ID: 912896113

View in Genome Browser
Species Human (GRCh38)
Location 1:113591707-113591729
Sequence AACTTTAAGGGATTTGTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 329}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912896109_912896113 4 Left 912896109 1:113591680-113591702 CCAGGTGGTATATTCTTCTTTAT 0: 1
1: 0
2: 2
3: 14
4: 228
Right 912896113 1:113591707-113591729 AACTTTAAGGGATTTGTTAAGGG 0: 1
1: 0
2: 0
3: 19
4: 329
912896106_912896113 29 Left 912896106 1:113591655-113591677 CCACAATTATACAAAGCAGGTAC No data
Right 912896113 1:113591707-113591729 AACTTTAAGGGATTTGTTAAGGG 0: 1
1: 0
2: 0
3: 19
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912896113 Original CRISPR AACTTTAAGGGATTTGTTAA GGG Intronic
902043232 1:13507282-13507304 AACTCTAAGGGACAAGTTAAAGG + Intronic
902186839 1:14731790-14731812 AACATTAAGGCACTTGTTTAAGG - Intronic
906478954 1:46187986-46188008 ACATTTAAGGGATCTGTGAAGGG - Intergenic
907831229 1:58066019-58066041 ATCTTGAAGGGATTTCTTGATGG + Intronic
907849320 1:58239109-58239131 AGCTGAAAGGGATTTATTAAGGG - Intronic
908106887 1:60854348-60854370 CACTTTAAGAAATTTGCTAAAGG + Intergenic
908708974 1:66993726-66993748 AACTTTAAAGGATTGTTTAGAGG + Intergenic
909202031 1:72701968-72701990 AGTTTAAAGGGATTTGTTAGTGG - Intergenic
909315926 1:74218848-74218870 AAATTTAATGGAATTATTAAAGG + Intronic
910477841 1:87625756-87625778 AACTTTCAAGGATTTTTTTAAGG - Intergenic
911190528 1:94944051-94944073 CATTTTTAGGTATTTGTTAAAGG - Intergenic
911804600 1:102189876-102189898 AAATTTAAGTGACTTATTAAAGG + Intergenic
912203387 1:107483691-107483713 CACTTTAAGGGATTTATCAAAGG - Intergenic
912896113 1:113591707-113591729 AACTTTAAGGGATTTGTTAAGGG + Intronic
912968321 1:114256893-114256915 AACAGAAAGGGATTTGTTACAGG - Intergenic
912995206 1:114526313-114526335 ACGTTTCAGGGATTTATTAACGG + Intergenic
916417617 1:164607350-164607372 AAATTTAAGCAATTTGCTAATGG + Intronic
916571076 1:166028293-166028315 AACTTCTAGGGATTTCTTAAGGG + Intergenic
916661826 1:166929198-166929220 ATCTTTAAGAGATTATTTAAAGG - Intronic
916695262 1:167229199-167229221 AACTTTAAGGGCTCTGATCATGG - Intronic
917422149 1:174874916-174874938 AACTTTAAGGAACATTTTAAGGG + Intronic
921419408 1:214929057-214929079 AAATTCAAGGGATTTTTCAAGGG + Intergenic
922132338 1:222792175-222792197 AAGATTAAGTGATTTGTTCAAGG + Intergenic
922987376 1:229876358-229876380 AGCTTTAAGGCAACTGTTAAAGG + Intergenic
923096355 1:230778212-230778234 AATTTTATAGGATTTGCTAATGG - Intronic
923374850 1:233351394-233351416 AGCTTTAAGGGCCTTGTTAGTGG + Intronic
1064644394 10:17446061-17446083 AACATTCAGAGATTTGTTTAAGG + Intronic
1064749476 10:18511930-18511952 AAATTTAAGGGACTTGTTCTTGG - Intronic
1065513389 10:26502092-26502114 AGCTTTATGGGCTTTCTTAAAGG + Intronic
1065652941 10:27912883-27912905 AACCTTAAGGATTTTTTTAAAGG - Intronic
1066763439 10:38780571-38780593 AATAGTAAGAGATTTGTTAATGG + Intergenic
1066958375 10:42195070-42195092 AATAGTAAGAGATTTGTTAATGG - Intergenic
1067472538 10:46547362-46547384 AACTTTAAGGGAACTGTGGAAGG - Intergenic
1067674577 10:48360884-48360906 AATTTTAAGGGATTGGTAATGGG + Intronic
1068309853 10:55263298-55263320 AATGTTAAGGGATTTGCTACAGG + Intronic
1071122656 10:82297579-82297601 AACTTTAGGGGCTTTCTTATGGG - Intronic
1075432991 10:122405598-122405620 AAACCTAAGGGATTTGTTATGGG + Intronic
1075639203 10:124052488-124052510 AACCTTAAGTGATTTGTCCAAGG - Intronic
