ID: 912895866

View in Genome Browser
Species Human (GRCh38)
Location 1:113588319-113588341
Sequence CACATTGTATCCAACCACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 161}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912895866_912895870 13 Left 912895866 1:113588319-113588341 CCAGAGTGGTTGGATACAATGTG 0: 1
1: 0
2: 1
3: 7
4: 161
Right 912895870 1:113588355-113588377 ATGTGGTTGGAGCAGAGTGATGG No data
912895866_912895868 -4 Left 912895866 1:113588319-113588341 CCAGAGTGGTTGGATACAATGTG 0: 1
1: 0
2: 1
3: 7
4: 161
Right 912895868 1:113588338-113588360 TGTGGACAATGCATTCTATGTGG 0: 1
1: 0
2: 1
3: 25
4: 196
912895866_912895869 0 Left 912895866 1:113588319-113588341 CCAGAGTGGTTGGATACAATGTG 0: 1
1: 0
2: 1
3: 7
4: 161
Right 912895869 1:113588342-113588364 GACAATGCATTCTATGTGGTTGG No data
912895866_912895871 17 Left 912895866 1:113588319-113588341 CCAGAGTGGTTGGATACAATGTG 0: 1
1: 0
2: 1
3: 7
4: 161
Right 912895871 1:113588359-113588381 GGTTGGAGCAGAGTGATGGAAGG 0: 1
1: 1
2: 12
3: 99
4: 502

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912895866 Original CRISPR CACATTGTATCCAACCACTC TGG (reversed) Intronic
902074907 1:13776686-13776708 CTCATTTTATCCAACCCATCAGG + Intronic
902328968 1:15721181-15721203 TACATTGTATCCAACAACCTTGG - Intronic
903601858 1:24547814-24547836 AACATGGTAACCAACAACTCAGG + Intergenic
906332442 1:44897994-44898016 CACCTGTAATCCAACCACTCTGG - Intronic
909759341 1:79269727-79269749 CACACTGTATCTAGCTACTCTGG + Intergenic
909909140 1:81239397-81239419 TATATTGCATGCAACCACTCAGG - Intergenic
911263249 1:95712334-95712356 CACATTGGAGCCAACAATTCAGG - Intergenic
912895866 1:113588319-113588341 CACATTGTATCCAACCACTCTGG - Intronic
913470283 1:119179633-119179655 CACTATGTATCCAGCTACTCTGG + Intergenic
915767047 1:158373747-158373769 CACACTGTATCTAGCTACTCTGG - Intergenic
916277299 1:163008637-163008659 TACATTGTATCCATCCAGACAGG + Intergenic
923157138 1:231289254-231289276 CACTCTGTATCCAGCTACTCTGG - Intergenic
923965228 1:239130393-239130415 AACATTGTATTCCATCACTCAGG - Intergenic
1063322097 10:5060438-5060460 CACTCTGTATCTAACTACTCTGG - Intronic
1064399605 10:15010783-15010805 CACATGGTATACACCCACTGTGG - Intergenic
1064449104 10:15425850-15425872 CACTCTGTATCTAACTACTCTGG - Intergenic
1066468515 10:35674529-35674551 GACACTGTATCCAAAAACTCTGG - Intergenic
1067661947 10:48242725-48242747 GTCATTGTATCCAATCACTCAGG + Intronic
1068631345 10:59301275-59301297 CATACTGTATTCAACCAGTCTGG + Intronic
1073789677 10:106927897-106927919 CACTTTGCATCCAGCTACTCTGG - Intronic
1074688340 10:115980179-115980201 CACATTGGATCCAACCAAATTGG - Intergenic
1084812053 11:71618113-71618135 CACATGGTATACACCCACTGTGG + Intergenic
1086397649 11:86433317-86433339 GACACTGTATCCAGCTACTCTGG - Intergenic
1087956237 11:104291157-104291179 CACATTCTACCCACCCATTCTGG - Intergenic
1090063224 11:123481510-123481532 CACATTGTACCCAACCTATAGGG - Intergenic
1090602051 11:128382994-128383016 AACAGTGTATCCATCCTCTCAGG + Intergenic
1094327662 12:29257252-29257274 CACACTGTATCTAGCTACTCTGG + Intronic
1096358680 12:50965007-50965029 CCCATTGCATCTAGCCACTCTGG + Intronic
1096420017 12:51449029-51449051 CCCATTGTCTCCCACCCCTCTGG - Intronic
1097664100 12:62461026-62461048 CACCCTGTATCTAGCCACTCCGG - Intergenic
