ID: 912896111

View in Genome Browser
Species Human (GRCh38)
Location 1:113591695-113591717
Sequence TTCTTTATTGACAACTTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 355}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912896106_912896111 17 Left 912896106 1:113591655-113591677 CCACAATTATACAAAGCAGGTAC No data
Right 912896111 1:113591695-113591717 TTCTTTATTGACAACTTTAAGGG 0: 1
1: 0
2: 4
3: 38
4: 355
912896109_912896111 -8 Left 912896109 1:113591680-113591702 CCAGGTGGTATATTCTTCTTTAT 0: 1
1: 0
2: 2
3: 14
4: 228
Right 912896111 1:113591695-113591717 TTCTTTATTGACAACTTTAAGGG 0: 1
1: 0
2: 4
3: 38
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912896111 Original CRISPR TTCTTTATTGACAACTTTAA GGG Intronic
903990548 1:27265308-27265330 TTCTTTAATGTCTAGTTTAATGG - Intronic
904721089 1:32509109-32509131 TTCTTTATTTCTAACTTTTAAGG + Intronic
904889609 1:33769794-33769816 TTCCTTATTGAGAGCTATAAGGG - Intronic
905600254 1:39243997-39244019 TTCTTTATTGACAGTTTTCCAGG + Intronic
908630083 1:66094470-66094492 TTGCTAATTGAAAACTTTAAAGG - Intronic
909607537 1:77522034-77522056 TACATTAATGAAAACTTTAAGGG + Intronic
910193330 1:84616556-84616578 TTTTTTTGTGATAACTTTAAAGG - Intergenic
910193512 1:84618683-84618705 TTTTTTAATCACAATTTTAAAGG - Intergenic
910395471 1:86789411-86789433 TTCTCTATTGCCAATTTTCATGG - Intergenic
910520049 1:88110393-88110415 TTCCTTTTTGAAAAATTTAAAGG - Intergenic
910685414 1:89911233-89911255 TTCTTTTTTGAAAAGTCTAAAGG - Intronic
911324849 1:96458989-96459011 TTATTCATTGACAATTTTTATGG + Intergenic
911470091 1:98307668-98307690 TTCTTTTTTGACATCAGTAAAGG + Intergenic
912309103 1:108601803-108601825 TTCATTTTTGTCAACTTTATAGG - Intronic
912406149 1:109439391-109439413 ATCTTAATTGTCAACTCTAACGG - Intergenic
912896111 1:113591695-113591717 TTCTTTATTGACAACTTTAAGGG + Intronic
913034482 1:114949825-114949847 CTCCTTATTAACAAATTTAAGGG + Intronic
913043093 1:115048549-115048571 ATCTGAATTAACAACTTTAAAGG - Exonic
916925407 1:169514481-169514503 ATCTTTAATGACAACATAAATGG + Intronic
918186219 1:182129861-182129883 TTTTATCTTGGCAACTTTAATGG + Intergenic
918319435 1:183350659-183350681 TTCTTTATGAACATCATTAAAGG + Intronic
918924163 1:190758900-190758922 TTTTTTAATGACAACTTTTAAGG + Intergenic
919113835 1:193256002-193256024 TTCTTTAATGATGAGTTTAATGG + Intergenic
920892105 1:209997957-209997979 TTCTTTATTTAAAAAGTTAAAGG + Intronic
922090564 1:222391450-222391472 TTGCGTTTTGACAACTTTAAAGG - Intergenic
922374528 1:224947821-224947843 TTCTTTATTTCCAAATTTATGGG + Intronic
922888438 1:229039605-229039627 TTCTTTAATTACAACTTCAAGGG - Intergenic
924071858 1:240288760-240288782 TTCTTCATAGACAACTCTCAAGG - Intronic
1063031643 10:2241019-2241041 TTTTTTATTGACATCTTTCTTGG + Intergenic
1063872748 10:10436681-10436703 TTCATTCATGAAAACTTTAATGG + Intergenic
1064850097 10:19700381-19700403 GTTTTATTTGACAACTTTAAAGG + Intronic
1065478443 10:26166332-26166354 TTCTTTTTCGTCAACATTAAAGG + Intronic
1065596448 10:27317717-27317739 TTCTTTATTTGCCACTTTCATGG + Intergenic
1068047965 10:51911872-51911894 TTCTTTGTTGAAGGCTTTAATGG - Intronic
1068540774 10:58292797-58292819 TGCTTTATTGAAGCCTTTAAAGG - Intergenic
1068719401 10:60227229-60227251 TTTTTCATTCAGAACTTTAAAGG + Intronic
1069396776 10:67998218-67998240 TTATTTATTGAGAACTTTTGGGG - Intronic
1070967655 10:80539346-80539368 TTCTGGATTGAAAACTTCAAAGG - Intronic
1071358810 10:84824436-84824458 TTCTTTATGAACAACTTTAATGG + Intergenic
1071439627 10:85678803-85678825 ATTATTATTGAGAACTTTAATGG - Intronic
1072094642 10:92165907-92165929 TTCCTCATGGACAACTTTGAGGG - Intronic