1075745158 10:124722053-124722075 AACAGGAAGAGATTTGTTAAAGG + Intronic
1077969060 11:7168614-7168636 AGCTTGAAGGAATTTGTTTAGGG - Intergenic
1079066098 11:17294501-17294523 AAGTTTTAGTGGTTTGTTAATGG + Intronic
1082234448 11:49806285-49806307 AACTTCCAGGGATTTTTTAAGGG - Intergenic
1085158921 11:74323110-74323132 AAATTTTAGGGTATTGTTAATGG - Intergenic
1086139273 11:83476487-83476509 GACTTTAAGTAATTTGTTTAAGG + Intronic
1086978485 11:93165733-93165755 AACATTAAGTTCTTTGTTAATGG + Intronic
1087289737 11:96307403-96307425 TACTTTAAGGGATATATTTAAGG - Intronic
1088219297 11:107550722-107550744 TAATTTAAGGGTTTTATTAACGG - Intronic
1088432730 11:109776513-109776535 ATCTTTCAGGGACTGGTTAATGG + Intergenic
1088654184 11:111983529-111983551 TCCATTAAGGTATTTGTTAATGG - Intronic
1089235941 11:117025371-117025393 GACTTTAAGAGATTTGCTCAAGG - Intronic
1091812368 12:3410020-3410042 AACTTGAAGGTATATGTTACAGG - Intronic
1092519607 12:9254905-9254927 AACTTTAAGGCATATTTCAAAGG + Intergenic
1093187424 12:16036999-16037021 AACTTTAAGTAAAATGTTAATGG + Exonic
1093368365 12:18333019-18333041 AAATTTAACAGATTTTTTAAAGG - Intronic
1093948047 12:25133329-25133351 AATTTAATGGGATTTGTTAGGGG - Intronic
1096784929 12:54011404-54011426 AACTTCAAGGGAGTTGCTAAGGG - Exonic
1096988460 12:55778466-55778488 AACTTTGAGGGAGTGGTAAAAGG - Intronic
1098191884 12:67957914-67957936 AACTGTAAGTGCTTGGTTAAGGG - Intergenic
1098422996 12:70324021-70324043 GAGTTTAAGGAATTTGTTCAAGG + Intronic
1098865967 12:75763919-75763941 AAATTTAATGGATTTGTATATGG - Intergenic
1099222505 12:79932244-79932266 AAGTTCAAGAGATTTCTTAAAGG + Intronic
1099543753 12:83950189-83950211 AACTATAAGGGAATTGAGAATGG + Intergenic
1099636414 12:85219334-85219356 AACTATAGTCGATTTGTTAAAGG + Intronic
1102331540 12:112036329-112036351 AACTTTAATGAGTTTGTTATTGG + Intronic
1102593892 12:113977914-113977936 AACTTTGATGGCTTGGTTAAGGG + Intergenic
1102622380 12:114206452-114206474 AACTTTAAGAGAGTTGTGATTGG - Intergenic
1102633672 12:114303662-114303684 ACCTTAAAGGGATTTGGTAGGGG + Intergenic
1104515297 12:129419552-129419574 AACTTTAATGAATATTTTAAAGG - Intronic
1106545619 13:30728430-30728452 ATTTTTAAGGGATTTATTATAGG - Intronic
1107366193 13:39679528-39679550 AATTTTAAAGGATTTTTTCAAGG + Exonic
1107782439 13:43918500-43918522 AACTTTTAGGGAAGTATTAAGGG + Intergenic
1108536816 13:51390660-51390682 CACTTAACGTGATTTGTTAAAGG + Intronic
1108769567 13:53682221-53682243 AAATTTAAGGGTTTTCTCAATGG + Intergenic
1108873665 13:55018459-55018481 AACTTTTAGGGATAGGCTAAGGG + Intergenic
1108966375 13:56308223-56308245 AGCTTTAATGGAGTTGTAAATGG - Intergenic
1109019368 13:57066730-57066752 AAACTTAAGTGACTTGTTAAGGG - Intergenic
1109835307 13:67849431-67849453 AACTATGAAGGATTTGATAAAGG - Intergenic
1110021997 13:70486469-70486491 AACTGTAATGGATTTGGAAAAGG + Intergenic
1110242585 13:73285582-73285604 AACTTTAAAGCACTTTTTAATGG - Intergenic
1111486882 13:88914097-88914119 AACTATAAAAGATTTGTGAAAGG + Intergenic
1112959621 13:105107505-105107527 AACTGTAGGGTTTTTGTTAATGG - Intergenic
1113012652 13:105788047-105788069 AAAATTCAGGGCTTTGTTAAAGG - Intergenic
1113985198 13:114309177-114309199 AAGTTTAAGCAATTTGCTAATGG - Intergenic
1115039194 14:28900480-28900502 AAATTTAAAGTATTTGTAAATGG - Intergenic
1116030241 14:39562437-39562459 AACCTTAAGGTAATTGTTATGGG + Intergenic
1116244787 14:42395690-42395712 AACTTCAAATGTTTTGTTAATGG + Intergenic
