ID: 912889906

View in Genome Browser
Species Human (GRCh38)
Location 1:113519063-113519085
Sequence CTGTTTTCATAGAGAGAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 779
Summary {0: 1, 1: 0, 2: 4, 3: 68, 4: 706}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912889906_912889908 1 Left 912889906 1:113519063-113519085 CCTAATTCTCTCTATGAAAACAG 0: 1
1: 0
2: 4
3: 68
4: 706
Right 912889908 1:113519087-113519109 AACCAAAGCCTCAAGAATTTGGG 0: 1
1: 0
2: 0
3: 30
4: 246
912889906_912889907 0 Left 912889906 1:113519063-113519085 CCTAATTCTCTCTATGAAAACAG 0: 1
1: 0
2: 4
3: 68
4: 706
Right 912889907 1:113519086-113519108 AAACCAAAGCCTCAAGAATTTGG 0: 1
1: 0
2: 3
3: 22
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912889906 Original CRISPR CTGTTTTCATAGAGAGAATT AGG (reversed) Intronic
900568835 1:3348475-3348497 CTGTCTTCATTGAGAGCAGTGGG + Intronic
900957637 1:5897021-5897043 CAGTTTTCAGAGTGAGAAGTCGG - Intronic
903350713 1:22714872-22714894 CTGTTTTAGAAGAGAGAATCAGG - Intronic
904124754 1:28230318-28230340 CTGTTTTCATAGAGTGAAGAGGG - Intronic
904367311 1:30022475-30022497 CTATTTTGCCAGAGAGAATTAGG - Intergenic
905251979 1:36655136-36655158 CTGTTTTTCTGGAGAGACTTTGG - Intergenic
905498020 1:38410753-38410775 CTGGTTTCATAGAATGAGTTGGG - Intergenic
906053672 1:42896781-42896803 CTGGCTTCATAGAATGAATTAGG + Intergenic
906131160 1:43457933-43457955 CTGCCTTCATAGAATGAATTAGG - Intergenic
907541193 1:55216180-55216202 AGGTTTTCATACAGAGAACTGGG - Intergenic
908298864 1:62741397-62741419 CTGGCTTCATAGAATGAATTAGG - Intergenic
908345149 1:63225039-63225061 CTGTTTTCATAGAATGATTTGGG - Intergenic
908547301 1:65174324-65174346 TTGTATTCTTAGAGAGACTTGGG - Intronic
908867284 1:68563291-68563313 TTGGTTTCATAGAAAGAGTTAGG + Intergenic
909098607 1:71321879-71321901 CTGGCTTCATAGAATGAATTAGG - Intergenic
909141705 1:71875393-71875415 CTGCTTTTACAGAGAGAAGTAGG - Intronic
909703828 1:78556920-78556942 CTGGTTTCATAGAATGAATTAGG - Intergenic
910077952 1:83302475-83302497 CTGGCTTCATAGAATGAATTAGG - Intergenic
910358403 1:86390023-86390045 CTGGTTTCATAGAATGATTTAGG - Intronic
910582144 1:88840305-88840327 CTGATTTCATAAAATGAATTGGG - Intergenic
910598078 1:89000997-89001019 CTGTGCTCATAGAATGAATTGGG + Intergenic
910708480 1:90154850-90154872 CTGTTTTTATAGGGAGGATCAGG + Intergenic
911373459 1:97023166-97023188 CTGGCTTCATAGAATGAATTAGG - Intergenic
912620776 1:111154991-111155013 CTGGTTTCGTAGAATGAATTAGG + Intronic
912889906 1:113519063-113519085 CTGTTTTCATAGAGAGAATTAGG - Intronic
913312825 1:117519815-117519837 CTGGCTTCATAGAATGAATTAGG - Intronic
913464018 1:119120535-119120557 ATGTTTTCATAGAATGATTTAGG - Intronic
913663426 1:121025544-121025566 CTGGTTTCATAGAATGAGTTAGG - Intergenic
914014817 1:143808812-143808834 CTGGTTTCATAGAATGAGTTAGG - Intergenic
914163004 1:145152395-145152417 CTGGTTTCATAGAATGAGTTAGG + Intergenic
914653438 1:149717369-149717391 CTGGTTTCATAGAATGAGTTAGG - Intergenic
915773148 1:158451921-158451943 TTGTTTTCATAGAATGAATTAGG - Intergenic
915992945 1:160535186-160535208 CTGGTGTCACAGAGTGAATTAGG + Intergenic
916156634 1:161856184-161856206 CTGTTTTCATACATAAAATGAGG + Intronic
916331419 1:163621662-163621684 CTGGCTTCATAGAAAGATTTAGG + Intergenic
916580926 1:166107628-166107650 CTGGCTTCATAGAATGAATTAGG - Intronic
916641532 1:166733591-166733613 CTGGCTTCATAGAATGAATTAGG - Intergenic
917057612 1:171000744-171000766 CTGACTTCATAGAATGAATTAGG + Intronic
917329051 1:173862895-173862917 CTTTTTTCTTAGACAAAATTGGG + Intergenic
917763104 1:178185890-178185912 CTGGCTTCATAGATTGAATTAGG + Intronic
917800730 1:178567638-178567660 CTGTCCTCATAGAATGAATTAGG + Intergenic
917898172 1:179513569-179513591 CTGCCTTCATAGAATGAATTAGG + Intronic
917907691 1:179603882-179603904 CTGGTTTTATAGAATGAATTAGG + Intronic
918158655 1:181875909-181875931 CTGGCTTCATAGAATGAATTAGG - Intergenic
918749627 1:188256812-188256834 CTGGCTTCATAGAATGAATTAGG + Intergenic
919115208 1:193272983-193273005 CTGGCTTCATAGAATGAATTAGG + Intergenic
919126307 1:193397302-193397324 CTGTTTTCCTCCAGGGAATTTGG + Intergenic
919397944 1:197073585-197073607 CTGGCTTCATAGAATGAATTAGG - Intergenic
919549191 1:198963373-198963395 CTGGCTTCATAGAATGAATTAGG + Intergenic
920822791 1:209397049-209397071 TTGCTTTCATAAAGAGAAATAGG - Intergenic
921148548 1:212381914-212381936 CTGTTCTCAGAGAGAGAAGGAGG + Intronic
921831431 1:219732211-219732233 CTGTTTTCATATTGGAAATTTGG - Intronic
922084657 1:222334598-222334620 GTGTTTTCATAGACAAAAATGGG + Intergenic
922377316 1:224981291-224981313 CTGGCTTCATAGAATGAATTAGG + Intronic
922396545 1:225207738-225207760 CTGGTTTCAGAGAGAGAATTGGG - Intronic
922927062 1:229357913-229357935 CTGGCTTCATAGAATGAATTAGG + Intergenic
923122531 1:231006103-231006125 CTGGTTTCATAGAATGATTTAGG - Intergenic
923371017 1:233312605-233312627 CTACCTTCATACAGAGAATTTGG - Intergenic
923691649 1:236199394-236199416 CTGGTTTCATAGAATGATTTAGG + Intronic
923808360 1:237285529-237285551 CTGGCTTCATAGAATGAATTAGG + Intronic
923875604 1:238043413-238043435 CTGGCTTCATAGAATGAATTAGG - Intergenic
923909849 1:238429230-238429252 CTGGCTTCATAGAAATAATTAGG + Intergenic
924701751 1:246461559-246461581 TTGTTTTGCTAGAGAGAATTAGG + Intronic
1063946916 10:11185843-11185865 CTGATCTCATAGAATGAATTGGG + Intronic
1064635461 10:17361653-17361675 CTGTTCTCATATAGTGAGTTGGG - Intronic
1064907838 10:20366996-20367018 CTGTCTTCATAGAATGAATTAGG + Intergenic
1065181761 10:23133484-23133506 GTCTTTTCATGGACAGAATTGGG - Intergenic
1065470663 10:26078002-26078024 CTGGTTTTATAGAATGAATTAGG + Intronic
1066145227 10:32550903-32550925 CTGGCTTCATAGAATGAATTAGG + Intronic
1066632390 10:37469832-37469854 CTGTTTTCCCAGACAGAACTGGG - Intergenic
1067405356 10:46018174-46018196 GTGTTTTCATACAGGTAATTAGG - Intronic
1068007289 10:51406529-51406551 CTTTTTCCATATAGAGAATCTGG - Intronic
1068138664 10:52976771-52976793 CTGGTTTCATATTGAGAATAAGG - Intergenic
1068924651 10:62523203-62523225 CTGGCTTCATAGAGTGATTTAGG + Intronic
1069166667 10:65168873-65168895 CTGGTTTCATAGAATGAGTTAGG + Intergenic
1069242416 10:66159681-66159703 CTGGCTTCATAGAATGAATTAGG + Intronic
1069325682 10:67228954-67228976 CTGGCTTCATAGAGTGAATTAGG - Intronic
1070161328 10:73868345-73868367 CTGTCTTCCTAGAGTGACTTGGG - Intronic
1070390921 10:75969892-75969914 CTGATATCATAGACAGTATTTGG + Intronic
1070863754 10:79693447-79693469 TTCTGTTCATAGAGAGAAGTGGG + Intergenic
1071405534 10:85326841-85326863 CTGGCTTCATAGAATGAATTAGG + Intergenic
1071737852 10:88321941-88321963 CTGGTTTCATAGAATGAGTTGGG - Intronic
1072815203 10:98501180-98501202 CTGGCTTCATAGAATGAATTAGG - Intronic
1072928316 10:99636926-99636948 CTGGCTTCATAGAATGAATTAGG - Intergenic
1073507950 10:104017971-104017993 CTTTTTTCTTAGACTGAATTGGG + Intronic
1074037057 10:109750501-109750523 CTGGTTTCATAGAATGATTTAGG + Intergenic
1074210190 10:111325094-111325116 CTGGTTTCATAGAATGAGTTAGG - Intergenic
