ID: 912896110

View in Genome Browser
Species Human (GRCh38)
Location 1:113591694-113591716
Sequence CTTCTTTATTGACAACTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 270}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912896109_912896110 -9 Left 912896109 1:113591680-113591702 CCAGGTGGTATATTCTTCTTTAT 0: 1
1: 0
2: 2
3: 14
4: 228
Right 912896110 1:113591694-113591716 CTTCTTTATTGACAACTTTAAGG 0: 1
1: 0
2: 3
3: 15
4: 270
912896106_912896110 16 Left 912896106 1:113591655-113591677 CCACAATTATACAAAGCAGGTAC No data
Right 912896110 1:113591694-113591716 CTTCTTTATTGACAACTTTAAGG 0: 1
1: 0
2: 3
3: 15
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912896110 Original CRISPR CTTCTTTATTGACAACTTTA AGG Intronic
901560119 1:10063383-10063405 CTTCTGTATTTTCAATTTTAGGG + Intronic
901713365 1:11133515-11133537 CTTCTTTATTGATTGCTATATGG + Intronic
903092539 1:20934528-20934550 CTTCTTTATTGAGAACATTGAGG - Intronic
904473860 1:30752063-30752085 CTTCTTTATGGTCCAGTTTACGG - Intronic
906703684 1:47878550-47878572 CTGCTTTTTTGACATCATTAAGG - Intronic
907878282 1:58517257-58517279 CTTCTTTATTAGCAATTTTAAGG - Intronic
908072661 1:60480148-60480170 ATTCTTTAATGACTGCTTTAAGG - Intergenic
908110917 1:60896430-60896452 CTTCTCTATCGACAATTTTGGGG + Intronic
908468517 1:64418725-64418747 CTTCTACATTTACAACCTTAGGG - Intergenic
908606169 1:65798952-65798974 CTTATTTATTGCCATCTTTGTGG + Intronic
909603216 1:77482375-77482397 ATTTTTTAATGAAAACTTTAAGG + Intronic
909864222 1:80646395-80646417 TTTCTTTTTTCACAACTCTAAGG - Intergenic
910994321 1:93087817-93087839 TATCTTTCTTTACAACTTTAAGG + Intronic
912896110 1:113591694-113591716 CTTCTTTATTGACAACTTTAAGG + Intronic
913690132 1:121271812-121271834 CTTCTTTATCGAAAAGTTAAAGG + Intronic
914147408 1:145008151-145008173 CTTCTTTATCGAAAAGTTAAAGG - Intronic
914802730 1:150973090-150973112 CTTCCTTGTTGAAAACTTTCAGG + Intronic
915680765 1:157580170-157580192 CTTCATTTTTGACAAATTCATGG + Intronic
917000160 1:170349005-170349027 CTTCTTTATTCATAACTTGTGGG - Intergenic
917046020 1:170861081-170861103 TTTCATTTTTGAAAACTTTATGG - Intergenic
917163647 1:172086683-172086705 CTACTTTATTGACAGCTTAGTGG + Intronic
917482073 1:175420786-175420808 CTTCTTTACTACCAACTTCATGG - Intronic
917566723 1:176220036-176220058 ATTCTTTATTTAAAATTTTAAGG - Intergenic
919598779 1:199596998-199597020 CTTTTTTATTTCCAACTTTTAGG - Intergenic
919766438 1:201130252-201130274 GTTCTTTATTGAGACCTGTAGGG - Intergenic
920477454 1:206290293-206290315 CTTCTTTATCGAAAAGTTAAAGG + Intronic
922374527 1:224947820-224947842 TTTCTTTATTTCCAAATTTATGG + Intronic
922713076 1:227847618-227847640 ATTCTTTATTGTGAACTCTAGGG - Intergenic
922888439 1:229039606-229039628 TTTCTTTAATTACAACTTCAAGG - Intergenic
923003058 1:230023442-230023464 TTGCTTCATTTACAACTTTATGG + Intergenic
1063164916 10:3452668-3452690 CTGTTTAATTGACAACTCTAAGG + Intergenic
1064822372 10:19351900-19351922 CTTCTTTATTAACAGATTTCTGG - Intronic
1064931521 10:20633549-20633571 CTTCTTCATTCACATTTTTATGG - Intergenic