1097982104 12:65744921-65744943 GACACTGTATCCAGCTACTCTGG + Intergenic
1099134766 12:78882356-78882378 CAGATTGGATCCAATCACTGTGG - Intronic
1099333625 12:81325457-81325479 CTCATTTTATCAAACCAATCAGG + Intronic
1099432762 12:82607612-82607634 TTCATTGTATCCACTCACTCTGG + Intergenic
1099523818 12:83695849-83695871 CACTCTGTATCTAACTACTCTGG - Intergenic
1099907396 12:88788748-88788770 CAAATTGTATGCCACCACCCAGG + Intergenic
1099942775 12:89209553-89209575 CACATGGAATCCAATCACTGGGG + Intergenic
1104403954 12:128502145-128502167 CACATTGCATCCAACAACCATGG + Intronic
1109159765 13:58957897-58957919 CACACTGTATCTAGCTACTCTGG - Intergenic
1111658763 13:91183059-91183081 GACATTATACCCAACCACTGTGG + Intergenic
1112602882 13:100873731-100873753 CACATTGCACCAAACAACTCAGG + Intergenic
1115514710 14:34173886-34173908 CCCATAGTTTCCAACCACTGGGG + Intronic
1115612842 14:35065317-35065339 CATAATGTATTCAGCCACTCAGG + Intronic
1116798177 14:49414055-49414077 CAGATGGAATTCAACCACTCTGG + Intergenic
1117039337 14:51755043-51755065 CACATGGTATACACCCACTGTGG + Intergenic
1118951434 14:70439659-70439681 GAAATTGAATCCAACCACTTTGG - Intergenic
1120429644 14:84399002-84399024 CACACTGTATCTAGCTACTCTGG - Intergenic
1120891226 14:89492851-89492873 CACATTGTATCTACCCACTGGGG + Intronic
1121298600 14:92850882-92850904 CACCTGTTATCCAAGCACTCTGG + Intergenic
1126449384 15:48789188-48789210 AACATTGTTTCCAACAACTATGG - Intronic
1128600690 15:68993097-68993119 GAAATGGAATCCAACCACTCTGG - Intronic
1129636638 15:77325332-77325354 CTCACTGTAGCCTACCACTCAGG - Intronic
1130329331 15:82908972-82908994 CACAGTGGATGAAACCACTCAGG + Intronic
1130511046 15:84589446-84589468 CACATTGCAACCAACGACTGTGG + Intergenic
1132534991 16:474313-474335 CACATTTTACCCGACCACCCCGG - Intronic
1132836715 16:1957951-1957973 CACTTTGTATCTAGCTACTCTGG - Intergenic
1134776287 16:16856515-16856537 GGCACTGTATCCAACCACCCTGG + Intergenic
1136641260 16:31567582-31567604 CACGTTGCATCCAAGCACTTTGG + Intergenic
1143552840 17:7641603-7641625 GACACTGTATCTAACTACTCTGG + Intergenic
1144440050 17:15273007-15273029 CACATGGTATGCTCCCACTCAGG + Intergenic
1145107752 17:20134184-20134206 CAATTTCAATCCAACCACTCAGG + Intronic
1147431927 17:40376559-40376581 CACTTTGTATCTAGCTACTCTGG + Intergenic
1149797861 17:59538011-59538033 CACTTGGTGTCCTACCACTCCGG + Intergenic
1153114538 18:1639359-1639381 CACTTTCTAACCAACCACACTGG - Intergenic
1156023390 18:32624763-32624785 CAATTTCTATCCAACCACCCTGG + Intergenic
1158303819 18:56082898-56082920 CACTTTGCAGCCAATCACTCTGG + Intergenic
1159230910 18:65605856-65605878 CACTCTGTATCCAGCTACTCTGG + Intergenic
1160615151 18:80120595-80120617 CACATATAATCCCACCACTCTGG - Intronic
1162090792 19:8278564-8278586 CACTTGTTATCCAAGCACTCTGG - Intronic
1162093025 19:8293402-8293424 CACTTGTTATCCAAGCACTCTGG - Intronic
1164982294 19:32623319-32623341 CACATTGTATAAAACAATTCAGG - Intronic
1165415433 19:35690847-35690869 CACTCTGTATCCAGCTACTCTGG - Intergenic
929087205 2:38180462-38180484 CACTCTGGATCCAGCCACTCTGG + Intergenic
929788293 2:45007220-45007242 TCCATTGTAACCAGCCACTCCGG + Intronic
932350488 2:71026951-71026973 CACATGGTATACACCCACTGTGG + Intergenic
934590374 2:95544197-95544219 CACATGGTATACACCCACTGTGG + Intergenic