1078348799 11:10575370-10575392 CTGTTTTCAAAGAGAGAATAGGG + Exonic
1078592890 11:12660689-12660711 CTGGCTTCATAGAATGAATTAGG + Intergenic
1080152736 11:29073035-29073057 CTGGCTTCATAGAATGAATTAGG + Intergenic
1080567372 11:33523988-33524010 CTGGTTTCATAAAATGAATTGGG + Intergenic
1080672237 11:34391558-34391580 CTGGCTTCATAGAATGAATTAGG + Intergenic
1080799443 11:35596512-35596534 CTGACTTCATAGAGTGATTTAGG + Intergenic
1080863582 11:36172832-36172854 CTGGCTTCATAGAAAGATTTAGG + Intronic
1080933037 11:36833442-36833464 CTGGCTTCATAGATTGAATTAGG + Intergenic
1081221947 11:40473090-40473112 CTGGTTTCATAGAATGAGTTAGG - Intronic
1081844086 11:46226001-46226023 CTGGCTTCATAAAAAGAATTTGG - Intergenic
1082206883 11:49447417-49447439 CTGTCTTCATAGAATGATTTAGG - Intergenic
1083299125 11:61731107-61731129 CTGGTTGCATGGAGATAATTAGG + Intronic
1084220826 11:67677089-67677111 CTGGCTTCATAGAATGAATTAGG - Intronic
1084994142 11:72958888-72958910 CTGTTTCCATAGATGGAAATGGG - Intronic
1085748213 11:79133488-79133510 CTGGCTTCATAGAATGAATTAGG - Intronic
1086010421 11:82096323-82096345 CTGTTTTCCTATATAGAATGTGG - Intergenic
1086127749 11:83366588-83366610 CTTTTTTAATAAAGAGAATGGGG - Intergenic
1086601419 11:88638488-88638510 CTGTCTTCATTGATTGAATTAGG + Intronic
1086648389 11:89254333-89254355 CTGTCTTCATAGAATGATTTAGG + Intronic
1086994279 11:93338902-93338924 CTATTTTCATAGATACACTTGGG + Intronic
1087296553 11:96382642-96382664 CTGTTTTCTTAAAGATAATATGG - Intronic
1087304853 11:96476691-96476713 CTGGCTTCATAGAATGAATTAGG - Intronic
1087688652 11:101294319-101294341 CTGGTTTCATAGAATGATTTAGG + Intergenic
1087845958 11:102972572-102972594 ATGTTTTCTTAGAGAGAAAGAGG - Intergenic
1088346533 11:108833335-108833357 CTTTTTCCATAGATAGAGTTGGG + Intronic
1088387760 11:109278472-109278494 CTGGCTTCATAGAATGAATTAGG + Intergenic
1088425756 11:109700085-109700107 CTGGTTTCATAGAATGAGTTAGG - Intergenic
1088520864 11:110698425-110698447 CTGGTTTCATAGAACGAGTTAGG + Intronic
1088747525 11:112816970-112816992 CTCTCTTCCTAGAGAGAACTGGG - Intergenic
1088759848 11:112918979-112919001 CTGTTTTGAAAGAGAAAAATAGG + Intergenic
1089161827 11:116444324-116444346 GTGTTTTGATAGAAAGAATGTGG - Intergenic
1089208506 11:116784681-116784703 TTGTGTTCAAAGAGAAAATTAGG - Intronic
1089952598 11:122543470-122543492 CTGGCTTCATAGAATGAATTAGG + Intergenic
1089999060 11:122938115-122938137 CTGTTTTCATAGATTGAGCTGGG + Intronic
1090090162 11:123689483-123689505 CTGTTTCCATATAGATAATCAGG + Intergenic
1090848879 11:130553555-130553577 GTGTTATTATAGAGAGAATTAGG + Intergenic
1091052883 11:132389672-132389694 CTGTGCTCATAGAGTGAGTTTGG - Intergenic
1091210172 11:133850879-133850901 CTGGCTTCATAGAATGAATTAGG + Intergenic
1092583308 12:9872117-9872139 CTGAATTCAGAGAGAGTATTGGG + Intergenic
1092586879 12:9909415-9909437 CTGTTTTCAGGGAGAGAAAGGGG - Intronic
1092954024 12:13532761-13532783 TTGATTTCATAGGGAGAATGGGG + Intergenic
1093278156 12:17154506-17154528 CTGTCTTCATAGAATGATTTAGG - Intergenic
1093344144 12:18019611-18019633 CTGATCTCATATATAGAATTAGG - Intergenic
1093598013 12:20985075-20985097 CTGGCTTCATAGAATGAATTAGG + Intergenic
1093646880 12:21596241-21596263 CTGGCTTCATAGAATGAATTAGG - Intronic
1093720874 12:22440591-22440613 CTGGCTTCATAGAATGAATTAGG - Intergenic
1093951880 12:25171607-25171629 CTGGCTTCATAGAATGAATTAGG - Intronic
1093995264 12:25634321-25634343 CTGGCTTCATAGAATGAATTAGG - Intronic
1094055283 12:26262927-26262949 CTGGTCTCATAGAATGAATTAGG - Intronic
1094097018 12:26717895-26717917 GTGTTTTCCTAGGGAGAATGGGG - Intronic
1094241708 12:28234234-28234256 CTGTGTTCATAGAAAAGATTTGG - Intronic
1094293961 12:28882509-28882531 CGTTTTTCATAGAGATGATTAGG + Intergenic
1094810103 12:34128202-34128224 CTGGCTTCATAGAATGAATTAGG - Intergenic
1095115507 12:38347037-38347059 CTGGCTTCATAGAATGAATTAGG - Intergenic
1095244795 12:39907346-39907368 CTTTCTTCATTGAGAAAATTAGG - Intronic
1095722375 12:45414681-45414703 ATGTTTGCATAGACAGTATTGGG - Intronic
1095733052 12:45526098-45526120 CTGCCTTCATAGAATGAATTAGG - Intergenic
1096032169 12:48428803-48428825 CTGGCTTCATAGAATGAATTAGG - Intergenic
1096348181 12:50869635-50869657 ATGGCTTCATAGAAAGAATTAGG - Intronic
1096368664 12:51050151-51050173 CTGTTTTCATGTAGATAAATAGG + Intronic
1096437622 12:51607932-51607954 CTGGCTTCATAGAATGAATTAGG + Intronic
1096957164 12:55538293-55538315 CTGGCTTCATAGAGTGAATTAGG - Intergenic
1097295804 12:57961408-57961430 CTGGCTTCATAGAATGAATTAGG - Intergenic
1098378781 12:69845593-69845615 CTGGCTTCATAAAAAGAATTTGG - Intronic
1098786186 12:74758875-74758897 CTGGTTTCATAGAATGATTTAGG + Intergenic
1099124905 12:78741878-78741900 CTGTTTTAATAGGCAGAGTTTGG + Intergenic
1099288456 12:80745187-80745209 CTGTTTTAATATAGAAAATTTGG - Intergenic
1099476769 12:83117256-83117278 CTGGTTTTATAGAATGAATTAGG - Intronic
1099860989 12:88226003-88226025 CTGTTTTCATATAGTGAGTGAGG - Intergenic
1099900579 12:88706322-88706344 CTGGTTTCATAGAATGAGTTAGG + Intergenic
1100290689 12:93211742-93211764 CTGGCTTCATAGAGTGAATTAGG + Intergenic
1100467895 12:94864255-94864277 CTGGTCTCATAGAATGAATTAGG - Intergenic
1100932248 12:99622881-99622903 CTGGTTTCATAGAAAGAGATAGG - Intronic
1100945007 12:99772553-99772575 CTGAGTTCATAGAGAAAATGGGG + Intronic
1101634968 12:106532274-106532296 CTGGCTTCATAGAATGAATTAGG + Intronic
1101649623 12:106664062-106664084 CTGACTTCATAGAAAGAGTTAGG + Intronic
1102916423 12:116756833-116756855 CTGGCTTCATAGAATGAATTAGG + Intronic
1103025325 12:117569373-117569395 CTGTTTACATAAAAAGAAGTAGG + Intronic
1103083992 12:118047539-118047561 GTATTTTAAAAGAGAGAATTTGG - Intronic
1103133795 12:118490372-118490394 CTGTTTTTATGGGGAGAATTGGG + Intergenic
1103912327 12:124359434-124359456 CAGTCTTCAAGGAGAGAATTGGG - Intronic
1104181035 12:126380997-126381019 CTGGTTTCATAGAATGATTTAGG - Intergenic
1105865967 13:24460236-24460258 CTGTTTTCTGAGGAAGAATTTGG - Intronic
1105908575 13:24838319-24838341 CTGGCTTCATAGAATGAATTAGG - Intronic
1106624223 13:31403613-31403635 CAGTTTGCATAGAGAGAAAGAGG - Intergenic
1106888522 13:34216802-34216824 CTGTTATAATAGAGAGCCTTTGG - Intergenic
1107133932 13:36923976-36923998 CTGTGTTCATATAGTTAATTCGG - Intergenic
1107487462 13:40842865-40842887 CTGGCTTCATAGAATGAATTAGG - Intergenic
1108143755 13:47454590-47454612 CTGGTTTCATAGAATGAGTTGGG + Intergenic
1108261727 13:48664333-48664355 CTGGCTTCATAGAATGAATTAGG + Intronic
1108626957 13:52239180-52239202 CTGGCTTCATAGAATGAATTAGG - Intergenic
1108659109 13:52567279-52567301 CTGGCTTCATAGAATGAATTAGG + Intergenic
1108882771 13:55141621-55141643 CTGGTTTCATAGAATGAGTTAGG + Intergenic
1109337399 13:61009617-61009639 CTCTTTTAAAAGAGAGAAATTGG - Intergenic
1110945530 13:81410782-81410804 CTGTGTTCATACAGTGAATTAGG + Intergenic
1110966811 13:81710081-81710103 CTGGCTTCATAGAATGAATTAGG + Intergenic
1111153358 13:84289422-84289444 CTGGCTTCATAGAATGAATTAGG - Intergenic
1111230198 13:85335475-85335497 CTACATTCATAGAGAGAATGAGG - Intergenic