1066131850 10:32402109-32402131 CTTATTTATTTACATCTGTATGG - Intergenic
1066591380 10:36998559-36998581 ATTCTTTATTTTCATCTTTATGG + Intergenic
1067179699 10:43975307-43975329 CATCTTTATTGACACATTTTTGG - Intergenic
1067304777 10:45051860-45051882 TTTCTTGTTTGATAACTTTAAGG - Intergenic
1069080122 10:64079634-64079656 CTTCTTTATGGGCTTCTTTATGG + Intergenic
1069206505 10:65694981-65695003 CTTCTTTATTAATATTTTTATGG - Intergenic
1069396777 10:67998219-67998241 ATTATTTATTGAGAACTTTTGGG - Intronic
1070455032 10:76604803-76604825 CATATTTTTTGTCAACTTTATGG - Intergenic
1073525005 10:104172363-104172385 CTTCTTTCATCATAACTTTATGG + Intronic
1073728335 10:106260604-106260626 CTAATTTATTGAAAACTCTAGGG + Intergenic
1074130640 10:110570402-110570424 CTTCTTTATTCCCAACTACAAGG - Intronic
1078787251 11:14506929-14506951 CTTCTTTACTCACACCTTTTAGG - Intronic
1079693798 11:23453358-23453380 CTTTTTTCTTGACACTTTTAGGG - Intergenic
1079731889 11:23943252-23943274 CTTATTTATTTACCACTTTCTGG + Intergenic
1083773842 11:64883564-64883586 CTTCTGTGGTGACAACATTAGGG + Intronic
1085866987 11:80305734-80305756 CCTCTGTATTGACAACTGAAAGG - Intergenic
1085896913 11:80650715-80650737 ATTCTTTATTTTCATCTTTATGG - Intergenic
1086077813 11:82873242-82873264 CTTCTTCATTGAGATCTTTCTGG - Intronic
1086787522 11:90988429-90988451 CATCTTTATTGTCAAATTTTTGG - Intergenic
1086898943 11:92344640-92344662 CTTCCTTCTTCACAACTTCATGG - Intergenic
1087343669 11:96941532-96941554 CCTCTCTATTAACAACCTTAGGG + Intergenic
1087507218 11:99040884-99040906 TTTCTTTAGTCACAATTTTAGGG + Intronic
1088287008 11:108199916-108199938 CTTCTTCATACACAACGTTAAGG + Intronic
1088603700 11:111508666-111508688 CTTCATTATTGCCAACATTTAGG - Intronic
1090828762 11:130406261-130406283 CTAATTTATTGAGAACTTTGAGG - Intronic
1092454177 12:8627450-8627472 CTTCTTTATAGACAGTTTAATGG + Intergenic
1093833720 12:23799692-23799714 TTTCTTTATTGTGTACTTTATGG - Intronic
1097356076 12:58603535-58603557 TTTCTTTTTTGAAAAATTTACGG + Intronic
1097675225 12:62594462-62594484 CTTGATTTTTTACAACTTTAAGG - Exonic
1098292530 12:68970572-68970594 CTTCTGTCTTCCCAACTTTATGG + Intronic
1098713215 12:73793787-73793809 TTTTTTTAGTGACGACTTTAGGG - Intergenic
1100001300 12:89839306-89839328 TTTCTTTATTGACAGAGTTAAGG + Intergenic
1100047357 12:90399036-90399058 CTTTTATATTGACAAGTGTACGG + Intergenic
1103755948 12:123207221-123207243 CTACGGTATTGTCAACTTTAAGG - Intronic
1105733872 13:23247452-23247474 CTTCTTTACTGGCTACCTTAAGG - Intronic
1108046006 13:46385887-46385909 CTTCTTCATTAACTTCTTTAGGG - Intronic
1108049963 13:46423971-46423993 CTCCTTTATGGAAATCTTTAGGG - Intronic
1108303087 13:49100801-49100823 CTTCTGTATTGACCATTTTCTGG + Intronic
1109542482 13:63797259-63797281 CTCCTTTATGGAAATCTTTAGGG - Intergenic
1110524488 13:76520273-76520295 ATTCTTTCTGGATAACTTTATGG - Intergenic
1111053070 13:82911680-82911702 CCTGTTTATTCACAAATTTAAGG + Intergenic
1111636930 13:90917340-90917362 CTAGTTTATTTACAAGTTTAGGG - Intergenic
