ID: 912895870

View in Genome Browser
Species Human (GRCh38)
Location 1:113588355-113588377
Sequence ATGTGGTTGGAGCAGAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912895866_912895870 13 Left 912895866 1:113588319-113588341 CCAGAGTGGTTGGATACAATGTG 0: 1
1: 0
2: 1
3: 7
4: 161
Right 912895870 1:113588355-113588377 ATGTGGTTGGAGCAGAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912895870 Original CRISPR ATGTGGTTGGAGCAGAGTGA TGG Intronic
No off target data available for this crispr