1111354611 13:87081439-87081461 CTGCTTTCACCGAGAGAATAAGG - Intergenic
1111563025 13:89977702-89977724 CTGTTTTCATAGATTTATTTAGG - Intergenic
1111767750 13:92555198-92555220 ATATGTTCATAGTGAGAATTTGG - Intronic
1111871619 13:93839972-93839994 CTGGCTTCATAGAATGAATTAGG + Intronic
1112055730 13:95689090-95689112 CTGGTTTCATAGAATGAGTTAGG + Intronic
1112532634 13:100219771-100219793 CTGTTTTATTCAAGAGAATTGGG - Intronic
1112738426 13:102446971-102446993 CTGACTTCATAGAATGAATTAGG - Intergenic
1113178346 13:107594595-107594617 CTGTTTTCATAAACACTATTGGG - Intronic
1113330363 13:109320646-109320668 CTGGCTTCATAGAATGAATTAGG - Intergenic
1113347141 13:109489939-109489961 CTGTTTTTATAGAGGGATTCAGG + Intergenic
1114691878 14:24590712-24590734 CTGGCTTCATAGAATGAATTAGG + Intergenic
1114711065 14:24778869-24778891 ATGTTTTAATATAGAGAACTAGG + Intergenic
1114912355 14:27216578-27216600 CAGTTTGCATAGAGAGAAAGAGG + Intergenic
1115997336 14:39208186-39208208 CTGGCTTCATAGAATGAATTAGG - Intergenic
1116021310 14:39464969-39464991 CTGTCTTCTTAGAATGAATTTGG + Intergenic
1116347049 14:43807119-43807141 CTGGCTTCATAGAATGAATTAGG - Intergenic
1116576737 14:46584951-46584973 CAGTTTACATAGAGAGAAAGAGG + Intergenic
1116652372 14:47609853-47609875 CTGGCTTCATAGAATGAATTAGG - Intronic
1116920135 14:50563336-50563358 ATGTTTTCATGGAGAGAATGGGG + Intronic
1116944949 14:50828262-50828284 TTGTTTTTAAAGTGAGAATTAGG + Intronic
1117222312 14:53618357-53618379 GTGATTTAATAGAGGGAATTAGG + Intergenic
1117398161 14:55332636-55332658 ATGTTTTCATAGGGAGAACTTGG + Intronic
1117729575 14:58708538-58708560 TTGTTTGCCTAGAGAGAATTCGG - Intergenic
1117998789 14:61503780-61503802 CTGTTTTCATAAAAAGAAAGAGG + Intronic
1118133231 14:62991370-62991392 CTGCTTTCAGAAAGAGAACTGGG + Intronic
1118196879 14:63635114-63635136 CTGGCTTCATAGAATGAATTAGG - Intronic
1118343620 14:64917130-64917152 CTTATTTCAAAGAAAGAATTAGG + Intronic
1118423820 14:65635840-65635862 CTGGCTTCATAGAATGAATTAGG + Intronic
1119008339 14:70956239-70956261 ATGTTTTCTTAGAAAGAATAAGG + Intronic
1119458262 14:74775414-74775436 CTGTTTGCATATGGAAAATTAGG + Intronic
1119677122 14:76564210-76564232 TTGTTTGCATAGAGACAACTGGG + Intergenic
1119973486 14:78999080-78999102 ATGTTTTCAAACAAAGAATTTGG + Intronic
1121460162 14:94069497-94069519 CTGGCTTCATAGAATGAATTAGG - Intronic
1121922015 14:97890714-97890736 CTGATTTCATTGAAGGAATTTGG - Intergenic
1123103965 14:105828120-105828142 CTGGCTTCATAGAATGAATTAGG + Intergenic
1123490589 15:20777203-20777225 CTGTCTTCATAGAATGAGTTTGG + Intergenic
1124557430 15:30739588-30739610 CTGGCTTCATAGAATGAATTAGG - Intronic
1124810483 15:32932504-32932526 CTGTTCTCATAAAATGAATTTGG + Intronic
1125371267 15:38980067-38980089 CTGGTTTCATAGAATGAGTTGGG + Intergenic
1125846721 15:42862221-42862243 CAGGTTTCATAGAATGAATTAGG - Intronic
1125847949 15:42875498-42875520 CTGTTTTCATCAACAGAATAGGG + Intronic
1126060220 15:44773688-44773710 CTGGCTTCATAGAATGAATTAGG + Intergenic
1126528260 15:49682626-49682648 CTATCTTCAAGGAGAGAATTAGG + Intergenic
1126573384 15:50173778-50173800 CTGGCTTCATAGAATGAATTAGG - Intronic
1127688426 15:61371196-61371218 CTATTTTCATGCAGTGAATTTGG - Intergenic
1127924069 15:63521204-63521226 CTGTTTTAAAAAAGAGAATAAGG - Intronic
1128808369 15:70551820-70551842 TTGTTTTCATAGAGACTATTGGG - Intergenic
1129044829 15:72725553-72725575 CTGTTTTCAGAGATATTATTAGG + Intronic
1129096598 15:73215787-73215809 CTGGCTTCATAGAATGAATTAGG + Intronic
1130058094 15:80546520-80546542 ATGTTTTGGTAGAGAGATTTGGG + Intronic
1130794080 15:87190020-87190042 CTGTTTCCAAAAAGAGATTTTGG - Intergenic
1131693451 15:94851053-94851075 CTGCCTTCATAGAATGAATTAGG + Intergenic
1131943436 15:97592867-97592889 CTGTTGTCATAGCCAGAATTGGG - Intergenic
1132170907 15:99653341-99653363 CTGTTCTCAGAGAGAGACTAGGG + Intronic
1132182947 15:99775570-99775592 ATATGTTCATAGTGAGAATTTGG + Intergenic
1132267763 15:100491067-100491089 CTGTTTTGAGAGACAGATTTTGG - Intronic
1132323862 15:100949514-100949536 CTGGTTTCATAGACTGAATTGGG - Intronic
1202955421 15_KI270727v1_random:73506-73528 CTGTCTTCATAGAATGAGTTTGG + Intergenic
1132506517 16:312418-312440 CCCTTTTCTTGGAGAGAATTAGG + Intronic
1132817429 16:1838307-1838329 CTGTTTTGATAGAGAAGATAAGG + Intronic
1133733600 16:8596847-8596869 TTGTTTTCAGCCAGAGAATTGGG + Intergenic
1135085907 16:19474308-19474330 CTATTTCCACAGAGAGAAGTGGG + Intronic
1137224151 16:46486253-46486275 CTGTATTCATAGAATGAGTTAGG - Intergenic
1137975884 16:53031640-53031662 CTTTTTTGTTAGGGAGAATTAGG + Intergenic
1138004966 16:53324779-53324801 CTGTTTTCATTGAGAGGACTTGG - Exonic
1138715792 16:59020720-59020742 CTGGTTTCATGGTAAGAATTTGG + Intergenic
1138759879 16:59530458-59530480 CTGATTTTATAGAGAAATTTGGG - Intergenic
1139116040 16:63954276-63954298 CTCTTATTATAGAGAAAATTTGG - Intergenic
1139126482 16:64084227-64084249 CTGTTTTAAAAGCCAGAATTAGG - Intergenic
1139151908 16:64391881-64391903 TTGGTGTCATAGAGAGAATTAGG + Intergenic
1139987605 16:70912635-70912657 CTGGCTTCATAGAATGAATTAGG + Intronic
1140152418 16:72382696-72382718 CTCGTTTCATAGAGTGAGTTTGG - Intergenic
1140568271 16:76070362-76070384 TTGTTTTTATAGATAGTATTGGG + Intergenic
1143721420 17:8813387-8813409 CTGGCTTCATAGAATGAATTAGG - Intronic
1144370801 17:14589743-14589765 CTGTGTTCAGGGAGAGAAATAGG + Intergenic
1144407885 17:14970092-14970114 CTGGCTTCATAGAATGAATTAGG + Intergenic
1145387397 17:22425789-22425811 CTGATTTCATAGATTGAGTTGGG + Intergenic
1146099273 17:29963549-29963571 CTATCCTCATAGAAAGAATTAGG + Intronic
1146751083 17:35381314-35381336 CTGGCTTCATAGAATGAATTAGG + Intergenic
1147517014 17:41128484-41128506 CTGGCTTCATAGAATGAATTAGG - Intergenic
1147529732 17:41264447-41264469 CTGTTTTCAGTGAGGGAATTAGG - Intergenic
1148407944 17:47436278-47436300 CTGGCTTCATAGAATGAATTAGG + Intronic
1149152715 17:53588459-53588481 CTGGTTTCATAGAATGAATTAGG - Intergenic
1149410606 17:56402198-56402220 CTGGCTTCATAGAATGAATTGGG + Intronic
1149535246 17:57428626-57428648 CTGTTTTCATATTTAGAATGAGG + Intronic
1149935015 17:60796234-60796256 CTGGCTTCATAGAATGAATTAGG + Intronic
1150818463 17:68414534-68414556 CTGGCTTCATAGAATGAATTAGG + Intronic
1151497765 17:74469038-74469060 CTGGCTTCATGGAAAGAATTAGG + Intronic
1153069194 18:1086053-1086075 CTGGCTTCATAGACTGAATTAGG + Intergenic
1153702418 18:7710032-7710054 CTGGTTTCATAGAATGACTTAGG - Intronic
1153965627 18:10178957-10178979 CTGGCTTCATAGAATGAATTAGG + Intergenic
1154498752 18:14982808-14982830 CTGCTTTCATAGAATGAATCAGG - Intergenic
1154963263 18:21330694-21330716 GTTTTTTCAAAGAGAGACTTAGG - Intronic
1155456832 18:26025801-26025823 CTGGTTTCATAGAGTGAGTTGGG - Intronic
1156976368 18:43226171-43226193 CTTGTTTCATAGAATGAATTAGG - Intergenic
1156984825 18:43337778-43337800 CTGACTTCATAGACTGAATTAGG - Intergenic
1157935714 18:51870483-51870505 CTGGTTTCATAGAGTGAGTTAGG + Intergenic
1158002914 18:52639850-52639872 CTGGCTTCATAGAATGAATTAGG - Intronic