1111788550 13:92822764-92822786 CTTCTTTTTTGAGGAGTTTAAGG - Intronic
1112968262 13:105226147-105226169 ACTGTTTATTGACAATTTTATGG + Intergenic
1114334203 14:21670885-21670907 CTTCTTTAGTGACATATTTTCGG - Intergenic
1115506304 14:34097375-34097397 CTGCTTTAATGACATCTTTGGGG - Intronic
1115873740 14:37837269-37837291 CTTCTTTATTGATAATTTATTGG + Intronic
1116241093 14:42343992-42344014 CTTCTTTTAGGACAAATTTAGGG - Intergenic
1117187039 14:53250494-53250516 TTTCTTTATTGAACACATTATGG + Intergenic
1117461601 14:55950830-55950852 CTTATTTCTTGTCAATTTTATGG - Intergenic
1120401041 14:84032125-84032147 TTTCTTTATACATAACTTTAAGG - Intergenic
1123894249 15:24812459-24812481 CTTTAATATTGACAACTTGAAGG - Intergenic
1125135836 15:36341893-36341915 CTTCTTTACTGCCAAATTGAGGG - Intergenic
1125770971 15:42165738-42165760 CTTCTTAATAGAGAATTTTAAGG - Exonic
1126173313 15:45712466-45712488 CTTGTTTATTTATATCTTTAAGG + Intergenic
1126186455 15:45835204-45835226 CTTCCTTGTTGCCAACATTATGG - Intergenic
1127126349 15:55816041-55816063 CTTGTTTTTTAACTACTTTAGGG + Intergenic
1127161466 15:56191318-56191340 TTTCTTTTTTGATAACTTTGAGG - Intronic
1127863085 15:63010753-63010775 CTTATTTAATTACAAGTTTATGG + Intergenic
1129805953 15:78458185-78458207 CTACTTTACGTACAACTTTATGG + Intronic
1131296512 15:91154223-91154245 CTTTTTTATAGACCAGTTTAGGG + Intronic
1131504196 15:93001389-93001411 CTATTTCAGTGACAACTTTATGG + Intronic
1131696347 15:94881633-94881655 CTTCTTTATATACAATGTTAAGG - Intergenic
1132126723 15:99233408-99233430 CATCTGTATTGTCAAATTTATGG - Intronic
1134741318 16:16549536-16549558 CTTCTTTATTTAAAAGTTGAAGG + Intergenic
1134926240 16:18162906-18162928 CTGCTTTATTTACAAGTTGAAGG - Intergenic
1135657686 16:24265753-24265775 ATTTTTTATTGACAACATTTAGG - Intronic
1136908164 16:34121563-34121585 TTTCTTTATTTAGAACTGTAAGG - Intergenic
1137085270 16:36112911-36112933 CTTCTATATAGAAAATTTTAAGG - Intergenic
1137857570 16:51810491-51810513 CTTATATAATGTCAACTTTATGG - Intergenic
1141048779 16:80742207-80742229 CTTCTTTAGTGACATCTTAGTGG - Intronic
1141550143 16:84801427-84801449 CTTCATTACTGGCAACTTTCTGG - Intergenic
1141707881 16:85678784-85678806 TTGCTTTATTTTCAACTTTAGGG + Intronic
1146874133 17:36394510-36394532 CTACTTCGTTGACAATTTTAAGG + Intronic
1146881486 17:36445421-36445443 CTACTTCGTTGACAATTTTAAGG + Intergenic
1147065254 17:37918363-37918385 CTACTTCGTTGACAATTTTAAGG - Intergenic
1148513546 17:48194430-48194452 CTTTTTTATTGACTGCTTTATGG - Intronic
1148536933 17:48447118-48447140 ATTCCTTATTGACAACATTTAGG - Intergenic
1150767674 17:68015095-68015117 CCTCTTCATAGACAAATTTAAGG - Intergenic
1150946680 17:69754169-69754191 CTTTTATACTGACAACTTTTGGG - Intergenic
1151303346 17:73245458-73245480 CTCCTTGAATAACAACTTTATGG - Intronic
1153046641 18:861477-861499 CTTTTGTTTTGACAATTTTAAGG + Intergenic
1153428576 18:4991522-4991544 CTTCTTTATATACAATGTTAAGG - Intergenic
1155354586 18:24940044-24940066 CTTCTGTATTCACAACTGAATGG + Intergenic
