:79565702-79565724 TATTATGTGAAGCTTTCACTAGG - Intronic
966167841 3:177041225-177041247 AGTTCTGTGAAGTTTGTCCCTGG - Intronic
969858278 4:10017246-10017268 AGTTATGTGAAACTTACACCTGG - Intronic
971747806 4:30607136-30607158 TGATAAGTTAAGATTGTACCAGG + Intergenic
976660320 4:87534055-87534077 TGGTTTGTGAAGCTTCTGCCTGG + Intergenic
977686275 4:99850435-99850457 TATTATGTGAAGTGTGTGCCTGG + Intronic
983892000 4:173039156-173039178 TGTTATCTGCATCATGTACCTGG + Intronic
984484513 4:180351018-180351040 TGTTCTGTGTATCTTGTAACTGG + Intergenic
992284208 5:75216403-75216425 TGCTATGTGATTGTTGTACCAGG - Intronic
992518225 5:77519579-77519601 TTTCTTGTGAAACTTGTACCAGG + Intronic
997546460 5:134712172-134712194 TGTTATGTGTAGTTTTTTCCAGG + Intronic
999517782 5:152318359-152318381 TGTCATGTTAAGCTTGAAACAGG - Intergenic
1010471038 6:76228933-76228955 TCTTATGTGATTCTTGTACCAGG + Intergenic
1012944076 6:105447738-105447760 TGTTCTGTGAAGATTGAAGCTGG + Intergenic
1016552090 6:145293398-145293420 TGTTATGCCAAACTTGTATCTGG - Intergenic
1024123699 7:46270541-46270563 TGATTTTTGAAGCTTGTCCCAGG + Intergenic
1024493773 7:50018214-50018236 TGTTATGTGAGGCTGGTAAAAGG - Intronic
1031238866 7:119212782-119212804 TGTTGTTTGAAGCTTTTATCAGG + Intergenic
1045719161 8:105086965-105086987 TTTCAGGTTAAGCTTGTACCTGG - Intronic
1047399823 8:124536707-124536729 TCCCATGTGAAGCTTGTTCCAGG + Intronic
1048115753 8:131520196-131520218 TGTTATGTGAAGTATCTAGCAGG + Intergenic
1048948138 8:139469678-139469700 TGTTATATGAAGGTTGCAACAGG - Intergenic
1050312488 9:4367538-4367560 TGTTCTCTGTAGCTTGAACCCGG + Intergenic
1051835606 9:21334690-21334712 TGTGATGTGACCCTGGTACCAGG - Exonic
1054810308 9:69429041-69429063 CGTTATGTGCAGGTTGTACAGGG + Exonic
1056061840 9:82891312-82891334 TGTTAGATGAAGCCTGGACCTGG - Intergenic
1062665835 9:137670981-137671003 TGTTGTGTGACTCTTGTTCCAGG + Intronic
1203432443 Un_GL000195v1:103464-103486 TGTTTTGTGATGCTTCCACCTGG - Intergenic
1203434066 Un_GL000195v1:121101-121123 TGTTTTGTGATGCTTCTGCCTGG + Intergenic
1187084671 X:16029557-16029579 TGTTATGAGAAGCATGCACCAGG - Intergenic
1195420198 X:104666979-104667001 TATTTTGTGAGGCTTGCACCAGG + Intronic
1197909012 X:131460193-131460215 TGTTTTGTGAATCTTGAACCAGG - Intergenic
1199449291 X:147961649-147961671 TGTTCAGGGAAGCATGTACCTGG - Intergenic
1202071892 Y:21000519-21000541 AGTTATGTGAATCTCCTACCTGG - Intergenic