1158756808 18:60335061-60335083 CTGGCTTCATAGAATGAATTAGG - Intergenic
1158997057 18:62932258-62932280 CTGGTTTCATAGAATGAGTTAGG - Intronic
1159079897 18:63725118-63725140 CTTTTTTGAGAGAAAGAATTTGG + Intronic
1159839088 18:73375188-73375210 CTGGCTTCATAGAGTGATTTAGG - Intergenic
1161609627 19:5234628-5234650 CTGTTTTCTGAGAGAGCCTTTGG - Intronic
1162649471 19:12075913-12075935 CTATGTTCATAAAGGGAATTGGG - Exonic
1162976664 19:14210236-14210258 CTGTTTTCCTAGAGCCCATTCGG + Intergenic
1164100328 19:22049137-22049159 CTGTTTTCACAAGGAAAATTTGG + Intergenic
1164174813 19:22762623-22762645 CTGGCTTCATAGAATGAATTAGG - Intronic
1164287923 19:23838439-23838461 CTGGCTTCATAGAATGAATTAGG + Intergenic
1164319829 19:24133956-24133978 CTGGCTTCATAGAATGAATTAGG + Intergenic
1164390789 19:27818946-27818968 CTGGTCTCATAGAAAGAGTTAGG + Intergenic
1165283989 19:34823047-34823069 CTGTTCTCATAGAATGAGTTAGG - Intergenic
1165303498 19:34988536-34988558 CTGTTTGCAAAGGGAGAAATTGG - Intergenic
1165644504 19:37423384-37423406 CTGGTTTTATAAATAGAATTTGG - Intronic
1166917357 19:46204408-46204430 CTCTTTACATAGAGGGAATAGGG + Intergenic
1168395729 19:56046464-56046486 CTGGCTTCATAGAATGAATTAGG + Intronic
1168404755 19:56104817-56104839 CTGTTTTAAAAGAGAGATCTGGG - Intronic
925774957 2:7325880-7325902 CTGGTTTCACAGATAAAATTTGG + Intergenic
926462232 2:13145252-13145274 CTGTTTTTAAAGAGGGACTTGGG + Intergenic
926560478 2:14411650-14411672 CTGGCTTCATAGAATGAATTAGG - Intergenic
926844334 2:17118588-17118610 CTGTTCTCATAAAATGAATTAGG + Intergenic
927067454 2:19487715-19487737 ATGTTTTCAAAGAGAGATTGGGG - Intergenic
927924709 2:27003220-27003242 CTGTGTGCATATAGAGAATCTGG - Intronic
928188594 2:29139486-29139508 CTGCTTTCATAGAATGAATTAGG + Intronic
929288462 2:40163135-40163157 CTGGTTTCATGTAGAGACTTGGG + Intronic
929722601 2:44385979-44386001 CTGGCTTCATAGAATGAATTAGG + Intronic
929806159 2:45146954-45146976 CTGGCTTCATAGAATGAATTAGG - Intergenic
930567593 2:53042265-53042287 CTGGTTTCATAGAATGAGTTAGG + Intergenic
930764838 2:55074564-55074586 CTGTCTTCATAGAATGATTTAGG - Intronic
931055626 2:58467045-58467067 CTGGTTTCATTTAGAGGATTAGG + Intergenic
931536144 2:63279119-63279141 CTGGTTTCATAGAATGATTTAGG - Intronic
932100257 2:68892798-68892820 CTGGCTTCATAGAATGAATTAGG + Intergenic
932270615 2:70405824-70405846 CTGGATTCATAGAATGAATTAGG - Intergenic
932519819 2:72398952-72398974 CTGGCTTCATAGAATGAATTAGG - Intronic
932954345 2:76334174-76334196 CTGGCTTCATAGAATGAATTAGG + Intergenic
933433194 2:82211550-82211572 CTGTCTTCATAGACTGATTTAGG + Intergenic
933468140 2:82682708-82682730 CTGTTTTCTCAGAGGGAAATTGG - Intergenic
935467407 2:103415464-103415486 CTGGCTTCATAGAATGAATTAGG - Intergenic
935715160 2:105932958-105932980 CTGTCTCCAAAGAGAGAATAGGG - Intergenic
935863313 2:107358172-107358194 CTGTCTTCATAAATAGATTTTGG + Intergenic
935954308 2:108360371-108360393 CTGTCTTCATAGAATGAATTAGG - Intergenic
936164747 2:110110704-110110726 CTGGCTTCATAGAATGAATTAGG - Intronic
936504236 2:113092359-113092381 ATGTTTCCATATAAAGAATTTGG + Intergenic
936633715 2:114232657-114232679 CTGGTTTCATAGAGTGATTTGGG + Intergenic
937020376 2:118645271-118645293 CTATTTTCATGAAGAGAACTTGG + Intergenic
937068944 2:119047157-119047179 CTGGCTTCATAGAATGAATTAGG + Intergenic
937169445 2:119851040-119851062 CTGGTTTCATAGAGCAATTTGGG + Intronic
937529615 2:122812147-122812169 CTAGCTTCATAGAAAGAATTAGG - Intergenic
937561325 2:123227921-123227943 CTGGCTTCATAGAAAGAGTTAGG + Intergenic
937672055 2:124548423-124548445 CTGGTTTCATGGAGTGAACTGGG - Intronic
937721722 2:125105148-125105170 CTGATCTCATAGATACAATTAGG + Intergenic
937767332 2:125676944-125676966 CTGGCTTCATAGAACGAATTAGG + Intergenic
937874680 2:126813906-126813928 CTGTTTTCATAGAATCAAGTAGG + Intergenic
938315454 2:130323842-130323864 CTGGTCTCATAGAGTGAGTTAGG + Intergenic
938509737 2:131928060-131928082 CTGGCTTCATAGAATGAATTAGG - Intergenic
939313988 2:140523025-140523047 CTGATTTCATAGAATGAGTTAGG - Intronic
939431719 2:142118032-142118054 ATGGTTTCACAGAGAGAAATAGG - Intronic
939946137 2:148413466-148413488 CCGGCTTCATAGAGTGAATTAGG + Intronic
940157090 2:150668963-150668985 CTGGTTTCATAGAATGAATTAGG - Intergenic
940492551 2:154382153-154382175 CTGTGTCCATAGAGGGGATTGGG - Intronic
940618387 2:156080617-156080639 CTGGCTTCATAGAACGAATTAGG + Intergenic
941404045 2:165067012-165067034 ATGTTTTCTCAGAAAGAATTGGG + Intergenic
942154426 2:173112922-173112944 CTGGCTTCATAGAATGAATTAGG + Intronic
942593454 2:177570002-177570024 CTGTTTAAATAGAAAGAATAGGG + Intergenic
942628687 2:177932293-177932315 CTGGCTTCATAGAATGAATTAGG - Intronic
942726384 2:179012601-179012623 CTGGCTTCATAGAATGAATTAGG - Intronic
943264292 2:185707678-185707700 CTGGCTTCATAGAATGAATTAGG - Intergenic
943392111 2:187283324-187283346 CTGGATTCATAGAATGAATTTGG + Intergenic
943890999 2:193287051-193287073 CTGGCTTCATAGAATGAATTAGG + Intergenic
944790684 2:203122085-203122107 CTGTTTTAAAAGAAAGAATCAGG - Intronic
945131712 2:206580722-206580744 CTGGCTTCATAGAATGAATTAGG + Intronic
945861364 2:215126300-215126322 CTGACTTCATAGAATGAATTAGG + Intronic
946036775 2:216749474-216749496 CTGGCTTCATAGAATGAATTAGG - Intergenic
946157442 2:217816314-217816336 CTGTCTTCAGAGACAGAAGTTGG + Intronic
946223471 2:218248875-218248897 CTGTTTTCACAGTGAGAATATGG + Intronic
946230036 2:218285676-218285698 CTGTCTACATAGAGAGACCTGGG + Intronic
946501594 2:220253375-220253397 CTGGCTTCATAGAATGAATTAGG - Intergenic
946723846 2:222641424-222641446 CTCTTATCATAGGGAGAAGTTGG + Intronic
946978496 2:225180074-225180096 ATTTTTTCATAAAGTGAATTAGG - Intergenic
947554549 2:231079524-231079546 CTTTTTTTACAGAGATAATTTGG + Exonic
1169517149 20:6329860-6329882 CTGGCTTCATAGAATGAATTAGG + Intergenic
1169548336 20:6674158-6674180 CTCATAGCATAGAGAGAATTTGG + Intergenic
1169685819 20:8270098-8270120 CTGTTTTGATAGAGATTGTTTGG - Intronic
1170375569 20:15696549-15696571 CTGGCTTCATAGAATGAATTAGG + Intronic
1171244342 20:23598758-23598780 CTCTTTTAATAGAGAGGTTTTGG + Intergenic
1171725325 20:28613638-28613660 CTGTCTTCATAGAATGAGTTTGG + Intergenic
1171752737 20:29069443-29069465 CTGTCTTCATAGAATGACTTTGG - Intergenic
1171789526 20:29508126-29508148 CTGTCTTCATAGAATGACTTTGG + Intergenic
1171858008 20:30366322-30366344 CTGTCTTCATAGAATGACTTTGG - Intergenic
1173711617 20:45161949-45161971 CTGGCTTCATAGAAAGAGTTAGG + Intergenic
1173772189 20:45670297-45670319 CTGACTTCATAGAATGAATTAGG - Intergenic
1174935382 20:54862084-54862106 CTGTTGTCATAGAGAGGAGCTGG + Intergenic
1175675715 20:60945162-60945184 ATGTATTGAAAGAGAGAATTAGG - Intergenic
1175711878 20:61227837-61227859 CTATTTTCATAGCTAGAAATTGG + Intergenic
1176359137 21:5979147-5979169 CTGACTTCATAGAGTGATTTAGG + Intergenic
1176783744 21:13230506-13230528 CTGGCTTCATAGAATGAATTAGG + Intergenic
1177195220 21:17897321-17897343 CTGGCTTCATAGAATGAATTTGG + Intergenic
1177564824 21:22806815-22806837 CTATTTTGATAGATAGAGTTCGG - Intergenic
