ID: 912896112

View in Genome Browser
Species Human (GRCh38)
Location 1:113591706-113591728
Sequence CAACTTTAAGGGATTTGTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912896106_912896112 28 Left 912896106 1:113591655-113591677 CCACAATTATACAAAGCAGGTAC No data
Right 912896112 1:113591706-113591728 CAACTTTAAGGGATTTGTTAAGG 0: 1
1: 0
2: 0
3: 15
4: 196
912896109_912896112 3 Left 912896109 1:113591680-113591702 CCAGGTGGTATATTCTTCTTTAT 0: 1
1: 0
2: 2
3: 14
4: 228
Right 912896112 1:113591706-113591728 CAACTTTAAGGGATTTGTTAAGG 0: 1
1: 0
2: 0
3: 15
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912896112 Original CRISPR CAACTTTAAGGGATTTGTTA AGG Intronic
900217507 1:1489640-1489662 CAAAATTAAGGGATTTGGGAGGG - Intronic
902734415 1:18390695-18390717 CAACTTTAAGGGCTTTAGTCTGG + Intergenic
905363767 1:37437664-37437686 CATCTTTGAGGGGTTTGCTAAGG - Intergenic
905681144 1:39871766-39871788 CCACTATAAGGGATTTTTTAGGG + Intronic
908602304 1:65753859-65753881 CAATTTTAAGGGATTTCTAATGG + Intergenic
911568517 1:99494020-99494042 AAACTTTCATGCATTTGTTAGGG + Intergenic
912896112 1:113591706-113591728 CAACTTTAAGGGATTTGTTAAGG + Intronic
915907976 1:159893152-159893174 CAACTTGAAAGGACTTGTTGAGG + Intronic
916571075 1:166028292-166028314 TAACTTCTAGGGATTTCTTAAGG + Intergenic
917826209 1:178823854-178823876 CAAGTTTAAGGGAGTGGTTGGGG + Intronic
918095582 1:181331259-181331281 CTATTTTAGGGGATTTATTAGGG + Intergenic
919077721 1:192832968-192832990 AAAAATCAAGGGATTTGTTATGG + Intergenic
922397942 1:225222246-225222268 CAAGTTTGAGGGAATTGTTCAGG + Intronic
1065031932 10:21595243-21595265 GACATTTAAGGGATCTGTTAAGG + Intronic
1066132365 10:32407027-32407049 CAATTTTAAGTGAATTGTTCTGG + Intergenic
1067674576 10:48360883-48360905 GAATTTTAAGGGATTGGTAATGG + Intronic
1068428632 10:56902615-56902637 GCACTTTAAGGGATTTGATCAGG + Intergenic
1068644025 10:59445552-59445574 CAAGTTTGAGGAATTTGTGAAGG + Intergenic
1071122657 10:82297580-82297602 AAACTTTAGGGGCTTTCTTATGG - Intronic
1074142031 10:110681416-110681438 AAACTGTAAGGTATTTGTAAAGG + Intronic
1075046255 10:119148817-119148839 GCACTTTAAGGGACTTGTAAGGG + Intronic
1075432990 10:122405597-122405619 CAAACCTAAGGGATTTGTTATGG + Intronic
1075607582 10:123824748-123824770 TAACTTCAAGGGATGTGGTAGGG + Intronic
1077969061 11:7168615-7168637 CAGCTTGAAGGAATTTGTTTAGG - Intergenic
1078705880 11:13743734-13743756 TAACTATAATGGATGTGTTAAGG + Intergenic
1078806715 11:14712955-14712977 CAACTTTATGAGATATATTAAGG - Intronic
1079193000 11:18297525-18297547 CACCTTTAAAGGATTTTGTAGGG - Intronic