1072522512 10:96240883-96240905 TTCTTTATTTAGAACTTGGAAGG + Intronic
1072688260 10:97551759-97551781 TTCCTTATTAACAACTTTTATGG + Intronic
1072988125 10:100161331-100161353 TTTTTTATTGACTTTTTTAAAGG - Intronic
1073740085 10:106396784-106396806 TTCTCTATTTCCAAATTTAATGG + Intergenic
1073950955 10:108808609-108808631 TTCTTTAATAACATCTTTAATGG - Intergenic
1074015960 10:109533967-109533989 TTATTTATTGACTTCTTTCATGG + Intergenic
1074605168 10:114955824-114955846 TACTGTATTGAAAATTTTAAAGG + Intronic
1075643655 10:124083840-124083862 TTCTTTATTAAAAACTGTGACGG + Intronic
1076220057 10:128726304-128726326 TTCTTTCATGGCAACTTGAATGG + Intergenic
1077198266 11:1292344-1292366 ATTTTTATTAATAACTTTAAAGG + Intronic
1077832107 11:5884602-5884624 TTCTTTATTCACATGTTTACAGG + Exonic
1080341557 11:31271609-31271631 TACTCTATTGACAAATTCAAAGG + Intronic
1081164939 11:39796860-39796882 TTATTTTTTGACATATTTAAGGG - Intergenic
1081248350 11:40797453-40797475 TTCTGTATTTACTTCTTTAATGG - Intronic
1082086268 11:48052603-48052625 TTCTTCATTGATACTTTTAAGGG + Intronic
1084292794 11:68186007-68186029 TTCTTTATTACCAGCTTGAATGG - Intronic
1084838073 11:71819964-71819986 TTCTTTATAGTAAAGTTTAATGG - Intergenic
1086046677 11:82541267-82541289 TTCTTTATTTTCAACATTATAGG - Intergenic
1086114105 11:83229277-83229299 TTCTTTAGTTACCACTTTAAAGG + Intronic
1086252573 11:84834369-84834391 TTGTTCACAGACAACTTTAAAGG + Intronic
1086734679 11:90291233-90291255 TTCCTAATTGCCAAATTTAATGG - Intergenic
1087454821 11:98371632-98371654 TTCTTGGTTGACAAAATTAAAGG + Intergenic
1087666561 11:101055837-101055859 TTATTTTATGACAACATTAAAGG + Intronic
1087713341 11:101580275-101580297 TCCTTTATTTAGAACTTTAAAGG - Intronic
1088226569 11:107626719-107626741 TTCTTTATTGCTTCCTTTAAAGG + Intronic
1088287009 11:108199917-108199939 TTCTTCATACACAACGTTAAGGG + Intronic
1088980815 11:114861733-114861755 TTCTTAATTGACATCTTCAAAGG + Intergenic
1090160597 11:124489593-124489615 TTCTAAATTGTCAACTTTATTGG + Intergenic
1092400628 12:8174111-8174133 TTCTTTATAGTAAAGTTTAATGG + Intronic
1092825753 12:12396939-12396961 TTCTATAATTACAACTTTCAAGG + Intronic
1093382529 12:18510618-18510640 TTCTTTCTAGATAATTTTAAAGG + Intronic
1093708653 12:22303940-22303962 TTCATTTTTGACTACTTAAAAGG + Intronic
1096058074 12:48672103-48672125 TTATTTAATAACAACTTGAATGG - Intronic
1097356077 12:58603536-58603558 TTCTTTTTTGAAAAATTTACGGG + Intronic
1097441513 12:59613726-59613748 TTGTTAATTGAGAACTTTTATGG + Intronic
1097718083 12:62988738-62988760 TTCTTTTTTTACAGCTTTATTGG + Intergenic
1097915206 12:65013876-65013898 TTATTGATTGATAATTTTAACGG - Intergenic
1098224738 12:68309928-68309950 TTTATTATTGACAACTTGATTGG - Intronic
1098895001 12:76049096-76049118 TTATTTATTAAAGACTTTAACGG + Intronic
1099273998 12:80552009-80552031 TTCTTTATTAAAGCCTTTAATGG + Intronic
1099650235 12:85417332-85417354 TTCTTTATTGACAATTGCATTGG - Intergenic
1099828923 12:87815004-87815026 TTCTTAATTGACACCTTTAAAGG + Intergenic
1099851565 12:88104237-88104259 TTCTTTACTTTCCACTTTAAAGG - Intronic
1100060005 12:90563493-90563515 TTCTGTTTTGTCAAATTTAAAGG + Intergenic
1100096188 12:91040145-91040167 TCCATTATTGGCAACTCTAAAGG - Intergenic
1100576937 12:95900778-95900800 TTATTTATTTACATTTTTAAAGG - Intronic
1100782555 12:98044811-98044833 TTTTTTATTGCCAACCTTAAAGG + Intergenic
1102740012 12:115198833-115198855 TCCTTCATTGCCAACTTTCAGGG - Intergenic
1103071506 12:117947321-117947343 TTCATTATTGAAAACTCTCAAGG + Intronic
1106307524 13:28526748-28526770 TTCTATATTAAGAACTTTATTGG + Intergenic