1177603761 21:23352276-23352298 TTGTTTTCCTAGAAAGAAATTGG + Intergenic
1177952381 21:27554462-27554484 GTGTTAACATAGAGAGAATCTGG - Intergenic
1177981791 21:27924345-27924367 CTGGCTTCATAGAATGAATTAGG + Intergenic
1178238168 21:30868053-30868075 CTGTTTTCAAAGAGTGGGTTTGG + Intergenic
1179410606 21:41160038-41160060 CTGTTTTCACAGGGACCATTTGG - Intergenic
1179764381 21:43559403-43559425 CTGACTTCATAGAGTGATTTAGG - Intronic
1179775912 21:43662064-43662086 CTGTTTTCTTAGCCAGAAGTGGG + Intronic
1180409532 22:12591510-12591532 CTGTCTTCATAGAATGAGTTTGG - Intergenic
1180896689 22:19340007-19340029 CTGGCTTCATAGAGTGATTTAGG - Intronic
1183000817 22:34857168-34857190 CTGTTTACACAGAGAGAAGTAGG + Intergenic
1183790554 22:40065066-40065088 CTGGTCTCATAGAATGAATTGGG + Intronic
1184625614 22:45726157-45726179 CTGGCTTCATAGAGTGAATTAGG + Intronic
949696536 3:6702896-6702918 CTGGCTTCATAGAGTGAGTTAGG - Intergenic
949749593 3:7336033-7336055 CTGGTTTCATAGAATGATTTAGG - Intronic
950067297 3:10123259-10123281 CTGTTTTCACAGATGGAATGTGG + Intronic
950414462 3:12860728-12860750 CAGTCTTCATAGAGATGATTTGG - Intronic
950414736 3:12862425-12862447 CAGTCTTCATAGAGATGATTTGG - Intronic
950592095 3:13944677-13944699 CTGGCTTCATAGAATGAATTAGG + Intronic
950842945 3:15985632-15985654 CTGGTTTCATAGAATGAGTTAGG + Intergenic
951268176 3:20594417-20594439 CTGTCTTCATAGAATGATTTAGG + Intergenic
951470228 3:23048063-23048085 CTGGTCTCATAGAGTGAGTTAGG - Intergenic
952097130 3:29967197-29967219 CTGTCTTCATGGAATGAATTAGG + Intronic
952221307 3:31326858-31326880 CTGTTTTAAAAGGGAGAAATTGG + Intergenic
952444364 3:33366334-33366356 CTGGCTTCATGGAGTGAATTGGG + Intronic
952523110 3:34182237-34182259 TTGTTTATATAGAGAGTATTTGG + Intergenic
952523996 3:34190569-34190591 CTGTTTTCACAGAGACAACACGG + Intergenic
952574841 3:34762125-34762147 CTGGCTTCATAGAGTGAGTTAGG - Intergenic
952610932 3:35207560-35207582 CTGGCTTCAAAGAGTGAATTAGG + Intergenic
952803231 3:37317811-37317833 CTTTGTTTATAGTGAGAATTAGG + Intronic
953254538 3:41277236-41277258 CTGGCTTCATAGAATGAATTAGG - Intronic
953522669 3:43657845-43657867 CTGCTTTCAAAGATGGAATTTGG - Intronic
953539761 3:43806964-43806986 CTGGCTTCATAGAATGAATTAGG - Intergenic
953909031 3:46882648-46882670 ATGTTTTCGTAGAGAGAAAAGGG + Intronic
954502014 3:51026486-51026508 CTGGTTTCATAGAATGAGTTGGG + Intronic
955051086 3:55411699-55411721 CTGTTATCAGAAAGAGAAGTAGG + Intergenic
955175340 3:56608138-56608160 CTGGCTTCATAGAATGAATTAGG + Intronic
956559790 3:70562488-70562510 CTGGTTTCATAGACTGAGTTAGG + Intergenic
956880306 3:73504162-73504184 CTGTTTTAATTGTGAGAATGAGG - Intronic
956950554 3:74277253-74277275 CTGGCTTCATAGAATGAATTAGG - Intronic
956995368 3:74821149-74821171 CTGGTTTCATAGAATGAATTAGG + Intergenic
957015990 3:75065668-75065690 CTGGCTTCATAGAATGAATTAGG + Intergenic
957331226 3:78767123-78767145 CTGGCTTCATAGAATGAATTAGG + Intronic
957676284 3:83370308-83370330 CTGCCTTCATAGGAAGAATTAGG - Intergenic
958088016 3:88837724-88837746 CTGGCTTCATAGAATGAATTAGG + Intergenic
958445673 3:94211587-94211609 CTGGTTTCATAGAATGAATTAGG - Intergenic
958490308 3:94764470-94764492 CTGGCTTCATAGAATGAATTAGG + Intergenic
958812046 3:98871779-98871801 CCGGGTTCATAGAAAGAATTAGG + Intronic
959275025 3:104267823-104267845 CTGGCTTCATAGAATGAATTAGG + Intergenic
959589188 3:108058057-108058079 CTATTTTGATACAGAGAGTTTGG + Intronic
959770937 3:110095238-110095260 CTTTTCTCATAAAGAGAACTTGG - Intergenic
959802246 3:110509264-110509286 CTGGCTTCATAGAATGAATTAGG + Intergenic
960516834 3:118611459-118611481 CTGGCTTCATAGAATGAATTAGG - Intergenic
960524735 3:118696526-118696548 CTGGTTTCATAGAATGAATTAGG - Intergenic
961264434 3:125629940-125629962 CTGGCTTCATAGAATGAATTAGG + Intergenic
961331712 3:126146531-126146553 CTGAGTTCATAGGGAGAATTAGG - Intronic
961505441 3:127368104-127368126 CTTTTTTTAGAGAGATAATTGGG - Intergenic
961982952 3:131100746-131100768 CTGGCTTCATAGAGTGAATTAGG + Intronic
962464579 3:135645652-135645674 CTGGTTTCATAGAATGAGTTAGG + Intergenic
963687889 3:148460943-148460965 CTGGCTTCATAGAATGAATTAGG - Intergenic
964319149 3:155475950-155475972 CTGGCTTCATAGAAAGAGTTTGG - Intronic
964600950 3:158500371-158500393 CTGGCTTCATAGAATGAATTGGG + Intronic
964624913 3:158749521-158749543 CTGTTGTGATAGATAGAATATGG + Intronic
964644132 3:158940082-158940104 CTGGTTTCATAGAATGATTTAGG - Intergenic
965052437 3:163668154-163668176 CTGGTTTCATAAAGTGAATTAGG + Intergenic
965164386 3:165176648-165176670 TTGTTTTCATATGGAAAATTGGG + Intergenic
965348303 3:167579583-167579605 GTATATTCATAGAGAAAATTGGG + Intronic
965728181 3:171742424-171742446 CTATGTTCATAGAGTGAATGTGG - Intronic
966034933 3:175400081-175400103 CCCTTTTCATATAGAGAATGAGG - Intronic
966292065 3:178371156-178371178 CTGGTTTCATAGAATGATTTAGG + Intergenic
966340238 3:178917468-178917490 CTGGTTTCATAGAATGACTTAGG - Intergenic
966991835 3:185240273-185240295 CTGCTTTCATAGAATGATTTAGG + Intronic
967422270 3:189286709-189286731 CTCTTGTCAAAGAGAGAATAAGG + Intronic
967466996 3:189819087-189819109 GTGTTTTCATAGTAGGAATTTGG + Intronic
967494038 3:190122845-190122867 CTGTTTTCAGATAAAGATTTTGG + Intergenic
967688251 3:192442768-192442790 TTGTTTTCAGATAGAGAAATGGG + Intronic
969309299 4:6343692-6343714 CTTTTTTTTTAGACAGAATTTGG - Intronic
969923781 4:10565831-10565853 CTGTTTTCAGAAAGAGAAAGTGG + Intronic
970468310 4:16349962-16349984 CTGATGTGATAGAGAGACTTGGG - Intergenic
970996416 4:22272316-22272338 CTGGCTTCATAGAATGAATTAGG - Intergenic
971273552 4:25173963-25173985 CAGTTCTCTTAGAGAGAATCAGG - Intronic
971331719 4:25686829-25686851 CTGTTTTCATACAGAATGTTGGG - Intergenic
971694919 4:29888467-29888489 CTGGCTTCATAGAATGAATTAGG + Intergenic
971721459 4:30250320-30250342 TTGGTTTCATAGAATGAATTTGG + Intergenic
971900775 4:32655302-32655324 CTGGTTTCATAGAATGAATTAGG + Intergenic
972032622 4:34480211-34480233 CTTTATTCATAGAAAGGATTGGG - Intergenic
972433578 4:39009383-39009405 CTGGTTTCATAGAATAAATTAGG - Intronic
972680524 4:41302201-41302223 CTGGTTTCATAGAATGAATTAGG + Intergenic
972685210 4:41345946-41345968 CTTTGTTCATAAAGAGAATTAGG + Intergenic
972945830 4:44254300-44254322 CTATTTTCAAAGAAAGTATTGGG + Intronic
973196606 4:47450425-47450447 CTGTCTTCATCGAGAAATTTTGG - Intergenic
973962598 4:56126747-56126769 TTGATTTCATAGAGATAACTGGG - Intergenic
974180332 4:58376275-58376297 CTGGTTTCACAGAATGAATTAGG + Intergenic
974301282 4:60070683-60070705 CTGTCCTCATAGACAGAGTTTGG - Intergenic
974870388 4:67636344-67636366 CTGTTTTGATAAAGAAATTTAGG + Intronic
974951210 4:68584766-68584788 CTGGCTTCATAGAATGAATTAGG - Intronic
975026355 4:69553746-69553768 CTGTCTTCATACAGTGAGTTGGG - Intergenic
975301167 4:72792777-72792799 CTGGTTTCATAGAATGATTTAGG - Intergenic
975517594 4:75263804-75263826 CTGGCTTCATAGAATGAATTAGG - Intergenic
975911740 4:79275282-79275304 CTGTATTCAGAGACAGAACTTGG - Intronic
976856769 4:89613415-89613437 CTGGCTTCATAGAATGAATTAGG - Intergenic
977267949 4:94878556-94878578 CTGTTTTCAGAAAAAAAATTAGG - Intronic