1156518891 18:37704924-37704946 CACCTTTATGGAGAACTTTATGG + Intergenic
1158307564 18:56123557-56123579 CTTCTTTATTTACCATTTTCAGG + Intergenic
1158556843 18:58482413-58482435 ATTCTTTATTGAGAACTTCTCGG - Intronic
1159019908 18:63134921-63134943 CTTCTCTCATGACAACTTTAGGG + Intronic
1159192053 18:65059122-65059144 CTTCTTGACTGATAATTTTAGGG - Intergenic
1160144409 18:76351783-76351805 CTTATTTAAAGACAACTTTATGG + Intergenic
1160375845 18:78410823-78410845 CTTCTTTTCTGTCAGCTTTATGG + Intergenic
1166114162 19:40642535-40642557 CTTCTTTATTTACAGCTCTGAGG - Intergenic
1166414645 19:42585827-42585849 CTTCTTTGTAGAAAACTCTAAGG + Intronic
927724329 2:25409649-25409671 CTTCCTTATTGTCAAATTCATGG + Intronic
928721727 2:34128981-34129003 GTTCTTTAATTAGAACTTTAGGG + Intergenic
929086264 2:38170420-38170442 CCTCTTTTTTCAAAACTTTATGG - Intergenic
933020226 2:77181601-77181623 CTTCATTTTTGAAAACTCTATGG - Intronic
933304502 2:80580502-80580524 GTTCTTTATTAACTAATTTAGGG + Intronic
933972012 2:87477516-87477538 GTCCTTTATTAACAACTTCAAGG + Intergenic
935916469 2:107957485-107957507 ATTTTTTATTTACAACTTTTAGG + Intergenic
936321715 2:111472681-111472703 GTCCTTTATTAACAACTTCAAGG - Intergenic
936786927 2:116104632-116104654 TTTCTTTTTTGAGAATTTTAGGG + Intergenic
938146744 2:128840731-128840753 AGTATTTATTGAGAACTTTATGG - Intergenic
938452770 2:131437264-131437286 TTCCTTTAGTGACAACTGTATGG - Intergenic
940411629 2:153370841-153370863 CTTCTTCATGGCCAACTCTATGG - Intergenic
942706409 2:178777537-178777559 CTTCTTTAATGACTACTTTATGG + Exonic
943397882 2:187364540-187364562 CTTCTATTTTGGAAACTTTAAGG + Intronic
943940741 2:193991375-193991397 ATTCATTATTGCCAACTTTCTGG - Intergenic
944017166 2:195055191-195055213 CGTCTTTATTCTCAACTTCAGGG + Intergenic
944358746 2:198825569-198825591 GTGTTTTATTTACAACTTTAAGG + Intergenic
945127704 2:206531217-206531239 CTTCTTTACTAACTACTTTCAGG - Intronic
945379115 2:209118346-209118368 CTTTTTTATTAACAACCTTCTGG + Intergenic
945508500 2:210671344-210671366 CCTCTGGATTGACAACTCTATGG - Intronic
946611886 2:221467453-221467475 CATCTTTCATGACATCTTTAGGG - Intronic
946668584 2:222077359-222077381 CTGCTTTATTGCCAACTGTCAGG + Intergenic
1169975364 20:11319962-11319984 CATCTTTGCTGACAATTTTAAGG + Intergenic
1170005211 20:11661220-11661242 CTTCTTTAATGTCATTTTTAAGG + Intergenic
1171471588 20:25376379-25376401 CTACTGAATTGAAAACTTTAAGG + Intronic
1171481264 20:25457511-25457533 CTACATTATTGACAAAGTTAAGG - Intronic
1173008728 20:39161229-39161251 CTACTTTGTTGAAAATTTTAAGG + Intergenic
1173432553 20:43002504-43002526 TTTCTTTTTTGAAAACTTAATGG - Intronic
1174951314 20:55044146-55044168 CTTCTTTTTTCACAATTTAATGG + Intergenic
1177871988 21:26584824-26584846 TTTCTTTATTGCCAATTTGATGG + Intergenic
1177950392 21:27528722-27528744 CCTCTTTAGTCACATCTTTATGG - Intergenic
1179245018 21:39625615-39625637 TTTCTTTATTGAGGACTTTTTGG - Intronic
1179358293 21:40682467-40682489 CTTCATCATCTACAACTTTAGGG - Intronic
1182690553 22:32158775-32158797 CTTCTTTGTTGAGGACTTTTTGG - Intronic