936495046 2:113012001-113012023 CCCATATTATCCAACCACTTGGG - Intergenic
938051930 2:128181611-128181633 CACATTACATCCTTCCACTCAGG - Intronic
940870015 2:158851661-158851683 CACATGGTATACACCCACTGTGG + Intronic
940872724 2:158872719-158872741 CACATGGTATACACCCACTGTGG + Intergenic
943629656 2:190236959-190236981 CACAATGTATCCATCAACACTGG + Intronic
944857834 2:203785365-203785387 CACTCTGTATCTAGCCACTCTGG - Intergenic
947026734 2:225744743-225744765 CACTCTGTATCCAGCTACTCTGG + Intergenic
947447036 2:230172174-230172196 CACCTTGTGTCCAACCTCTCAGG - Exonic
1170086454 20:12537817-12537839 CACATTCTACCCAACAACTTTGG + Intergenic
1176790728 21:13316226-13316248 GACATTGTATTAAACCACTTAGG - Intergenic
1177990102 21:28027175-28027197 GACATTGTATTAAACCACTTAGG - Intergenic
1178636263 21:34306945-34306967 CAGTTTGTATCCCACCTCTCAGG + Intergenic
1180650615 22:17373491-17373513 AACATTGTATCCTTCCACTCAGG + Intronic
1185168411 22:49276603-49276625 CACATTATATCCACCCATCCAGG + Intergenic
949124984 3:436458-436480 CAAATGGTATCCAACCACCAAGG + Intergenic
949770101 3:7569206-7569228 CACTCTGTATCTAACTACTCTGG + Intronic
950632739 3:14293740-14293762 CACTCTGTATCCAGCTACTCTGG + Intergenic
950929493 3:16774285-16774307 CACTCTGTATCCAGCTACTCTGG + Intergenic
952472393 3:33669825-33669847 CAAATGGGATACAACCACTCTGG + Intronic
952593757 3:34989147-34989169 CACTCTGTATCCAGCTACTCTGG + Intergenic
952980169 3:38727813-38727835 CAGCTTGTCTCCACCCACTCTGG - Intronic
955124917 3:56101663-56101685 CAAATGGAATCCAACAACTCGGG + Intronic
957043868 3:75359374-75359396 CACATGGTATACACCCACTGTGG - Intergenic
957075661 3:75601558-75601580 CACATGGTATACACCCACTGTGG - Intergenic
959981907 3:112527096-112527118 CACATGGTATACACCCACTGTGG - Intergenic
961272770 3:125701400-125701422 CACATGGTATACACCCACTGTGG + Intergenic
961688909 3:128654008-128654030 CACTCTGTATCTAACTACTCTGG + Intronic
963260340 3:143185959-143185981 CACATTGAATGCCACCACCCTGG - Intergenic
963382418 3:144548289-144548311 CACATTGTTCCCAGCTACTCGGG - Intergenic
964378614 3:156073687-156073709 CACTCTGTATCCAGCTACTCTGG + Intronic
971505604 4:27363436-27363458 CACAATGTATCCATCCACTCAGG + Intergenic
973687732 4:53390198-53390220 CACATGGAATCCCAACACTCTGG - Intronic
973922767 4:55705429-55705451 CACATTCTATCTGATCACTCTGG + Intergenic
976353947 4:84092975-84092997 CCCATTTTATCAATCCACTCAGG + Intergenic
981125012 4:141095593-141095615 CAAATTGTATGCAACCAAACAGG - Intronic
981437028 4:144736393-144736415 CACCTGTTATCCAAGCACTCTGG - Intronic
984329974 4:178302322-178302344 CACCTTGAATCCAAGCACTTTGG + Intergenic
985403764 4:189616398-189616420 CACACTGTATCTAGCTACTCTGG - Intergenic
986626292 5:9726057-9726079 CACCCTGTATCTAACTACTCTGG + Intergenic
986999889 5:13649831-13649853 TACACTGTGTCCAACCATTCTGG + Intergenic
987347338 5:16990731-16990753 CACTCTGTATCTAACTACTCTGG - Intergenic
987990114 5:25199500-25199522 CACTCTGTATCTAACTACTCTGG - Intergenic
990216241 5:53535569-53535591 CAAATGGTATACAACCACTTTGG - Intergenic
992985299 5:82222447-82222469 CACATAGTATGCAATCACACTGG + Intronic
993529083 5:89003374-89003396 CACTCTGTATCCAGCTACTCTGG - Intergenic
995319681 5:110819550-110819572 AACATGGTATCTGACCACTCTGG - Intergenic
999509142 5:152229555-152229577 TAAATTCTAGCCAACCACTCTGG - Intergenic