1079680617 11:23292620-23292642 CAAATTTAAGAGATTTTTGAAGG + Intergenic
1079794698 11:24786114-24786136 TAACTTTGAGGGATTTGTGAGGG - Intronic
1080088292 11:28313831-28313853 CATATTTAAGGGATTTTTTTTGG + Intronic
1082234449 11:49806286-49806308 AAACTTCCAGGGATTTTTTAAGG - Intergenic
1082635944 11:55593936-55593958 CAACTTTACGGTATTTTTTGAGG + Intergenic
1083002123 11:59302120-59302142 CAATTTCAACAGATTTGTTAGGG + Intergenic
1085926780 11:81033224-81033246 CAAGTTCAAGGGAATTGTTCAGG + Intergenic
1088395464 11:109363166-109363188 CAAGTGAAAGAGATTTGTTATGG - Intergenic
1091215917 11:133901644-133901666 CATCTTTAATGTATTTTTTATGG - Intergenic
1092223390 12:6730677-6730699 TAACTTTAATGGTTTTTTTAAGG - Exonic
1093375269 12:18418545-18418567 ATAGTTTAAGGGATTTGATAAGG + Intronic
1093948048 12:25133330-25133352 TAATTTAATGGGATTTGTTAGGG - Intronic
1094629990 12:32164581-32164603 AAACTTTATGGTATTTGTTATGG + Intronic
1095597967 12:43980559-43980581 CAAGTTTAAGGGAATTATTCAGG - Intronic
1096784930 12:54011405-54011427 AAACTTCAAGGGAGTTGCTAAGG - Exonic
1100584020 12:95962568-95962590 CATTTTTAAGGGATTTGTAAGGG - Intronic
1100954531 12:99892387-99892409 CACCGTAAAGGGATTTTTTAAGG + Intronic
1102633671 12:114303661-114303683 TACCTTAAAGGGATTTGGTAGGG + Intergenic
1107351275 13:39517584-39517606 CAACTTCTAGGGATTTTTCAAGG - Intronic
1107781222 13:43904444-43904466 CAACCTTAAGGGATAAGTTTAGG + Intergenic
1109310412 13:60686333-60686355 CAACTTTATGAGATTTCTAATGG - Intergenic
1109850068 13:68051390-68051412 CAAATTTATGGGATTAGCTATGG + Intergenic
1111779304 13:92701466-92701488 CAATTTTCAGGGATTTTTCAGGG + Intronic
1114720094 14:24872486-24872508 CAACTCTTAGGGTTTTGTGATGG - Intronic
1115616635 14:35101550-35101572 AAACTTTTAGGGATTTCTTTTGG + Intronic
1115848431 14:37565092-37565114 CAACTTTAAAATATTTGTTTAGG + Intergenic
1116030240 14:39562436-39562458 TAACCTTAAGGTAATTGTTATGG + Intergenic
1118806717 14:69244094-69244116 CAATATTCAGGGATTTGTTACGG + Intergenic
1119917185 14:78413096-78413118 CTTCTTTAAGTGATTTGTTGAGG + Intronic
1121835988 14:97092874-97092896 CAAATTCGAGGGATTTGTTTTGG - Intergenic
1124704413 15:31950916-31950938 ACATTTTAAGGGATTTTTTATGG + Intergenic
1125436859 15:39655266-39655288 AAACTTACAGGGATTTCTTAAGG + Intronic
1125838230 15:42772948-42772970 CAACCTGAAGTGATTTGTAATGG - Intronic
1126116369 15:45211342-45211364 CACATTTTAGGGTTTTGTTATGG - Intergenic
1127228183 15:56957804-56957826 GAACTTTTAGAGATTTGTTCTGG + Intronic
1128261729 15:66237352-66237374 CAATTTTAAGGGTATTGTTTTGG - Intronic
1128616200 15:69111935-69111957 CCAGTTTATGGTATTTGTTATGG + Intergenic