1107000961 13:35545115-35545137 TTCTTTATTTATACCTTTACTGG - Intronic
1107196034 13:37652629-37652651 TTCTTTCTAGACAAGTTTATAGG + Intronic
1108114945 13:47117041-47117063 TACTTTATTTAAAATTTTAAAGG + Intergenic
1108296855 13:49029659-49029681 TTCTTTCTTGTCTACTTAAAAGG - Intronic
1109284078 13:60391580-60391602 TACTTTATTGACCACTCTAAAGG + Intergenic
1110831922 13:80041709-80041731 TTCTTTTTTAACAGCTTTATTGG + Intergenic
1111023106 13:82480583-82480605 TTGTTTATTCACTGCTTTAAAGG + Intergenic
1111203729 13:84974964-84974986 TTCTTTTTTGTGAACTTCAAAGG + Intergenic
1111551855 13:89823109-89823131 TTCATTATTGATAAAATTAAAGG + Intergenic
1111974078 13:94947054-94947076 TTCTTTAATGAGAAGTTTCAAGG - Intergenic
1111974906 13:94956022-94956044 TTCTTTATTTAGAGTTTTAATGG - Intergenic
1112968263 13:105226148-105226170 CTGTTTATTGACAATTTTATGGG + Intergenic
1113108497 13:106797195-106797217 TTATTTATTAACAGCTTAAATGG - Intergenic
1113969067 13:114174775-114174797 TTCTGTATTGAAAACTTTTATGG + Intergenic
1114791434 14:25663335-25663357 TACTTTATTGATAACTTGACAGG + Intergenic
1115015392 14:28605827-28605849 TCTTTTATACACAACTTTAATGG + Intergenic
1116041416 14:39690665-39690687 TTCTTTGTTGGCAACAATAAAGG + Intergenic
1116536451 14:46037488-46037510 TTCTTTAATGAAAATTATAAAGG - Intergenic
1117168868 14:53069288-53069310 TTGCTTATTGGCCACTTTAATGG + Intronic
1119079145 14:71675513-71675535 TTCTTTAGAGATAACTTCAAAGG + Intronic
1119629680 14:76217229-76217251 TTTGTTATTGAACACTTTAAAGG - Intronic
1125770970 15:42165737-42165759 TTCTTAATAGAGAATTTTAAGGG - Exonic
1126832621 15:52623670-52623692 TTCCTTATTGTCAAATTCAATGG - Intronic
1127175723 15:56353901-56353923 TTCTTTCTTGCCAGCTTTAGAGG + Intronic
1130321498 15:82846232-82846254 TTCTTTATTGATGGCTTTAGTGG - Intronic
1131216572 15:90541678-90541700 TACTTTATTGTCAACTTTAGAGG + Intronic
1131696346 15:94881632-94881654 TTCTTTATATACAATGTTAAGGG - Intergenic
1134909480 16:18011453-18011475 TTTTTTATTGAAAATTTTATTGG + Intergenic
1135047030 16:19164410-19164432 TTCTTCATTGAGATCTGTAAAGG + Intronic
1135726676 16:24859440-24859462 TACTTTAAAGAAAACTTTAAAGG + Intronic
1137718726 16:50614595-50614617 CACTTTATTGACCACTTTACTGG + Intronic
1139458251 16:67101511-67101533 TTCTGAATTGACACCATTAAGGG + Intergenic
1145969400 17:28947785-28947807 TTCAGTATTGACATCTTCAAAGG + Intronic
1146041090 17:29455435-29455457 TTCTTTCTTTTCAACTTGAATGG + Intronic
1146436504 17:32853825-32853847 TAATTTATTGACAAATTTATTGG - Intronic
1150671372 17:67201320-67201342 TGCTTTATTGTCATCGTTAATGG - Intronic
1151149570 17:72072888-72072910 TTCTTTATAAACAGTTTTAAAGG - Intergenic
1153428575 18:4991521-4991543 TTCTTTATATACAATGTTAAGGG - Intergenic
1155083882 18:22436696-22436718 TTCTTTTTTAGCAGCTTTAAAGG + Intergenic
1155387325 18:25292829-25292851 TTCTTTAAACAAAACTTTAAGGG + Intronic
1155794149 18:30012720-30012742 TTTTTTTTTGAGAACTTTAAAGG - Intergenic
1156343205 18:36231005-36231027 TTCTTTATTACCAACTTGAGTGG + Intronic
1157002125 18:43539341-43539363 TTCCTTTTAGACAAATTTAATGG + Intergenic
1157051608 18:44172623-44172645 GTCTTTATTCACTACTGTAAGGG - Intergenic
1157853531 18:51082059-51082081 TTCGTTATTGCCAACTTTACTGG + Exonic
1158942395 18:62417377-62417399 TTCTTTTTTGACAATTCCAATGG - Intergenic
1160144410 18:76351784-76351806 TTATTTAAAGACAACTTTATGGG + Intergenic
1160573315 18:79833001-79833023 TCCTTCATTGCCAATTTTAAAGG - Intergenic
1162656905 19:12138143-12138165 TTCCTTTTTGAAAACTTTACAGG - Intronic
1164893721 19:31849480-31849502 TGCTTTGTTGACAACTTTATAGG - Intergenic
925051387 2:818391-818413 GTCTTAATTGAAACCTTTAATGG + Intergenic