977372291 4:96154229-96154251 CCCTTTTAATAGAGAGAGTTAGG - Intergenic
978726379 4:111974428-111974450 CTGGCTTCATAGAATGAATTAGG + Intergenic
978917274 4:114142545-114142567 CTGGTTTCATAGAATGATTTAGG + Intergenic
979181752 4:117737573-117737595 CTGGTCTCATAGAATGAATTAGG - Intergenic
979498146 4:121408179-121408201 CTGACTTCATAGAATGAATTAGG + Intergenic
979943309 4:126791303-126791325 CTGTTTTGACAGGGAGAATTGGG + Intergenic
979995235 4:127424517-127424539 CTGGCCTCATAGAAAGAATTGGG - Intergenic
979995722 4:127428463-127428485 CTGGCTTCATAGAATGAATTAGG - Intergenic
980057793 4:128095711-128095733 TTTTTTTCAAAGATAGAATTTGG + Intronic
980088088 4:128412711-128412733 CTGGTTTCATAGAATGAGTTAGG + Intergenic
980236823 4:130118551-130118573 CTGGTTTCATAGAATGAGTTAGG - Intergenic
980238143 4:130135161-130135183 CTGTCTTCATAGAATGAATTAGG - Intergenic
980413293 4:132451196-132451218 CTGGTCTCATAGAATGAATTAGG - Intergenic
980523893 4:133964454-133964476 CTGACTTCATAGAATGAATTAGG - Intergenic
980695163 4:136345296-136345318 CTCTTATTATAGACAGAATTTGG + Intergenic
981059094 4:140400838-140400860 ATATTTTTATTGAGAGAATTAGG + Intronic
981346988 4:143687498-143687520 CTGGCTTCATAGAATGAATTAGG - Intronic
981461685 4:145020071-145020093 CTGGCTTCATAGAATGAATTAGG - Intronic
981626278 4:146759421-146759443 CTGGCTTCATAGAATGAATTAGG - Intronic
981886930 4:149687586-149687608 CTGGCTTCATAGAATGAATTAGG - Intergenic
982075584 4:151733597-151733619 CTGGCTTCATAGAATGAATTAGG - Intronic
982960126 4:161825396-161825418 CTGGTTTCATAGAATGATTTAGG + Intronic
983544569 4:168949622-168949644 CTGGCTTCATAGAATGAATTAGG + Intronic
984092393 4:175390167-175390189 CTGGCTTCATAAAGTGAATTAGG - Intergenic
984439028 4:179742128-179742150 CTGTTTTCATAGGTAAAATTTGG - Intergenic
984722021 4:182981893-182981915 CTGGTTTCATAGAATGAATTAGG - Intergenic
984915933 4:184724447-184724469 ATGATTTCATAGAGAAAACTTGG - Intronic
985093201 4:186385070-186385092 CTGGTTTCATAGAATGAATTAGG - Intergenic
986845932 5:11753412-11753434 CTGTATTTATTGAGATAATTAGG + Intronic
986952596 5:13108575-13108597 ATGCTGTCATGGAGAGAATTTGG + Intergenic
987527691 5:19074620-19074642 CTGGTTTCATAGAATGATTTAGG - Intergenic
987732303 5:21790498-21790520 TTTTTTGTATAGAGAGAATTAGG + Intronic
987811582 5:22843228-22843250 GTGTTTTCACAGATAGAATTGGG - Intronic
987848441 5:23318169-23318191 CTGTTTTGATAGAGATTGTTTGG - Intergenic
987957460 5:24759231-24759253 CTAGCTTCATAGAGTGAATTAGG + Intergenic
988453786 5:31369757-31369779 GTGTTTTCATAGAGAAATTGAGG - Intergenic
988876205 5:35449140-35449162 CTGTCTTCATAGAATGATTTAGG - Intergenic
989028767 5:37095068-37095090 CTGGCTTCATAGAAAGACTTAGG - Intergenic
990275530 5:54191979-54192001 ATGTTGTCATAGAAATAATTAGG - Intronic
990672905 5:58152487-58152509 CTGGCTTCATAGAATGAATTAGG - Intergenic
990775841 5:59304901-59304923 CTGGCTTCATAGAACGAATTAGG + Intronic
990837616 5:60040008-60040030 CAGTTTTGATAGAGTGAATGGGG - Intronic
990903065 5:60774120-60774142 CTGGTTTCATAGAATGAGTTAGG - Intronic
990922914 5:60987413-60987435 CTGGTTTCATAGAATGAGTTGGG - Intronic
992073491 5:73170288-73170310 TTATTTTAATAGAGAGAATTTGG + Intergenic
993250044 5:85510110-85510132 CTGTTTTCATAGAATGAATTAGG + Intergenic
993272385 5:85812234-85812256 TGGTTTTTATAGAGAGAGTTGGG + Intergenic
993277547 5:85879910-85879932 CTGGCTTCATAGAATGAATTAGG + Intergenic
993917358 5:93759382-93759404 CTGGCTTCATAGAATGAATTAGG - Intronic
994277069 5:97851967-97851989 CTGGTTTCATAGAATGATTTAGG - Intergenic
994304319 5:98183855-98183877 CTGACTTCATAGAATGAATTAGG - Intergenic
994330160 5:98495455-98495477 CTGACTTCATAGAATGAATTAGG - Intergenic
994777844 5:104057831-104057853 CTGGTTTCATAGAATGATTTAGG + Intergenic
995149576 5:108826603-108826625 CTGGCTTCATAGAATGAATTTGG + Intronic
995293456 5:110487807-110487829 CTGACTTCATAGAATGAATTAGG + Intronic
995693534 5:114854510-114854532 CTGGCTTCATAGAATGAATTAGG - Intergenic
996011055 5:118482321-118482343 CTGGTTTCATAGAACGAATTAGG - Intergenic
996032258 5:118718854-118718876 CTGGCTTCATAGAATGAATTAGG - Intergenic
996325712 5:122270690-122270712 CTGGCTTCATAGAATGAATTAGG - Intergenic
996678636 5:126205699-126205721 CTGGCTTCATAGAGTGATTTAGG - Intergenic
996722367 5:126642459-126642481 CTGGCTTCATAGAATGAATTGGG + Intergenic
996925214 5:128817280-128817302 CTGTTTTCATAGATTGAATTGGG - Intronic
997058556 5:130473891-130473913 CTGGCTTCATAGAGTGATTTAGG + Intergenic
997655138 5:135548837-135548859 CTGTTATCTTGGTGAGAATTGGG + Intergenic
998064053 5:139142279-139142301 CTGACTTCATAGAATGAATTAGG - Intronic
999040590 5:148406125-148406147 CTGATTTCAGAGAGCCAATTTGG + Intronic
999352379 5:150886404-150886426 CTGTTTTTATAGAATGAATTGGG + Intronic
999484392 5:151980672-151980694 CTGGCTTCATAGAATGAATTTGG + Intergenic
999494489 5:152083666-152083688 CAGTTCTCCTAGAGTGAATTTGG + Intergenic
999819044 5:155206499-155206521 CTGGTTTCATAGAATGAATTAGG - Intergenic
1000738670 5:164937109-164937131 CTGATATAAAAGAGAGAATTTGG - Intergenic
1000811027 5:165862101-165862123 CTCTTTTAATAAAGATAATTTGG + Intergenic
1002814196 6:663424-663446 CTGGTTTCATAGAATGAATTAGG - Intronic
1002967531 6:1981657-1981679 CTGGTTTCATAGAATGAGTTAGG - Intronic
1003451177 6:6233584-6233606 CTGGCTTCATAGAATGAATTTGG - Intronic
1005222629 6:23605224-23605246 CTGTTCTCATAGAATGAGTTTGG - Intergenic
1005259190 6:24039356-24039378 CTGGTTTCATAGAATGATTTAGG + Intergenic
1005919368 6:30385799-30385821 CTGTCTTCATAGAATGATTTAGG - Intergenic
1006280075 6:33045005-33045027 CTGGCTTCATAGAATGAATTAGG + Intergenic
1006569333 6:34987700-34987722 CTGTTTTAAGAGAGAGATTATGG + Intronic
1007526343 6:42497559-42497581 CTGGTTTCATAGAATGATTTAGG + Intergenic
1007881275 6:45170045-45170067 CTGTGTTGAAAGAGAGAAGTGGG - Intronic
1008121397 6:47621548-47621570 CTGGCTTCATAGAATGAATTAGG + Intronic
1008231791 6:48991770-48991792 CTGGCTTCATGGAGTGAATTAGG - Intergenic
1008358125 6:50579919-50579941 CTGTTTTCAAAGACACAGTTGGG + Intergenic
1008973276 6:57395167-57395189 CTGGTTTCATATAATGAATTAGG + Intronic
1009162180 6:60296706-60296728 CTGGTTTCATATAATGAATTAGG + Intergenic
1009332228 6:62438046-62438068 CTGGTTTCATAGAATGATTTAGG + Intergenic
1009486505 6:64230261-64230283 TTGTTTCCACAGAGACAATTAGG - Intronic
1009745184 6:67803956-67803978 CTGGCCTCATTGAGAGAATTTGG - Intergenic
1009773763 6:68178410-68178432 CTGGTTTCATAGAGAGGAGCTGG - Intergenic
1010008697 6:71025718-71025740 CACTCTTCATAGAGTGAATTAGG + Intergenic
1010181602 6:73092916-73092938 CTGGCTTCATAGAATGAATTGGG + Intronic
1010610496 6:77948933-77948955 CTGGCTTCATAGAGTGAATTAGG - Intergenic
1010858119 6:80869031-80869053 CTGGCTTCATAGAATGAATTAGG + Intergenic
1011394915 6:86896481-86896503 CTGGCTTCATAGAATGAATTAGG - Intergenic
1011520804 6:88203439-88203461 CTGGTCTCATAGAATGAATTTGG - Intergenic
1011965547 6:93153056-93153078 CTGGCTTCATAGAGTGAATTAGG + Intergenic
1011970551 6:93217341-93217363 CTGGTTTCATAGAATGAGTTAGG + Intergenic