950939473 3:16878920-16878942 CCTCTTTATTAACAACTTTGGGG + Intronic
951599084 3:24353017-24353039 TCTCTTTAATGACAACTTCAGGG + Intronic
952216069 3:31279030-31279052 CTACTTTGTTCACAGCTTTATGG + Intergenic
955926595 3:64012173-64012195 ATTCTTTCTTTACAATTTTATGG + Intronic
955965837 3:64388482-64388504 CATCTTTGTTCACGACTTTAGGG - Intronic
955992172 3:64640181-64640203 CTTCCTTATTGACCACTACATGG + Intronic
957996335 3:87694682-87694704 TTTCTTTATTGAATACTTAAGGG - Intergenic
958700244 3:97579856-97579878 CTTGTTTATTGATATTTTTAAGG - Intronic
959542671 3:107558173-107558195 CTTTCTTAGTGACAACTCTAAGG - Intronic
963582643 3:147146211-147146233 CTTCTTTACTGCCACCTTTAGGG - Intergenic
965466798 3:169039724-169039746 TTTTTTTATTTACAACTTTTTGG - Intergenic
965796517 3:172446206-172446228 CTTCTTCCTTGACAATTTGAAGG - Intronic
966975945 3:185083354-185083376 CCTTTTTATTGACAACTATCAGG - Exonic
969906643 4:10403052-10403074 ATTCTTAATTGACAACTAAATGG + Intergenic
971139188 4:23905160-23905182 CATAACTATTGACAACTTTATGG + Intergenic
971511853 4:27436437-27436459 CATCATTATTGACAACCTTACGG + Intergenic
973248593 4:48037915-48037937 TTTTTTTAATGACAACTTTTTGG - Exonic
974124967 4:57684990-57685012 CTTCTGGATTGCCAACTTTTTGG - Intergenic
974905556 4:68051044-68051066 CTTATTTATTGTCAGCTTAATGG + Intergenic
976369234 4:84267816-84267838 CTTCCTTATTTACCACTTAATGG - Intergenic
976986274 4:91303050-91303072 CTTTTTTATTGATAAATTTATGG - Intronic
978184788 4:105844291-105844313 CTTCTTCATTAACAGCCTTATGG - Intronic
978647021 4:110946306-110946328 CTTATTTATACATAACTTTAGGG - Intergenic
978981718 4:114955579-114955601 ATTCTTTCTTGACTAATTTATGG - Intronic
979418321 4:120471723-120471745 TTTCTTTATTGAAAACTATCAGG + Intergenic
979709610 4:123763414-123763436 CATCTTTATTGACAAATTTTGGG - Intergenic
981784575 4:148462713-148462735 ATTTTTTATACACAACTTTATGG - Intergenic
981935376 4:150233969-150233991 CTTCTTTATTTCCACCTTTCAGG + Intronic
986117559 5:4793489-4793511 CTTCTTTACAGAGAACTATATGG + Intergenic
986117656 5:4794497-4794519 CTTCTTTACAGAGAACTGTATGG - Intergenic
986396308 5:7334152-7334174 TTTCTTAATGGAAAACTTTAAGG - Intergenic
987161821 5:15152632-15152654 CTTCTTTATTGAGCACCTTTAGG + Intergenic
988007070 5:25429002-25429024 CTTTTTTATTTAAAACTTTCAGG - Intergenic
988542809 5:32127242-32127264 CTTCTTTATAGAAAACTGGAAGG + Intronic
988555233 5:32230759-32230781 TTTCTTCTTTGAGAACTTTAAGG + Intronic
988762023 5:34320475-34320497 CTTCTTTGTGAACTACTTTAGGG + Intergenic
989365033 5:40646245-40646267 CTTCTTTTATTAGAACTTTATGG - Intergenic
990653749 5:57931758-57931780 GTTCTTTATTGTCAACTTTGTGG + Intergenic
991519373 5:67478651-67478673 CTTTTTTATTGTCAGCTGTAGGG - Intergenic
993304637 5:86260793-86260815 TTTCTTTATTTGCACCTTTATGG - Intergenic
995819574 5:116214203-116214225 CTTGTTCATTTACAACTTTATGG - Intronic
995940821 5:117581762-117581784 CTTATTGATTGAGAACTGTAGGG + Intergenic
996779148 5:127165779-127165801 TTTTTTTAATGACAACTTTGGGG - Intergenic