926535539 2:14106680-14106702 TTTTTTATTAACAAATTTGAGGG - Intergenic
926652278 2:15359387-15359409 TTCTTAAATGACAAATATAAAGG + Intronic
930627569 2:53715459-53715481 TTCTTTATAGCCTACTTCAAAGG - Intronic
930648133 2:53934147-53934169 TACTTTGTTGACATCATTAAAGG - Intronic
931944620 2:67291592-67291614 TTCTAAATTAACAAATTTAAAGG + Intergenic
933034439 2:77375466-77375488 TACTCTCTTGACAAATTTAAGGG + Intronic
933236749 2:79872953-79872975 CTCTTTATTTCCATCTTTAAAGG - Intronic
933861323 2:86472233-86472255 TTCATTTTTGACTTCTTTAAAGG + Intronic
936959248 2:118056218-118056240 CTTTTTATTGACTACTTTCATGG + Intergenic
937444380 2:121944972-121944994 TTTTTCATTGACACCTTTGAAGG + Intergenic
938146743 2:128840730-128840752 GTATTTATTGAGAACTTTATGGG - Intergenic
939296758 2:140276161-140276183 TGCTATATTGACAATTATAATGG + Intronic
940146415 2:150549318-150549340 TCCTTTATCCACAACTTTCAAGG - Intergenic
940995635 2:160146690-160146712 TTCTTTCTTATCAACTTTAATGG + Intronic
941109692 2:161405508-161405530 TTCTTTATTGAGATGTTTTAAGG + Intronic
941470740 2:165883596-165883618 TTCTTTTTTTTAAACTTTAAAGG + Intronic
942055186 2:172175389-172175411 TTCTTTACTGCCAACTTTTAAGG + Intergenic
942288434 2:174445054-174445076 TTATTTATGGAGAACTTTGAGGG - Intronic
942706410 2:178777538-178777560 TTCTTTAATGACTACTTTATGGG + Exonic
942812134 2:180011860-180011882 TTCTTTATTAAAGACATTAAGGG - Intergenic
943326814 2:186509318-186509340 GTCTTTATTTACAACTTTATTGG - Exonic
943523659 2:188988750-188988772 TTCGTTATTTACAAACTTAAGGG - Intronic
943699515 2:190974546-190974568 TTCTACATGGACAACTTTAAAGG + Intronic
944930469 2:204513501-204513523 TTCTTTATTCTCATTTTTAATGG + Intergenic
945035657 2:205701770-205701792 TTCTCTTTTAAGAACTTTAAAGG - Intronic
945204416 2:207316761-207316783 TGCTTTATTCCCAAGTTTAAAGG - Intergenic
945558558 2:211309203-211309225 ATTTGTATTGAAAACTTTAAAGG + Intergenic
947202939 2:227631567-227631589 TTGTTTATTGACAACACTAAAGG + Intronic
947317647 2:228879000-228879022 TTATTTATTGAAAAATTTCATGG + Intronic
947393105 2:229660078-229660100 TTCTTCATTGACTTCTTTTAAGG + Intronic
947409297 2:229818734-229818756 TTCTTAATTGAAAACTTGACTGG + Intronic
947411731 2:229848377-229848399 TTCTTTTTTGATGACATTAATGG - Intronic
948119805 2:235521293-235521315 TTCTTTATTTTCAATTTTTAGGG + Intronic
948411302 2:237763473-237763495 CTCTTTTTTAACATCTTTAAGGG - Exonic
948643977 2:239392483-239392505 TTCTTTATGGCTCACTTTAAAGG + Intronic
1169260275 20:4133321-4133343 TTCTGTATTTACAAATTTTAAGG + Intronic
1172864220 20:38083126-38083148 TTCTTTAAGGACTATTTTAATGG - Intronic
1172955355 20:38753994-38754016 TTCTGTATTTACCACTTCAAGGG + Intronic
1173008729 20:39161230-39161252 TACTTTGTTGAAAATTTTAAGGG + Intergenic
1174832784 20:53828479-53828501 TTCTTTACTGAAAACTCTAAAGG - Intergenic
1177396482 21:20542005-20542027 TTCTTTCTTGACAATATTAAAGG - Intergenic
1178459755 21:32792174-32792196 TTCTTTACAGTCCACTTTAATGG + Exonic
1178682260 21:34682704-34682726 TCATTCATTGACATCTTTAAAGG + Intronic
1179321897 21:40300278-40300300 TTCTTTTTTGAGGACCTTAATGG - Intronic
1182393070 22:30015584-30015606 TTATTTATTGCCACCTTTACTGG + Intronic
1183268122 22:36843309-36843331 TGCTTTATCGACAAAGTTAATGG - Intergenic
1184719833 22:46305030-46305052 TTCTTTATTGATCACTTTCTAGG + Intronic
949223649 3:1667149-1667171 TTCTTTAATAACAGCTTTATTGG - Intergenic
949396887 3:3623985-3624007 TTCTTTATTGTTAAATTTTATGG + Intergenic
949611065 3:5704130-5704152 TTTTTTTTTCACAACTTTCATGG + Intergenic
949967181 3:9367182-9367204 TTCTTTCTTATAAACTTTAATGG - Intronic
949975594 3:9455641-9455663 TTCTTTTTTAACAGCTTTTAAGG + Intronic