1003389742 6:5703516-5703538 TACATTTTATCCCACAACTCTGG + Intronic
1003578123 6:7315745-7315767 CACTTTGTATCTAGCTACTCTGG + Intronic
1003937260 6:10988260-10988282 CACACTGTATAAAACCACTATGG + Intronic
1005007705 6:21306484-21306506 CACAATATAATCAACCACTCTGG - Intergenic
1006036030 6:31212973-31212995 CACATGGAATCCAGCTACTCAGG - Intergenic
1007432628 6:41785581-41785603 CCCTTTGTATCCTGCCACTCTGG - Intronic
1009685458 6:66949944-66949966 CACTTTGTATCTAGCTACTCTGG + Intergenic
1013411578 6:109888432-109888454 GAAATGGAATCCAACCACTCTGG - Intergenic
1014499159 6:122164717-122164739 CACTCTGTATCTAACTACTCTGG - Intergenic
1015345820 6:132157329-132157351 CACATTCTTTTCAAGCACTCAGG + Intergenic
1015455561 6:133423485-133423507 AACATTGTATCAAACCTATCAGG - Intronic
1016494839 6:144649143-144649165 CAAATTTTATCCACCCACTGAGG - Intronic
1018853693 6:167660731-167660753 CATATTGGAACCAACCCCTCTGG - Intergenic
1019570022 7:1706790-1706812 CACCTTGTGTCCAGCCCCTCGGG + Intronic
1019695236 7:2442259-2442281 CACATTTTATCCATTCACCCAGG + Intergenic
1020306490 7:6839872-6839894 CACATGGTATACACCCACTGTGG - Intergenic
1022315155 7:29238868-29238890 CTCATTTTCTCCAGCCACTCTGG - Intronic
1024466009 7:49711866-49711888 CACACTGTATCTAGCTACTCTGG + Intergenic
1024741870 7:52363218-52363240 CACTTTGTATCTAGCTACTCTGG + Intergenic
1024858849 7:53814272-53814294 CACCTTCTATCCCAGCACTCTGG - Intergenic
1031219473 7:118946130-118946152 CACACTGTAACCACCCACTGGGG + Intergenic
1031284097 7:119842615-119842637 TACATTGTATCCATGCCCTCAGG + Intergenic
1031409309 7:121422338-121422360 CACTCTGTATCCAGCTACTCTGG + Intergenic
1031409329 7:121422498-121422520 CACACTGTATCTACCTACTCTGG + Intergenic
1039999175 8:42562076-42562098 GATATTGTATCCCAGCACTCTGG + Intergenic
1040791105 8:51231212-51231234 CACCCTGTATCCAGCTACTCTGG + Intergenic
1040791124 8:51231331-51231353 CACCCTGTATCCAGCTACTCTGG + Intergenic
1041537952 8:58948857-58948879 CACCTTTAATCCAACCACTCAGG + Intronic
1043946745 8:86262174-86262196 CACATTTTATCTAAGCTCTCTGG + Intronic
1045385383 8:101667117-101667139 CTCATTTTGTCCAGCCACTCGGG - Exonic
1046109016 8:109699042-109699064 TACATTTTATCCAACCAGTGTGG + Intergenic
1049607935 8:143538356-143538378 CACATTCTCTGCAGCCACTCTGG + Exonic
1051594036 9:18806112-18806134 CCCATTGGATCCATCCATTCAGG + Intronic
1056080842 9:83092889-83092911 CACTTTGTATCTAGCTACTCTGG - Intergenic
1056456279 9:86764025-86764047 CACAGTGAATCCAACCCCTCAGG - Intergenic
1056866369 9:90230181-90230203 CACATGGTATACACCCACTGTGG + Intergenic
1059593163 9:115686343-115686365 CTCATTTTATCTGACCACTCAGG - Intergenic
1188166858 X:26873403-26873425 CACTTTGTATCTAACTAATCTGG - Intergenic
1188242776 X:27809899-27809921 CACTCTGTATCCAGCTACTCTGG + Intronic
1189301574 X:39956214-39956236 CAAATTGTATCCAATTACCCTGG - Intergenic
1192820459 X:74639321-74639343 AACATTTCATCCAACCACTGTGG + Intergenic
1194684119 X:96890740-96890762 CACATGGTATTTAATCACTCAGG + Intronic
1195706483 X:107741410-107741432 CACATTGTCTCCTCCCACTCTGG + Intronic
1195896274 X:109749126-109749148 CACTCTGTATCCAGCTACTCTGG - Intergenic
1196041605 X:111210943-111210965 AACATGGTGACCAACCACTCTGG - Intronic
1200692768 Y:6323665-6323687 AACTTTGTTTCCAACCATTCAGG - Intergenic
1201042504 Y:9851061-9851083 AACTTTGTTTCCAACCATTCAGG + Intergenic