997169091 5:131697175-131697197 TTTTTTTATTGACAACTGTGTGG - Intronic
997288753 5:132707652-132707674 CTTCTCTATTGACAATTTGTAGG - Intronic
998297291 5:140983868-140983890 CATTTTTACTGGCAACTTTAAGG + Intronic
999376310 5:151088743-151088765 CTTCTTTCTTGGCTACTTTCAGG - Intronic
1000080751 5:157844232-157844254 TTTCTTTTTTGAGAACTTGAGGG - Intronic
1000220017 5:159206137-159206159 GTTTTTTATTGACAGCTTTCGGG - Intronic
1004329059 6:14704855-14704877 CTTATTTTTTGAGAACTTGAAGG + Intergenic
1006166154 6:32066762-32066784 TTTCTTTATTAACACCTTTATGG - Intronic
1007343844 6:41212747-41212769 CTATTTTATAGACAAATTTATGG + Intergenic
1008904693 6:56663376-56663398 CTTTTTAATTGATAACTTTCAGG + Intronic
1009577180 6:65480544-65480566 CTATTTTATTTACTACTTTATGG + Intronic
1009857624 6:69284792-69284814 CCTCTTTATTAAAAACTTTGAGG + Intronic
1010819057 6:80391947-80391969 CCTCTTTATTGATCACTTTCTGG + Intergenic
1010852144 6:80790413-80790435 CTTCTATATTCTCAACTTTTTGG + Intergenic
1010859770 6:80895602-80895624 CTTCTATATAGAAAACTCTAAGG - Intergenic
1011058465 6:83233661-83233683 ATTTTTTATTTAAAACTTTATGG + Intronic
1011402665 6:86980622-86980644 ACTCTATGTTGACAACTTTACGG + Intronic
1011543330 6:88457194-88457216 TTTCTTTCTTGACCACTTTTGGG - Intergenic
1011854014 6:91665955-91665977 CTTATTGAATGTCAACTTTAGGG + Intergenic
1011900805 6:92294101-92294123 CTTTTTTAATGACCATTTTAAGG + Intergenic
1012518432 6:100091616-100091638 CTTCTTTATTAATGATTTTAAGG + Intergenic
1013652646 6:112211706-112211728 TTTCTTGAAAGACAACTTTAAGG - Intronic
1013855843 6:114571130-114571152 CTTATTTATTAACCTCTTTATGG - Intergenic
1014530562 6:122554093-122554115 ATTTTTAATTGACAAATTTAAGG - Intronic
1014532998 6:122582119-122582141 CTTATTTTTTGTCATCTTTATGG + Intronic
1015703379 6:136060351-136060373 CTTCTTTTCTGCCCACTTTAAGG + Intronic
1017115349 6:150970954-150970976 CTTCTTTATCCAGAAATTTAAGG - Intronic
1017349525 6:153423262-153423284 CTTTCTTACTGACAGCTTTATGG + Intergenic
1017546255 6:155453761-155453783 CTTCTTTGTTTAAAAATTTAAGG + Intronic
1018002116 6:159588630-159588652 CCTCATTGTTGTCAACTTTAAGG + Intergenic
1020553260 7:9635133-9635155 TTTCCTTATTAACAACTTAAAGG - Intergenic
1020903254 7:14032182-14032204 CTACTTTATGGAGTACTTTAGGG + Intergenic
1021005460 7:15389502-15389524 CTTCTTTCTTCTCAACTATATGG - Intronic
1021264509 7:18503294-18503316 CTTCCTTATTGCCAACTTACTGG - Intronic
1021761374 7:23905299-23905321 CTTGGTTATGGACAGCTTTAAGG - Intergenic
1022416807 7:30185457-30185479 TTTCTTTATTGGCAACTAGATGG + Intergenic
1022845990 7:34210208-34210230 ATTCTTTATGGACTGCTTTATGG - Intergenic
1023226954 7:37980042-37980064 TTCCTTTAATGACAACTATATGG - Intronic
1023633966 7:42191245-42191267 CATGTTTATTTTCAACTTTATGG - Intronic
1024180393 7:46887448-46887470 CTTCTTTATTGATAATTTTAAGG + Intergenic
1026738414 7:72963502-72963524 CTCCTTTATTGCCCTCTTTAAGG - Intronic
1027105320 7:75401568-75401590 CTCCTTTATTGCCCTCTTTAAGG + Intronic
1027846838 7:83389275-83389297 CTTCTATATTGAGAACCTAAGGG + Intronic