950577737 3:13842872-13842894 GACTTTATGGACAACTTTAAAGG + Intronic
951599085 3:24353018-24353040 CTCTTTAATGACAACTTCAGGGG + Intronic
952352890 3:32557711-32557733 TTCTGTATTGGCCACTTTAAAGG - Intronic
952586359 3:34897525-34897547 TTCTTTAATTACCTCTTTAAAGG + Intergenic
953446398 3:42972281-42972303 TTCTTTATTTACAACTGTCTTGG + Intronic
953567543 3:44045731-44045753 TTTTTTATTCACGATTTTAAAGG + Intergenic
955013419 3:55043340-55043362 TTCTTTCTTGCCATTTTTAAGGG + Intronic
956229731 3:66999621-66999643 TTCATCATTGACAATTTTATTGG + Intronic
957345177 3:78951105-78951127 TTCTTAAAGGAAAACTTTAAGGG + Intronic
958168792 3:89912879-89912901 TTCTTTATTGACTACTTCAAAGG + Intergenic
958173820 3:89969969-89969991 TTGTTTAGTGACAACTTTTAAGG - Intergenic
958187297 3:90138361-90138383 TTCTTTATTACCTACATTAATGG + Intergenic
958662072 3:97082565-97082587 TTCTTAAATGAAAGCTTTAAAGG - Intronic
958700243 3:97579855-97579877 TTGTTTATTGATATTTTTAAGGG - Intronic
958956682 3:100472326-100472348 TTCTTTATTGACAATTGAATTGG + Intergenic
959095575 3:101951795-101951817 TTCTTTAGTAGAAACTTTAAAGG - Intergenic
959237880 3:103748005-103748027 ATCTTTATTGAAAACTGTACTGG + Intergenic
959597308 3:108142614-108142636 TTCTTTATGGACATCTTTCCTGG + Intergenic
959602697 3:108206919-108206941 TTCTTTATTGACTACAAAAATGG - Intronic
960290611 3:115879845-115879867 TTCTTTATTAAAAATTTTTATGG + Intronic
960678019 3:120215982-120216004 TTCTTTTTTGACAAAATTATAGG + Intronic
961480863 3:127179517-127179539 TTCTTTATTGGTAACTATTAGGG - Intergenic
963219629 3:142794309-142794331 TTCTTTATGGACTCCTATAAAGG + Intronic
963625140 3:147661979-147662001 TTCTTTTATGACAAATTAAATGG + Intergenic
963643211 3:147882817-147882839 TTCTTTATATACAATGTTAAAGG - Intergenic
963653211 3:148011403-148011425 TTGTTTATTGATTATTTTAATGG - Intergenic
964110947 3:153086908-153086930 TTGTTTATTGACAAGCTTCAGGG - Intergenic
964167075 3:153720990-153721012 TTCTTTAGAAAGAACTTTAAAGG - Intergenic
965048077 3:163604822-163604844 TTTTTTATTGTCAAATTTAGTGG - Intergenic
965621157 3:170643491-170643513 TTCTGTTTTGACCTCTTTAAAGG + Intronic
965796516 3:172446205-172446227 TTCTTCCTTGACAATTTGAAGGG - Intronic
965893971 3:173551092-173551114 ACCTTCATTGATAACTTTAACGG + Intronic
966140168 3:176748243-176748265 TTCTTTATAGATTATTTTAAAGG - Intergenic
966149638 3:176852867-176852889 TTTATTATTCACAACTTGAATGG + Intergenic
966723009 3:183083219-183083241 TTCTTTAAAGTCAACATTAAAGG + Intronic
967423761 3:189302698-189302720 TTATTTATTGTCAACTTCATTGG + Intronic
969779493 4:9387467-9387489 TTCTTTATAGTAAAGTTTAATGG - Intronic
970515385 4:16824437-16824459 TTCATTATTTACAGCTTTACTGG - Intronic
970716185 4:18927537-18927559 TTCTTAATTGTGTACTTTAATGG - Intergenic
972019482 4:34292962-34292984 TACTTTAATTACTACTTTAAAGG - Intergenic
972349473 4:38223373-38223395 TGCTTTATTTACAATTTTACAGG - Intergenic
972950114 4:44311096-44311118 TTATTTATAGACAAATTTGAAGG - Intronic
973200361 4:47494385-47494407 TTAATTAGTTACAACTTTAATGG - Intronic
974893450 4:67908810-67908832 GTCTTCATGGAAAACTTTAATGG + Intergenic
975254731 4:72219416-72219438 TTGTTTATTCACAAATTTCATGG - Intergenic
975895705 4:79087641-79087663 TTCTCTATTGTCATCTTCAAGGG - Intergenic
976849954 4:89533526-89533548 TTATTTATTTTCAACTTTTAGGG + Intergenic
978927572 4:114267513-114267535 TTTATTATTGAGCACTTTAATGG + Intergenic
979360530 4:119758913-119758935 TTTTTTAATGACAATTTAAATGG - Intergenic
979510928 4:121552877-121552899 TTATTTATTGACATTTTTGATGG + Intergenic
979709609 4:123763413-123763435 ATCTTTATTGACAAATTTTGGGG - Intergenic