1012234537 6:96798180-96798202 TTGTTTTCATAGTGGGAATCAGG - Exonic
1012316730 6:97790495-97790517 ATATTTTCATGGAGAGAACTGGG + Intergenic
1012528792 6:100209866-100209888 CTGTTCTAATAAAGAGACTTTGG + Intergenic
1013937965 6:115621872-115621894 CTGGTTTCATAGAATGAGTTAGG - Intergenic
1014178730 6:118359820-118359842 CTGGTCTCATAGAATGAATTAGG - Intergenic
1014219287 6:118784172-118784194 TTGTTTTACCAGAGAGAATTAGG + Intergenic
1014285344 6:119490803-119490825 CTGGATTCATAGAATGAATTAGG - Intergenic
1014317955 6:119890868-119890890 ATGATTCCATAGAGAGACTTGGG + Intergenic
1014421286 6:121248936-121248958 CTGACTTCATAGATAGATTTAGG - Intronic
1014478824 6:121909617-121909639 CTGTATTTATAAAGTGAATTTGG + Intergenic
1014658508 6:124136492-124136514 CTGGCTTCATAGAGTGATTTAGG - Intronic
1014738306 6:125120757-125120779 CAGTTTGCATAGAGAGAAAGAGG - Intronic
1015362077 6:132351646-132351668 CTGGTTTCATAGAATGAATTAGG + Intronic
1015565872 6:134570504-134570526 CTGGCTTCATAGAATGAATTAGG - Intergenic
1016053738 6:139556854-139556876 CTGTTTTCAAAGAGAAATTTTGG + Intergenic
1016108355 6:140189933-140189955 CTGGCTTCATAGAATGAATTAGG - Intergenic
1016615485 6:146042984-146043006 CTATTTTCATACAGAGAGGTTGG - Intronic
1016634489 6:146271731-146271753 CTGTCCTCACAGAGAAAATTAGG - Intronic
1017190188 6:151645198-151645220 CTGACTTCATAGAATGAATTAGG + Intergenic
1018656167 6:166038516-166038538 CTGATTTCATAGAATGATTTAGG + Intergenic
1019134434 6:169899392-169899414 CTGTTTTCTTAGTGATAACTAGG - Intergenic
1020348759 7:7194679-7194701 CTGGCTTCATAGAATGAATTAGG + Intronic
1020555136 7:9661604-9661626 CTGTTTTAAGAAAGATAATTAGG + Intergenic
1021105263 7:16631338-16631360 CTGTATTTATAAAGTGAATTGGG + Intronic
1021268929 7:18560722-18560744 CTGTTTTGATAGAGGGAACGTGG + Intronic
1021272096 7:18601972-18601994 CTGTCCTCATAGAAAGAGTTAGG + Intronic
1021346138 7:19530870-19530892 ATGTTTACATAGAATGAATTTGG + Intergenic
1021359784 7:19697454-19697476 CTGCTTTCATTGAGAAAATGTGG - Exonic
1021435482 7:20609529-20609551 ATGTTTTCATAAAAAGAGTTGGG - Intergenic
1021466275 7:20947317-20947339 CTGGCTTCATAGAGTGAATTAGG - Intergenic
1021473796 7:21037207-21037229 CTGGCTTCATAGAATGAATTAGG + Intergenic
1022120191 7:27300635-27300657 TTATTTTCACAGAGAAAATTTGG - Intergenic
1023218326 7:37890263-37890285 CTGTTTTATTACAGTGAATTTGG - Intronic
1023645507 7:42309219-42309241 CTGGCCTCATAGAGTGAATTTGG - Intergenic
1024175029 7:46830808-46830830 CTGGCTTCATAGAGTGACTTAGG - Intergenic
1024367030 7:48532507-48532529 CTGGCTTCATAGAGTGATTTAGG + Intronic
1024545801 7:50517056-50517078 CTGACTTCATAGAATGAATTAGG - Intronic
1024668994 7:51574304-51574326 CTGGGTTCATAGAATGAATTAGG + Intergenic
1024680885 7:51686406-51686428 CTGGTAACATAAAGAGAATTGGG - Intergenic
1024745050 7:52396659-52396681 CTGGCTTCATAGAATGAATTAGG + Intergenic
1026581294 7:71620293-71620315 CTGGTTTCATAGAATGAGTTAGG + Intronic
1027295725 7:76767671-76767693 CTGGCTTCATAGAATGAATTAGG - Intergenic
1027328680 7:77068205-77068227 CTGGCTTCATAGAATGAATTAGG + Intergenic
1027350065 7:77302687-77302709 CTGGCTTCATAGAATGAATTAGG + Intronic
1027711371 7:81605641-81605663 CTGTGTTCACAGATCGAATTCGG + Intergenic
1028412141 7:90541439-90541461 CTGTTTTCATGGAATGAATTTGG - Intronic
1028681241 7:93535597-93535619 ATGTTTTCATAGAGACCATAGGG + Intronic
1029165257 7:98584703-98584725 CTGTTTTCAAAAAGTTAATTGGG + Intergenic
1030326043 7:108219336-108219358 CTGGCTTCATAGAATGAATTGGG - Intronic
1030390148 7:108917851-108917873 CTGGCTTCATAGAATGAATTAGG + Intergenic
1030531297 7:110714451-110714473 CTGGTTTCATAGAATGAGTTAGG + Intronic
1030721161 7:112872112-112872134 CTGGTTTCATAGAATGAGTTAGG - Intronic
1030752846 7:113252159-113252181 CTGGCTTCATAGAGTGAGTTTGG - Intergenic
1030768165 7:113438100-113438122 CTGTCTTCATAGAATGAGTTAGG + Intergenic
1031139171 7:117922498-117922520 CTGGTTTCATAGAATGATTTAGG - Intergenic
1031245524 7:119306638-119306660 CTGGCTTTATAGAGTGAATTAGG - Intergenic
1031625687 7:123990210-123990232 CTGGCTTCATAGAATGAATTAGG + Intergenic
1031706604 7:124988435-124988457 CTGTTATCAAAGAGATAAGTAGG + Intergenic
1033395400 7:140969297-140969319 CTGTTAGCATTGAAAGAATTTGG - Intergenic
1033721669 7:144066245-144066267 CTGGCTTCATAGAATGAATTAGG + Intergenic
1034205871 7:149314698-149314720 CTGTTTTCATAGAATGAGTTAGG + Intergenic
1034366581 7:150554768-150554790 CTGGTCTCATAGAAAGAACTGGG - Intergenic
1037156651 8:15708653-15708675 CAGTTTTTAAACAGAGAATTGGG + Intronic
1037452957 8:19035722-19035744 CTGTTTTCATTGGGATATTTTGG - Intronic
1037466203 8:19162966-19162988 CTGTTTTAATAGAAACATTTGGG - Intergenic
1037478643 8:19282814-19282836 CTGGCTTCATAGAATGAATTAGG + Intergenic
1037799971 8:22027551-22027573 CTGTTTTCTGAGAGAAAATCAGG - Intronic
1037985199 8:23286620-23286642 CTGTTTTCAGAGACAGCATGTGG + Intronic
1038152876 8:24958077-24958099 CTGTTTTCAAATAGAGAAGCCGG + Intergenic
1038366946 8:26946121-26946143 CTGGCTTCATAGAAGGAATTAGG + Intergenic
1039123882 8:34178838-34178860 CTGGCTTCATAGAATGAATTAGG - Intergenic
1039268671 8:35856244-35856266 CTGGTTTCATGGAATGAATTAGG - Intergenic
1039352379 8:36777107-36777129 TTTTCTTCATAGAGAGAATGTGG - Intergenic
1040077491 8:43252321-43252343 CTATGTTCAGGGAGAGAATTGGG + Intergenic
1040424371 8:47270145-47270167 CTGGTTTCATGGTGTGAATTAGG + Intronic
1040790260 8:51220405-51220427 CTGGTTTCATAGAATGAGTTGGG - Intergenic
1041293366 8:56329707-56329729 CTGGCTTCATAGAATGAATTAGG + Intergenic
1041334577 8:56766544-56766566 CTGGTTTCATAGAATGAGTTAGG + Intergenic
1041877672 8:62709226-62709248 CTGGCTTCATAGAATGAATTAGG + Intronic
1042188116 8:66157052-66157074 CTGTTTACATTCTGAGAATTCGG + Intronic
1042867933 8:73371889-73371911 CTGTTATCATTGAGAGAAAGAGG - Intergenic
1043071361 8:75640101-75640123 CTGTCTTCATAAAAAGACTTAGG + Intergenic
1043628182 8:82290828-82290850 CTGGCTTCATAGAATGAATTAGG + Intergenic
1043948013 8:86275959-86275981 CTGTTTTGAGGGACAGAATTAGG - Intronic
1044078202 8:87849744-87849766 CTGGTTTCATAGAATGAGTTCGG - Intergenic
1044227901 8:89740163-89740185 CTGGCTTCATAGAATGAATTAGG - Intergenic
1046073339 8:109285301-109285323 CTGCCTTCATAGAGTGAGTTAGG - Intronic
1046369288 8:113280171-113280193 CTGGCTTCATAGAATGAATTAGG + Intronic
1046480237 8:114807641-114807663 TTGTCCTCATGGAGAGAATTGGG + Intergenic
1046498480 8:115044558-115044580 CTGGCTTCATAGAATGAATTAGG - Intergenic
1046652886 8:116858516-116858538 TTTTTCTTATAGAGAGAATTGGG - Intronic
1046859887 8:119078471-119078493 CTGTTGGAATAGAGAGAATGGGG + Intronic
1047332199 8:123901007-123901029 CTGACTTCATAGAATGAATTAGG + Intronic
1048530758 8:135247629-135247651 CTGGCTTCATAGAGTGATTTAGG + Intergenic
1048640678 8:136356509-136356531 CTGATTTCATAGAGTGAGTTTGG + Intergenic
1049872494 8:144991484-144991506 ATGTTTTCATTGAATGAATTGGG - Intergenic
1051627749 9:19114277-19114299 TTGTTTTCATGGAGAGAAAGGGG + Intronic
1052050876 9:23848914-23848936 CTGTTGCCATGGAGAGAACTGGG - Intergenic