1131041838 15:89275683-89275705 CAACTTTAAGAGATTGGGTTGGG - Intronic
1131209431 15:90480991-90481013 CAATTTGAGGTGATTTGTTATGG - Intronic
1135162535 16:20109852-20109874 CAACTTGCAGGGATTTCTGAGGG + Intergenic
1135584864 16:23662069-23662091 AAAAGTTAAGGGATTTGATAGGG + Intronic
1139120823 16:64014378-64014400 AGACTTTAAGGGACTTTTTAAGG + Intergenic
1141476470 16:84277105-84277127 CAATCTTAAGGAATTGGTTATGG - Intergenic
1148487188 17:47998047-47998069 CAAGTTTGAGGGGTTTGTTTGGG + Intergenic
1149449064 17:56735395-56735417 CAACTTTGAGGGCTTTCTTTGGG - Intergenic
1149708662 17:58718855-58718877 AAACATTGAGGTATTTGTTAAGG + Intronic
1150938375 17:69662059-69662081 AAAGTTTAAGGGATTAGATATGG + Intergenic
1150986303 17:70201119-70201141 TTACTTTAAAGGTTTTGTTAAGG - Intergenic
1151006634 17:70445191-70445213 CAACTTGAAGGGAATTCTAATGG + Intergenic
1154966363 18:21361066-21361088 CCACTTTTTTGGATTTGTTAAGG + Intronic
1155751140 18:29423330-29423352 CAAGTTTGAGGGAATTGTTCAGG - Intergenic
1156692067 18:39720155-39720177 AAACTTTAAGGGTTTTTTTGTGG - Intergenic
1159309875 18:66692780-66692802 CAAGTTTAAGGGATCCGCTAGGG + Intergenic
1164255958 19:23528477-23528499 CCACTCTAAGGCATTTGTGATGG + Intronic
928162902 2:28945346-28945368 CAGCTTTAAAGGATATTTTACGG - Intronic
932119713 2:69087505-69087527 AAAAGTTAAGGGATTTGTAAAGG + Intronic
932385352 2:71327371-71327393 CAACTTGTGGTGATTTGTTACGG + Intronic
935420204 2:102859736-102859758 AAATTTTAAGGCATTTGTTATGG + Intergenic
937938888 2:127269728-127269750 CACATTTAAGGGAGTTTTTAAGG + Intronic
938150108 2:128875142-128875164 CAACATTAAAGGATTTTTCATGG - Intergenic
939656177 2:144828381-144828403 GGACTTTAAGAGATTTCTTAAGG - Intergenic
939723304 2:145681912-145681934 CAACTTTAAGTGTTTCGATATGG - Intergenic
941843613 2:170112599-170112621 CAAGTTCAAGGGAATTGTTCAGG + Intergenic
943159952 2:184234714-184234736 CAACTTTAAGGTATCAGTGATGG - Intergenic
943270183 2:185791105-185791127 TATCTGTAAGGGATTTGGTATGG - Exonic
944324976 2:198393534-198393556 CAACTTTTAGGGTTATTTTAAGG + Intronic
944353290 2:198755537-198755559 ATACTTTAAGGGATGTGTTTCGG - Intergenic
944706113 2:202290273-202290295 AAACTTAAAGGGATTTATTGTGG - Intronic
945519400 2:210805003-210805025 AAATTTTAAGGTATTTGTTTGGG + Intergenic
946693736 2:222331656-222331678 CAACTTTAAATGTTTTGTTGTGG - Intergenic
948324248 2:237099875-237099897 CAACTTGAAGGGATTTCTACAGG + Exonic
948405371 2:237713340-237713362 CTTTTTTAATGGATTTGTTAGGG + Intronic
949008438 2:241664554-241664576 CAGCCTTAAGGGAGTTGTTTGGG - Intronic
1172375516 20:34436182-34436204 CAAGTTTTAGGGATATGTGAGGG - Intronic