980133496 4:128838324-128838346 CACTTTACTGACAAATTTAAAGG - Intronic
980949658 4:139361899-139361921 TTCTTTATTCTCATCTGTAAGGG - Exonic
981032239 4:140136963-140136985 TTCTATTTTGAAAATTTTAAAGG + Intronic
981337907 4:143587663-143587685 TTCTTTCTTGAACACTTTCATGG + Intronic
981784574 4:148462712-148462734 TTTTTTATACACAACTTTATGGG - Intergenic
981800544 4:148650361-148650383 TTTATAATTGATAACTTTAATGG + Intergenic
981935377 4:150233970-150233992 TTCTTTATTTCCACCTTTCAGGG + Intronic
982185903 4:152798338-152798360 TTCTTTATTAAATAATTTAATGG + Intronic
982577923 4:157140218-157140240 TTCTTCATTGAATACTTTGATGG - Intronic
983870037 4:172814662-172814684 TTCTTTACTGCAAACTTTTATGG - Intronic
984641642 4:182172339-182172361 TTTTGTATTGCAAACTTTAATGG - Intronic
985020374 4:185682687-185682709 TTCTTTATTCAAAAATATAATGG + Intronic
986176318 5:5354940-5354962 TTATTTACTGAAAACTTAAAAGG - Intergenic
988794471 5:34639873-34639895 TTCTTTAATGACTATTTTAGTGG + Intergenic
989219421 5:38939305-38939327 TTTTGAAATGACAACTTTAATGG - Intronic
989668607 5:43887662-43887684 TTCTTTATCGCCAACATTAGTGG - Intergenic
990793875 5:59517879-59517901 TTTTTTACTGGAAACTTTAAAGG - Intronic
991678377 5:69111977-69111999 TTCTATATTTACAAATTTACAGG - Intronic
993377588 5:87167523-87167545 TTATTTATTGCTACCTTTAAAGG - Intergenic
993841641 5:92887316-92887338 TTCCTTATTGAAAACTTTTTTGG - Intergenic
995012754 5:107276258-107276280 TACTTTATTTACCTCTTTAAAGG + Intergenic
995013848 5:107288202-107288224 TTCTTTATGGGCAACTTTATTGG - Intergenic
995221388 5:109652628-109652650 CTACTTATTGACAATTTTAAGGG + Intergenic
995364151 5:111335951-111335973 TTGTTTATTTAAAAATTTAAAGG - Intronic
996509304 5:124301000-124301022 TTATTTTTTCACAGCTTTAACGG - Intergenic
996541756 5:124637488-124637510 TTATTTATTTACAATTTTAAAGG + Exonic
997629936 5:135359801-135359823 TTCTTTATTGACATCAAAAAGGG - Intronic
998241519 5:140450001-140450023 TTCTGGATTGACAGCATTAAAGG - Intronic
998297292 5:140983869-140983891 ATTTTTACTGGCAACTTTAAGGG + Intronic
998669573 5:144338621-144338643 TCCTTAAGTGACAAATTTAAGGG + Intronic
999059564 5:148618772-148618794 TTCTTGAATGAAGACTTTAACGG - Intronic
999592694 5:153166297-153166319 TTCTTTATTCACATTTTTGAAGG + Intergenic
1000080750 5:157844231-157844253 TTCTTTTTTGAGAACTTGAGGGG - Intronic
1000289298 5:159855229-159855251 TTCTTTTTTGCCAACATTTAAGG + Intergenic
1002961153 6:1915939-1915961 TTCTTTATGAACAGCTCTAATGG - Intronic
1005256597 6:24010222-24010244 TTTCTTTTTGACAGCTTTAAAGG - Intergenic
1005446714 6:25931554-25931576 TTATTTATTTACAATTCTAAAGG + Intergenic
1008142183 6:47844691-47844713 TTCTTCATTGAGAAATGTAAAGG + Intergenic
1008189361 6:48435698-48435720 TACTTTATTCACATCTTTTAAGG - Intergenic
1008268236 6:49459081-49459103 TTCTATAAGGACAACATTAAGGG - Exonic
1009280067 6:61737847-61737869 TTCTTTTTCTACAACTTTATTGG - Intronic
1009857625 6:69284793-69284815 CTCTTTATTAAAAACTTTGAGGG + Intronic
1009989144 6:70819525-70819547 ATTTTTATTGAAAATTTTAATGG + Intronic
1010073142 6:71768013-71768035 TGCTTTATAAGCAACTTTAATGG - Intergenic
1010308357 6:74351468-74351490 TTCTTAAGTGGCCACTTTAAGGG - Intergenic
1010842286 6:80660409-80660431 TTTATTAATGAAAACTTTAACGG + Intergenic
1011025100 6:82859948-82859970 TAACTTATTGACAACATTAAAGG - Intergenic
1011472580 6:87722475-87722497 TGCTTTGTAGACAACTTTACAGG + Intergenic
1011543329 6:88457193-88457215 TTCTTTCTTGACCACTTTTGGGG - Intergenic
1012155780 6:95818437-95818459 TAATTTATTGAGAATTTTAAGGG - Intergenic
1012518433 6:100091617-100091639 TTCTTTATTAATGATTTTAAGGG + Intergenic
