ID: 912896106

View in Genome Browser
Species Human (GRCh38)
Location 1:113591655-113591677
Sequence GTACCTGCTTTGTATAATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912896106_912896110 16 Left 912896106 1:113591655-113591677 CCACAATTATACAAAGCAGGTAC No data
Right 912896110 1:113591694-113591716 CTTCTTTATTGACAACTTTAAGG 0: 1
1: 0
2: 3
3: 15
4: 270
912896106_912896112 28 Left 912896106 1:113591655-113591677 CCACAATTATACAAAGCAGGTAC No data
Right 912896112 1:113591706-113591728 CAACTTTAAGGGATTTGTTAAGG 0: 1
1: 0
2: 0
3: 15
4: 196
912896106_912896113 29 Left 912896106 1:113591655-113591677 CCACAATTATACAAAGCAGGTAC No data
Right 912896113 1:113591707-113591729 AACTTTAAGGGATTTGTTAAGGG 0: 1
1: 0
2: 0
3: 19
4: 329
912896106_912896111 17 Left 912896106 1:113591655-113591677 CCACAATTATACAAAGCAGGTAC No data
Right 912896111 1:113591695-113591717 TTCTTTATTGACAACTTTAAGGG 0: 1
1: 0
2: 4
3: 38
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912896106 Original CRISPR GTACCTGCTTTGTATAATTG TGG (reversed) Intronic
No off target data available for this crispr