1174024564 20:47562595-47562617 TAGCTTTAAGGAATTAGTTAGGG + Intronic
1175393206 20:58640322-58640344 TTATTTTATGGGATTTGTTATGG + Intergenic
1176514002 21:7769538-7769560 CTACTTTGAGGGCTTTGTCAAGG - Intronic
1177007192 21:15688294-15688316 CAATTTTTAGATATTTGTTATGG - Intergenic
1177225923 21:18255996-18256018 CAATTTTAATAGATTTGTTTCGG + Intronic
1177916728 21:27097974-27097996 TAACTTTCAGGGAAATGTTAGGG + Intergenic
1178648115 21:34400062-34400084 CTACTTTGAGGGCTTTGTCAAGG - Intronic
1179034174 21:37745636-37745658 CAATTTTCAGTAATTTGTTACGG + Intronic
1182000415 22:26915189-26915211 CAATCTTCTGGGATTTGTTAGGG + Intergenic
1182167047 22:28186394-28186416 CAGCTTTGAGGGATTTTTCAGGG - Intronic
952269858 3:31820004-31820026 CTACATTAAGAGATTTATTAGGG - Intronic
952611304 3:35213842-35213864 CTACTTTGTGGTATTTGTTACGG + Intergenic
956526160 3:70164440-70164462 TAACTTCAAGGGATTTATTGAGG + Intergenic
957326597 3:78703645-78703667 TACCCTTAAGGGATTTGTTGTGG - Intronic
958885582 3:99722944-99722966 CAATTTTAAGGGATCTGTAGTGG + Intronic
963367297 3:144352582-144352604 CAAATTGAAGGGAGTTCTTATGG - Intergenic
965124988 3:164615378-164615400 CAAATTTAAGAGATTTATCAAGG + Intergenic
965474237 3:169134465-169134487 CAATTTTAAGTGAGTTTTTATGG + Intronic
965999916 3:174936152-174936174 CAATTTTAGAGTATTTGTTAGGG + Intronic
966627245 3:182031444-182031466 CAACTTTCAGTGATTTAGTAGGG - Intergenic
966671584 3:182532271-182532293 AAACTCTAAGGTATGTGTTATGG + Intergenic
968536642 4:1134980-1135002 CAAGTGCAAGTGATTTGTTAAGG - Intergenic
969275414 4:6131902-6131924 CAAATTTAAAGAATTTGCTATGG + Intronic
970121831 4:12762814-12762836 GAAATTATAGGGATTTGTTAAGG + Intergenic
970130684 4:12866922-12866944 TAATTTTAAATGATTTGTTAGGG + Intergenic
970329915 4:14970183-14970205 CCACTTTGAGGGATTTATTCAGG - Intergenic
970695489 4:18672097-18672119 GAAGTTGAAGAGATTTGTTATGG + Intergenic
971999780 4:34016141-34016163 GAACTTTAAGGCATCTTTTAAGG + Intergenic
973085398 4:46053502-46053524 CATTTTTAAAGGCTTTGTTATGG + Intronic
975865995 4:78724117-78724139 CCAGTTTATGGTATTTGTTATGG + Intergenic
976120856 4:81779902-81779924 CAACTTGAAGGAATTTGTCCTGG + Intronic
976551502 4:86401690-86401712 AAACTTTAAGAGATTTCTTTAGG - Intronic
977214854 4:94269533-94269555 CTACTTTATGGGATTTTTAAAGG + Intronic
977459730 4:97310155-97310177 CTACTGTCAGGGATTTGTCAGGG - Intronic
977587805 4:98794093-98794115 CACATTTTAGGGTTTTGTTATGG - Intergenic
979872832 4:125847439-125847461 CATATTTAAGAGATTTGCTATGG - Intergenic
982057513 4:151567484-151567506 GAATTTTAATGGATTTGCTATGG + Intronic