1012721352 6:102750262-102750284 TTGTATATTTTCAACTTTAATGG + Intergenic
1013310565 6:108889856-108889878 TACTTTATTAACAACTCTATTGG + Intronic
1013473278 6:110485211-110485233 TTCTTTACAGACAATCTTAATGG + Intergenic
1013657751 6:112263018-112263040 TTCTCTATTGAAAACATTACCGG - Intergenic
1013729341 6:113145204-113145226 TTCTCTATTGAGAACTACAAAGG - Intergenic
1014763327 6:125382336-125382358 TCCTCTATTGACAACTTTTTTGG + Intergenic
1015122546 6:129715768-129715790 CTCTTCATTGACAACTAGAATGG + Intergenic
1016460993 6:144280067-144280089 TTCTTTATTGAAAACATTCCTGG - Intergenic
1016619696 6:146093737-146093759 TCCTTTATTGAGCACCTTAATGG - Intronic
1016905295 6:149143949-149143971 CTCTTTCTTGAAACCTTTAATGG - Intergenic
1018002117 6:159588631-159588653 CTCATTGTTGTCAACTTTAAGGG + Intergenic
1018401042 6:163420409-163420431 TTGTTTGTTGATAACTTAAAAGG + Intronic
1020414685 7:7932482-7932504 TTCTATATTGAGATATTTAATGG + Intronic
1020699022 7:11454145-11454167 TCTTTTATTGACAATTTTATAGG + Intronic
1021720359 7:23498952-23498974 TTCTTTTTTAAAAACTTAAAAGG - Intergenic
1026372173 7:69711418-69711440 ATCATTAATCACAACTTTAAAGG - Intronic
1028266826 7:88735854-88735876 TTCTGTATAGACAACTTTGCAGG - Intergenic
1030371992 7:108711128-108711150 TTCTGTATTAACTAATTTAAAGG - Intergenic
1030739167 7:113087221-113087243 TTCTTTAGTGACATCCTTTAAGG - Intronic
1031451287 7:121923307-121923329 TTCTTTAGTAACTTCTTTAAAGG + Intronic
1031499521 7:122495829-122495851 TTATTTTTTGCCAACTTTGATGG + Intronic
1031548319 7:123077735-123077757 TACTTTGCTTACAACTTTAAAGG - Intergenic
1031695629 7:124849247-124849269 TTCTTATTTGACTACTTTTATGG - Intronic
1032481033 7:132247387-132247409 TTCTTTTTTGACAATTTTGAAGG - Intronic
1032664489 7:134021962-134021984 CCTTTTATTGACAACATTAAAGG + Intronic
1033080176 7:138289198-138289220 TTCTTTATTTACAACTGTCTTGG - Intergenic
1033972915 7:147065234-147065256 TTATTAATTGAAAAGTTTAATGG + Intronic
1034824376 7:154248265-154248287 TTCTTTCTTGTTCACTTTAATGG - Intronic
1035247322 7:157572242-157572264 TAGTTCACTGACAACTTTAATGG - Intronic
1036276926 8:7361429-7361451 TTCTTTATAGTAAACTTTAATGG - Intronic
1036344405 8:7948914-7948936 TTCTTTATAGTAAAGTTTAATGG + Intronic
1036839746 8:12109685-12109707 TTCTTTATAGTAAAGTTTAATGG + Intronic
1036861537 8:12355925-12355947 TTCTTTATAGTAAAGTTTAATGG + Intergenic
1037405061 8:18533333-18533355 ATCTTTAAAAACAACTTTAAAGG - Exonic
1037869458 8:22478651-22478673 TTCTTGAGTGCCAACTTTATGGG + Intronic
1038822848 8:30968706-30968728 TTCTCCATTGCCAACTTTGAGGG + Intergenic
1040695428 8:49991963-49991985 TTATTTTTTAACAGCTTTAATGG - Intronic
1040857860 8:51968976-51968998 TTCTTTATGGTCAAGCTTAAGGG - Intergenic
1041417237 8:57624469-57624491 TTTTTCCTTGAGAACTTTAATGG - Intergenic
1042366270 8:67940204-67940226 TTCTATTTAGACAATTTTAATGG - Intergenic
1043730354 8:83670618-83670640 TTCTTTTCAAACAACTTTAATGG - Intergenic
1044107227 8:88224695-88224717 TACTTTTATGACAAGTTTAATGG + Intronic
1044437942 8:92188111-92188133 TTATTTCTTGACAACATTAAGGG + Intergenic
1044710133 8:95049162-95049184 CTCCTTATTGCCAAATTTAATGG + Intronic
1045699945 8:104854299-104854321 TGATTTAAAGACAACTTTAAGGG - Intronic
1045759602 8:105588660-105588682 TTTTTTATTGGCAGCTTGAATGG + Intronic
1045851409 8:106703189-106703211 TTCATTATTGACAAAATAAAAGG - Intronic
1045966307 8:108028727-108028749 TTCTCTATTGCCAACTTTACAGG + Intronic
1046301356 8:112296089-112296111 TGCTTTTAAGACAACTTTAAAGG - Intronic
1046558039 8:115800857-115800879 TTTTCTATTCACAACTTAAATGG - Intronic
1047075471 8:121397238-121397260 CTCTTTAATGAAAAGTTTAAGGG + Intergenic