1052157188 9:25206779-25206801 CTGTTTTCATAGGGAGGAACTGG - Intergenic
1052247262 9:26350930-26350952 CTGGCTTCATAGAATGAATTAGG - Intergenic
1052261728 9:26524658-26524680 CTGTTTTCATAGACTGGAATGGG - Intergenic
1052346862 9:27418321-27418343 CTGGCTTCATAGAGTGAATTAGG - Intronic
1052438577 9:28463805-28463827 CTGTTTTAATTGAGTGCATTTGG + Intronic
1052638412 9:31132333-31132355 CTGGCTTCATAGAATGAATTCGG + Intergenic
1052731175 9:32288077-32288099 CTGGCTTCATAGAATGAATTAGG + Intergenic
1055125049 9:72709367-72709389 CTGGTTTCATAGAATGATTTAGG + Intronic
1055156598 9:73070194-73070216 CTGGTTTCATAGAATGATTTAGG - Intronic
1055181875 9:73398248-73398270 CTGGCTTCATAGAGTGATTTAGG + Intergenic
1055911174 9:81353857-81353879 CTGTCTTCATAGAATGAATTAGG + Intergenic
1056757290 9:89389793-89389815 CTTTTATCAAAAAGAGAATTTGG - Intronic
1056971075 9:91204052-91204074 CTGATTTCATAGAATGATTTAGG - Intergenic
1056993958 9:91437215-91437237 CTGTTTTAAAAAAGAGATTTAGG - Intergenic
1056995825 9:91458149-91458171 CTGTCCTTGTAGAGAGAATTTGG + Intergenic
1057381741 9:94573826-94573848 CTGGTTTCATAAAATGAATTGGG + Intronic
1058410763 9:104728587-104728609 CTGGCTTCATAGAATGAATTAGG - Intergenic
1058472615 9:105296660-105296682 CTGCTTCCAAACAGAGAATTTGG - Intronic
1058622890 9:106902425-106902447 CTGGATTCATAGAATGAATTAGG + Intronic
1058739141 9:107925023-107925045 CAGTTTTCTTAGAGACATTTTGG - Intergenic
1058755540 9:108079786-108079808 CTTTCTTCATAGAGAAACTTTGG - Intergenic
1058771008 9:108231841-108231863 CTGGCTTCATAGAATGAATTAGG - Intergenic
1059075140 9:111185160-111185182 CTGGCTTCATAGAATGAATTGGG + Intergenic
1059077977 9:111215169-111215191 CTGGCTTCATAGAATGAATTAGG + Intergenic
1059267096 9:113044829-113044851 CTGTTTACGTAGAGAAAATATGG - Intronic
1059837244 9:118169864-118169886 CTGTTTTTATCCATAGAATTAGG + Intergenic
1203450537 Un_GL000219v1:110422-110444 CTGTCTTCATAGAATGAGTTTGG + Intergenic
1186123218 X:6384925-6384947 CTGTGTTCATAAAGAGAAGTGGG + Intergenic
1187060044 X:15777478-15777500 CTGGCTTCATAAAAAGAATTTGG - Intronic
1187375812 X:18753005-18753027 CTGATCTCATAGAGTGAGTTAGG + Intronic
1187435058 X:19260242-19260264 TTGTTTTTATAAAGAGTATTTGG + Intergenic
1187637394 X:21245287-21245309 CTGGTTTCATAGAATGAGTTAGG + Intergenic
1188045587 X:25422858-25422880 CTGGCTTCATAGAATGAATTAGG + Intergenic
1188119771 X:26289987-26290009 CTGGTTTCATAGAATGAATTAGG + Intergenic
1188406461 X:29816562-29816584 CTGGTTTCATAGAATGAGTTAGG - Intronic
1189118827 X:38371628-38371650 CTGTATTAATTGAGTGAATTTGG - Intronic
1189218472 X:39348253-39348275 CTGGCTTCATAGAATGAATTAGG - Intergenic
1189365580 X:40385419-40385441 CTGTTTCCGTAGAAAGAATATGG - Intergenic
1189413962 X:40798078-40798100 CTGGCTTCATAGAATGAATTAGG - Intergenic
1189887257 X:45560657-45560679 CTGGTTTCATAAAGTGAGTTAGG + Intergenic
1189932054 X:46023021-46023043 CTGGCTTCATAGAATGAATTAGG - Intergenic
1190631895 X:52395706-52395728 CTGGTTTCATAGAATGATTTAGG + Intergenic
1191067414 X:56364941-56364963 CTGGTTTCATAGAATGAATTAGG + Intergenic
1191202667 X:57801485-57801507 CTGGTTTCATAGAATGAATTAGG - Intergenic
1191603642 X:63038758-63038780 CTGTTTTTATAGAATGAGTTAGG + Intergenic
1191729906 X:64322409-64322431 CTGTTTTTATAGAATGAGTTTGG + Intronic
1191751825 X:64550930-64550952 CTCTTTTGATAAACAGAATTTGG - Intergenic
1191954462 X:66628827-66628849 CTGGCTTCATAGAATGAATTAGG - Intronic
1191994362 X:67075436-67075458 CTGGCTTCATAGAATGAATTAGG - Intergenic
1192014178 X:67311184-67311206 CTGGCTTCATAGAATGAATTAGG + Intergenic
1192061166 X:67828161-67828183 CTGGTTTCATAGAATGAAATAGG - Intergenic
1192382489 X:70633056-70633078 CTGACTTCATAGGGTGAATTGGG - Intronic
1192399399 X:70819079-70819101 CTGATTTCATAAAATGAATTTGG - Intronic
1192740207 X:73885082-73885104 CTGGATTCATAGAATGAATTAGG - Intergenic
1192880806 X:75281769-75281791 CTGGCTTCATAGAATGAATTAGG + Intronic
1192904041 X:75530638-75530660 CTGGTTTCATAGAATGAATTAGG + Intergenic
1192943790 X:75942373-75942395 CTGGTCTCATAGAATGAATTAGG + Intergenic
1192944059 X:75945847-75945869 CTGGATTCATAGAATGAATTAGG + Intergenic
1192967966 X:76200134-76200156 CTGACTTCATAGAATGAATTAGG + Intergenic
1193107953 X:77699915-77699937 CTGTTTTCATAAAATGAGTTGGG - Intronic
1193197209 X:78646782-78646804 CTGGTTTCATAGAATGACTTAGG - Intergenic
1193590068 X:83378253-83378275 CTGGCTTCATAGAATGAATTAGG + Intergenic
1193662352 X:84272858-84272880 CTGTCTTCATAGAATGATTTAGG - Intergenic
1193714079 X:84916777-84916799 TTGCTTTCATAGAATGAATTAGG - Intergenic
1193775696 X:85638738-85638760 CTGGTTTCATAGAATGATTTAGG + Intergenic
1193830600 X:86284607-86284629 CTGGTTTCATAGAATGAGTTTGG + Intronic
1193860367 X:86658445-86658467 CTGCCTTCAAAGAGAAAATTCGG - Intronic
1193889086 X:87020805-87020827 CTGGCTTCATAGAATGAATTAGG - Intergenic
1193937816 X:87643544-87643566 CTGGCTTCATAGAATGAATTAGG - Intronic
1194067553 X:89280914-89280936 CTGGTTTCATAGAATGAGTTAGG - Intergenic
1194145485 X:90256355-90256377 CTGGCTTCATAGAATGAATTGGG - Intergenic
1194442744 X:93953294-93953316 CTGGTTTAATAGAGTGAGTTAGG + Intergenic
1194828018 X:98586434-98586456 TTGTCTTCACAGAGTGAATTGGG + Intergenic
1194926375 X:99829916-99829938 CTGGTTTCATAAAATGAATTAGG + Intergenic
1194955856 X:100179738-100179760 CTGGCTTCATAGAATGAATTAGG - Intergenic
1195019152 X:100809207-100809229 CTGGCTTCATAGAATGAATTAGG + Intergenic
1195473142 X:105256151-105256173 CTGGTTTCATAGAATGAGTTGGG + Intronic
1196229025 X:113199665-113199687 CTGTTCTCATAAAGTGATTTAGG + Intergenic
1196465128 X:115964257-115964279 CTGGCTTCATAGAATGAATTAGG - Intergenic
1196516704 X:116621763-116621785 CTGGCTTCATAGAATGAATTAGG + Intergenic
1196575460 X:117312930-117312952 CTGGCTTCATAGAATGAATTAGG + Intergenic
1196675408 X:118415385-118415407 CTGGCTTCATAGAATGAATTAGG + Intronic
1196737851 X:118995978-118996000 CTGGCTTCATAGAATGAATTAGG - Intronic
1197065939 X:122234185-122234207 CTGGCTTCATAGAATGAATTAGG + Intergenic
1197953991 X:131927056-131927078 CTGGCTTCATAGAATGAATTAGG - Intergenic
1198153261 X:133932075-133932097 CTGTTTTAATAAAGAGAGGTGGG - Intronic
1198796843 X:140406315-140406337 CTGGCTTCATAGAGTGATTTAGG + Intergenic
1199398831 X:147373070-147373092 CTGGCTTCATAGAGTGAATTAGG + Intergenic
1199488619 X:148374355-148374377 CTGGCTTCATAGAATGAATTGGG - Intergenic
1199521197 X:148738122-148738144 CTGGCTTCATAGAATGAATTAGG + Intronic
1199668848 X:150124449-150124471 CTGGCTTCATAGAATGAATTAGG - Intergenic
1199821423 X:151452448-151452470 CTGGCTTCATAGAATGAATTAGG + Intergenic
1199916205 X:152343596-152343618 CTGTGTGAATGGAGAGAATTTGG - Intronic
1200491238 Y:3825653-3825675 CTGGCTTCATAGAATGAATTGGG - Intergenic
1200721705 Y:6615105-6615127 CTGGTTTCATAGAATGAGTTAGG - Intergenic
1200758460 Y:7013861-7013883 CTGTTCTAAAAGAGAGAAATTGG - Intronic
1201473821 Y:14360058-14360080 CTGTGTTCATAAAGAGTAGTGGG - Intergenic
1201756036 Y:17486217-17486239 CCGTGTTCATAGAATGAATTAGG - Intergenic
1201845516 Y:18419768-18419790 CCGTGTTCATAGAATGAATTAGG + Intergenic