982802876 4:159726056-159726078 CAACTTTAAGAGATTTGAGAAGG + Intergenic
984055691 4:174927067-174927089 CCACTCTAAGAGATTTGTTGTGG - Intronic
984062067 4:175002292-175002314 CAACTTTATGGGTTTTGTGGTGG + Intergenic
984403184 4:179293265-179293287 AAACTTTGAGGGATGTGTTAAGG - Intergenic
984415409 4:179451703-179451725 CAAATTTAATGGATATGTTTGGG + Intergenic
987420317 5:17712620-17712642 CAGCCTAAAGGGATTTATTATGG + Intergenic
987956163 5:24743470-24743492 CAACTTGTAGGGATTTTTTAAGG - Intergenic
987960036 5:24794802-24794824 CTACTTTAAGGGTGTTGATAAGG + Intergenic
993848170 5:92971905-92971927 CAACTTTCATGGATTTCTGAGGG - Intergenic
994249753 5:97522008-97522030 CAACTTTAAGGCAAATATTAGGG - Intergenic
995210201 5:109529362-109529384 TTACTTCAGGGGATTTGTTATGG - Intergenic
995794480 5:115927052-115927074 CAAAGTAAAGGGACTTGTTAAGG - Intergenic
997847333 5:137299349-137299371 AAACTTTATTGGATTTGTAAGGG - Intronic
1000944377 5:167402343-167402365 CCAGTTTAAGGGATTTGTCAGGG - Intronic
1002761876 6:208821-208843 CCACTTTTAGGGAATTTTTAGGG - Intergenic
1003037560 6:2658021-2658043 CACCTTTTAGGTTTTTGTTATGG - Intergenic
1003486770 6:6586883-6586905 CCAGTCTAAGGTATTTGTTATGG + Intergenic
1004354263 6:14917545-14917567 CTACTTTAAGGGATTTTTGGTGG - Intergenic
1007569075 6:42876142-42876164 CAACATAAAGGGATTTTGTAAGG + Intergenic
1008137206 6:47790546-47790568 CAACTTTCTGGGGTTTCTTAAGG + Intronic
1008258216 6:49331194-49331216 GAACTTTGAGGTATTTCTTATGG - Intergenic
1008287877 6:49676246-49676268 CAACTTGAAGTGATGAGTTAGGG - Intergenic
1009730773 6:67602832-67602854 CTACTTTAATGGTTTTGTTTTGG + Intergenic
1010104659 6:72152465-72152487 CATCTTTAAGGCATTTTTTATGG + Intronic
1011898484 6:92262073-92262095 CAAGTTTTAAAGATTTGTTACGG + Intergenic
1012453285 6:99376359-99376381 TAACTTTAAGGGTTTGATTATGG - Intronic
1012587771 6:100945143-100945165 CAAGTTCAAGGGAATTGTTCAGG + Intergenic
1013469984 6:110455404-110455426 AAAATTAAAGGGCTTTGTTATGG - Intronic
1013685457 6:112576018-112576040 GTACTATAATGGATTTGTTAGGG + Intergenic
1014335862 6:120135543-120135565 TAACTTTAAAGTATTTGTAAGGG + Intergenic
1015548443 6:134386491-134386513 CAGCTTCCAGGGATTTGCTAGGG + Intergenic
1015973253 6:138763630-138763652 CAACTGTAATGGAGTTGTTTTGG - Intronic
1019722202 7:2579631-2579653 CTACTTACAGGCATTTGTTAAGG - Intronic
1020047371 7:5051082-5051104 CAACTTAAAGGGATTTTGTCTGG - Intronic
1021005468 7:15389583-15389605 CAACTGAAGGGAATTTGTTATGG + Intronic
1021341597 7:19470089-19470111 TCACTTTAAGAGATTTCTTATGG + Intergenic
1023525577 7:41099029-41099051 CAACTTAAGGGGATCTGTTGGGG - Intergenic