1047810003 8:128398177-128398199 TTTTTAATTGCCAAATTTAAAGG - Intergenic
1048905870 8:139087981-139088003 TTCATTATTGATAAAATTAAAGG - Intergenic
1050033101 9:1406878-1406900 ATCATTTTTGAAAACTTTAAAGG - Intergenic
1050767231 9:9150109-9150131 TTGTTTTTTGAAAACTTAAAAGG + Intronic
1051009198 9:12389777-12389799 TTCTTCATTGCCAAATTTGAAGG - Intergenic
1051209461 9:14726425-14726447 TTGTTTATTTAAAAGTTTAAGGG - Intergenic
1051809650 9:21034141-21034163 TTCTTTTTTGGCAACTAAAAAGG - Intergenic
1051931056 9:22386565-22386587 TTCCTTAATGACAAATTGAATGG + Intergenic
1052633897 9:31075040-31075062 TGCATTAATGACAACTTTAAAGG + Intergenic
1053310874 9:37018735-37018757 TTTATTGTTGACAACTTAAACGG + Intronic
1053450020 9:38185722-38185744 TTTATTTTTGACAACTTTAGTGG - Intergenic
1053610254 9:39705747-39705769 TCCTTTATTGTTAACTTTATAGG - Intergenic
1054087998 9:60765409-60765431 TCCTTTATTGTTAACTTTATAGG + Intergenic
1054243270 9:62636648-62636670 TCCTTTATTGTTAACTTTATAGG + Intergenic
1054557395 9:66671166-66671188 TCCTTTATTGTTAACTTTATAGG + Intergenic
1055277664 9:74637396-74637418 TTCATTATTGATAAATTTGATGG - Intronic
1055541251 9:77307711-77307733 TTCTTTATTCATAACTTCATTGG + Intronic
1055758342 9:79579330-79579352 TTCTTTAATGACAGCATTACAGG - Intronic
1055815952 9:80207020-80207042 TTATTTATTGACAAATATTAAGG + Intergenic
1056240304 9:84639145-84639167 TTCTTTATTAACAACAATACTGG + Intergenic
1058041123 9:100303114-100303136 TTCCTTAATGACAACATTTATGG + Intronic
1059114024 9:111584604-111584626 TTCCTTTTTTACAACTTTGAAGG - Intronic
1059277900 9:113110871-113110893 TTCTTTGGTGACAACTTTATAGG - Intergenic
1059278351 9:113113680-113113702 TTCTTTGGTGACAACTTTATAGG + Intergenic
1059785339 9:117576318-117576340 TTTTTTGTTTCCAACTTTAATGG - Intergenic
1060746228 9:126133297-126133319 TTGTTTATTGATAACATTTAAGG - Intergenic
1061777636 9:132976230-132976252 GCCTTTATTGACATCTTTAATGG - Intronic
1186163161 X:6799544-6799566 TTATTTTTTGAAAACCTTAATGG + Intergenic
1187515788 X:19968713-19968735 TTCTTTGTTAAGAACTATAAAGG - Intronic
1188571171 X:31587071-31587093 TTCTTTTTTAACATCTTTAAAGG - Intronic
1188645257 X:32558713-32558735 TTCTTTATTTATAAATTTAAAGG - Intronic
1188902318 X:35749087-35749109 TTCTTTAGTGATAATTTTGAGGG + Intergenic
1190550026 X:51570483-51570505 TACTTTATTGAGAACTATTAAGG + Intergenic
1191070806 X:56397991-56398013 TTCTTTATATACAATATTAAGGG - Intergenic
1191603937 X:63041488-63041510 TTTTTTATTGACCATTTGAAGGG + Intergenic
1193709147 X:84858276-84858298 TTATTTTTTGCCAACTTAAAAGG - Intergenic
1194731801 X:97463952-97463974 TTTTTTATTGACAAACTAAAGGG + Intronic
1195420137 X:104666187-104666209 TTCTTTGTTGCCAAACTTAATGG - Intronic
1196118024 X:112018075-112018097 GTTTTTATTGACATCTTTGAAGG + Intronic
1196881495 X:120202213-120202235 TTCTTTATTAACAACTGTAATGG + Intergenic
1197417696 X:126195063-126195085 TTCTTAATTGTCATCATTAATGG - Intergenic
1197740007 X:129883796-129883818 TTCTTTCTTTCCAACTTGAATGG + Intergenic
1197897415 X:131330228-131330250 TTCTTTATTAACAATTCTGATGG - Intronic
1198002653 X:132454983-132455005 TTCTTTATGGAAAAATTTAGAGG + Intronic
1198971737 X:142289345-142289367 ATCTTTCATGACAACTTTATTGG - Intergenic
1199341295 X:146680231-146680253 TTCCTTTTAGACAACCTTAAAGG - Intergenic
1199489680 X:148384492-148384514 TTATTTTTTGATAACTTTAAGGG - Intergenic
1199592309 X:149478450-149478472 TTCTTGATTAACAGCTGTAATGG - Intergenic
1200913048 Y:8547870-8547892 TTCCTTGTTGGCAACTCTAATGG - Intergenic
1200915595 Y:8568580-8568602 TTCTTTGTTGGCAGCTGTAATGG - Intergenic
1201897736 Y:19011021-19011043 TTATATGTTGACAACATTAATGG - Intergenic