1030271063 7:107668656-107668678 TATTTTTATTCACAACTTTAAGG + Intronic
1030486487 7:110174999-110175021 CTTTTTTATTCACAACTTATCGG + Intergenic
1031238189 7:119204194-119204216 CTTTCTTTTTGACTACTTTAGGG + Intergenic
1031826309 7:126570379-126570401 CTTCTTAAATTATAACTTTAGGG + Intronic
1034990386 7:155544310-155544332 CTTCTTTATTGACAGCTGCTGGG - Intergenic
1035415557 7:158681461-158681483 CTTCTCTATTCACACCTTTTGGG + Intronic
1035961683 8:4145286-4145308 CTTTCTTGTTGAGAACTTTATGG + Intronic
1037869457 8:22478650-22478672 TTTCTTGAGTGCCAACTTTATGG + Intronic
1038822847 8:30968705-30968727 CTTCTCCATTGCCAACTTTGAGG + Intergenic
1040857861 8:51968977-51968999 CTTCTTTATGGTCAAGCTTAAGG - Intergenic
1041859182 8:62492046-62492068 CTTCTATACTCACAACTCTAAGG - Intronic
1042062769 8:64839250-64839272 CTTCCTTTTTCACAACTTCATGG + Intergenic
1043776428 8:84276328-84276350 CACCTTTATGGACACCTTTATGG + Intronic
1044009113 8:86970087-86970109 CATTTTTATTTACAACTATATGG + Intronic
1044298880 8:90560630-90560652 CTAATTTATTTACATCTTTATGG + Intergenic
1044357379 8:91238929-91238951 CTTCTCTATGGACATCTATAAGG + Intronic
1044437941 8:92188110-92188132 TTTATTTCTTGACAACATTAAGG + Intergenic
1044526492 8:93258209-93258231 GTTATTTATTGACAATTTGAGGG + Intergenic
1045128493 8:99121724-99121746 CTTTTTTAATGACAATATTAAGG - Intronic
1045220306 8:100192498-100192520 CTTCTTTCTGGACATCTCTAAGG - Intronic
1045931403 8:107631152-107631174 CTTCTTTATTCACCACTTTATGG - Intergenic
1047244305 8:123125834-123125856 CTTTTTCATTGACTACTGTAAGG + Intronic
1050299875 9:4246918-4246940 CTTCTTTATTGCCAATGTTTGGG - Intronic
1051550530 9:18323544-18323566 CTTCTTTCTTGCTAATTTTATGG - Intergenic
1054756385 9:68962830-68962852 CATATATATTGACAACTTCAAGG + Intronic
1054893658 9:70282106-70282128 CTTCTTTATTGACAGATTAGAGG + Intronic
1055178688 9:73354678-73354700 CCTCTTTATTTCCTACTTTATGG + Intergenic
1055879501 9:80983044-80983066 GTTATTGATTGACACCTTTAAGG + Intergenic
1057047667 9:91898505-91898527 CTTTATTCATGACAACTTTATGG + Intronic
1057308910 9:93929194-93929216 CTTCTCTATTGACCACTTTCTGG - Intergenic
1058189951 9:101901333-101901355 GTTCTTTTTTGTCATCTTTAGGG + Intergenic
1058792306 9:108461625-108461647 TTTCTTTAATGAAGACTTTAGGG - Intergenic
1203366511 Un_KI270442v1:262905-262927 TTTCTTTATTTACAAATGTAAGG + Intergenic
1189757604 X:44286518-44286540 CTTCTTTACTGGCTACCTTAAGG - Intronic
1191603936 X:63041487-63041509 CTTTTTTATTGACCATTTGAAGG + Intergenic
1191870221 X:65739320-65739342 GTTCTTAAGTGACAGCTTTAAGG + Intronic
1193205498 X:78742527-78742549 CTTCTTTATGGCCTACTATATGG + Intergenic
1193550735 X:82889385-82889407 CTTCTCTTTTGTCAACTTTCAGG - Intergenic
1196362821 X:114886508-114886530 TTTCTTTAGTGGCAACTCTAGGG + Intronic
1198164381 X:134040010-134040032 CTTTTTTATTGTAAACTTTTGGG - Intergenic
1198590299 X:138172793-138172815 TTTCTTTATTGAAAACTTAATGG + Intergenic
1199489681 X:148384493-148384515 TTTATTTTTTGATAACTTTAAGG - Intergenic
1202137876 Y:21686059-21686081 TTTCTTTATTAATAACTATAAGG + Intergenic