1024618992 7:51141285-51141307 CAAGGTTAAGGGATATGTTTTGG + Intronic
1024756204 7:52535747-52535769 TAACTTTAATTGATTTATTATGG + Intergenic
1030312360 7:108081513-108081535 CAACTGCAAGTGATTTATTAAGG - Intronic
1030613738 7:111716564-111716586 CTGCTTTAAGGGATGTGTTTGGG - Intergenic
1031156141 7:118114687-118114709 CAAGTTCAAGGGAATTGTTCAGG + Intergenic
1031638045 7:124125988-124126010 TAACTTGAAGTTATTTGTTAAGG + Intergenic
1036107542 8:5856962-5856984 CAAGATCAAGGGAATTGTTAAGG - Intergenic
1036549010 8:9800437-9800459 CAAGTTCAAGGGAATTGTTCAGG + Intergenic
1036598484 8:10237499-10237521 AAATTTTAAAGGATATGTTATGG + Intronic
1037114707 8:15210454-15210476 TGACTTTAAGGAAGTTGTTATGG - Intronic
1037239151 8:16758004-16758026 CTACTTTAGGGGCTTTTTTAAGG + Intergenic
1037258640 8:16982499-16982521 CACCTTTGTGGGACTTGTTAAGG - Intergenic
1042069848 8:64919890-64919912 CAACTTTAGGGTAGTGGTTAGGG - Intergenic
1044357569 8:91241890-91241912 CAACTTTAAGAGATTTAATGAGG + Intronic
1045566982 8:103328845-103328867 CAAATATAAGTGATGTGTTATGG + Intronic
1045696102 8:104810495-104810517 CAAGTGCAAGTGATTTGTTAAGG + Intronic
1047330432 8:123882062-123882084 CTAATTTAAGGGATTCTTTAGGG + Intronic
1048836995 8:138529306-138529328 CCACTTTTAGGCATTTGTTGTGG + Intergenic
1050291244 9:4157255-4157277 CAACATTAACAGTTTTGTTAGGG + Intronic
1050611598 9:7359663-7359685 CAACTTCCAGGGTTTTGTGAGGG - Intergenic
1054742772 9:68825533-68825555 GAAATTTAAGGTATTTGTAAAGG - Intronic
1055138852 9:72852113-72852135 CAACATTAAGGGAATTTTAAGGG + Intergenic
1056065530 9:82929755-82929777 GGACTTTAAGTGATTTGTAACGG - Intergenic
1058047127 9:100368622-100368644 CAAGTTTGAGGGAATTGTTCAGG - Intergenic
1186174669 X:6913134-6913156 CCACTTTAAGGAATTTTTCATGG - Intergenic
1187537145 X:20152220-20152242 CAACTTTAACAGATTTGATATGG - Exonic
1189103471 X:38214202-38214224 CAAGTTGAAGGGATTTGTCTGGG - Intronic
1189444348 X:41066918-41066940 CCACTCTAAGGGCTTGGTTAGGG - Intergenic
1194639373 X:96384381-96384403 CAACTATAAATGATTGGTTAAGG + Intergenic
1195376377 X:104231801-104231823 CAACTTTAAGAGTTTTATTATGG + Intergenic
1195524302 X:105868746-105868768 CAACTGTAAGGGATATATTGAGG + Intronic
1196079237 X:111613670-111613692 CAACTCTAAGGAACTTGTTCAGG + Intergenic
1197685964 X:129440041-129440063 CACCATTAAGGGATGAGTTATGG - Intergenic
1199075882 X:143525249-143525271 CAACTTTAAATAATTTGTTTAGG + Intergenic
1199504965 X:148551580-148551602 CAACTTTAAAAGTTTTGTTCTGG + Intronic
1199638711 X:149838534-149838556 CAACTTTGAGGGATGTGCTGAGG + Intergenic
1200849383 Y:7867023-7867045 CAAATTTGAGGGAATTGTTCAGG - Intergenic