1117012845 14:51488435-51488457 CAGTTTAAGGGATTTATTCAAGG + Intergenic
1117665931 14:58055873-58055895 ATCTCTAAGGGATTTGTTTTAGG + Intronic
1117897603 14:60504253-60504275 GAATTTAAGGTATTTGTTGAAGG + Intronic
1118987151 14:70766266-70766288 AAGTTTAAGAGATTTGTCCAGGG - Intronic
1119046676 14:71324297-71324319 AAGTTGAAGTGATTTGTTGAAGG + Intronic
1119917186 14:78413097-78413119 TTCTTTAAGTGATTTGTTGAGGG + Intronic
1120484685 14:85098165-85098187 ATTTTTGAGGGATTTTTTAAAGG - Intergenic
1121552082 14:94810459-94810481 AACTTAATGGGATTCTTTAAGGG + Intergenic
1122036681 14:98954116-98954138 AACTTTAACGGATTTGCCCAAGG + Intergenic
1124055411 15:26237270-26237292 AACTGCCAGGGCTTTGTTAAAGG - Intergenic
1124838127 15:33215529-33215551 ACCTTTAAGGGCTGTGTGAATGG - Intergenic
1125436860 15:39655267-39655289 AACTTACAGGGATTTCTTAAGGG + Intronic
1126500849 15:49342681-49342703 ATCTTTAAGGGAGTTCTAAAAGG - Intronic
1127532398 15:59857164-59857186 AACTTTACAAGATATGTTAAAGG + Intergenic
1128734010 15:70041771-70041793 AACTTTAAGGGAGTCATGAATGG + Intergenic
1135577994 16:23600808-23600830 AAATTTAAGGGATATGTTCCAGG - Intergenic
1138455542 16:57118742-57118764 AACCTTAAATGATTTTTTAAAGG + Intronic
1139002611 16:62531424-62531446 ATCTTTAAAGAATTTGCTAAAGG - Intergenic
1139120824 16:64014379-64014401 GACTTTAAGGGACTTTTTAAGGG + Intergenic
1139171508 16:64635593-64635615 TACTTGAATGCATTTGTTAATGG - Intergenic
1139785402 16:69388185-69388207 ACAGTTAAGGGATTTGTTCAAGG - Intronic
1139786836 16:69399895-69399917 AACATAAAAGGATTTATTAAGGG - Intronic
1141911255 16:87059891-87059913 AAAACTAAGGCATTTGTTAAAGG + Intergenic
1144233747 17:13235763-13235785 GAGTTTAAGTAATTTGTTAAAGG + Intergenic
1144398080 17:14865327-14865349 AATTTTAAATGATTTGTTCAAGG - Intergenic
1144468511 17:15516290-15516312 AAATCTAAGGGACTTGGTAACGG + Intronic
1146011193 17:29196173-29196195 AACTTTAAGTGATTAATTCAAGG + Intergenic
1148962948 17:51408691-51408713 AACTTTCAGAGTTTTGTTTAGGG - Intergenic
1151132289 17:71909485-71909507 GACTTTATGGGATTTGCTCAAGG - Intergenic
1151198405 17:72448616-72448638 AACTTTAAAGGGCATGTTAAAGG + Intergenic
1151301222 17:73228239-73228261 AACTTCAAGGGTTTTGTAATAGG - Intronic
1153969472 18:10212387-10212409 ACCTTGATGGGTTTTGTTAAAGG + Intergenic
1154035468 18:10797649-10797671 AATTTTAAGGGCTTTATGAATGG - Intronic
1155136297 18:22996626-22996648 AACTTTATGGTATTTTTTAAAGG + Intronic
1155280496 18:24234638-24234660 AGCTTAAAGGGATATGATAAAGG + Intronic
1156416927 18:36904911-36904933 AAGGTTAATTGATTTGTTAAAGG - Intronic
1156619825 18:38836398-38836420 AACTATAATGGATGGGTTAAGGG + Intergenic
1156692066 18:39720154-39720176 AACTTTAAGGGTTTTTTTGTGGG - Intergenic
1157633122 18:49120439-49120461 ACCTTTAAGGGATTGGTTCCAGG + Intronic
1157761679 18:50269902-50269924 TATTTTAAGGGATTTATTATAGG - Intronic
1159304340 18:66620207-66620229 AAATTTGAGGGATTTTTTAATGG + Intergenic
925469667 2:4145607-4145629 AAATATAAGGGTTTTGTTATTGG + Intergenic
926417791 2:12667189-12667211 GACATTAAGTGATTTGTTCAAGG + Intergenic
926976510 2:18521444-18521466 AACTTTCAGGGACTTGCCAAAGG - Intergenic
928017926 2:27676323-27676345 CACTTCAAGGAATTTGTTACAGG + Intronic
930296562 2:49561780-49561802 AACTTTCAGTGTTTTGTTTATGG + Intergenic
930535895 2:52645864-52645886 AAGTTTAAGTAATTTGTTCAAGG + Intergenic
931776384 2:65544636-65544658 AACCTTACGGGATTTGGGAATGG - Intergenic
931832950 2:66071615-66071637 AACTTTAAAGTATTTTTGAACGG + Intergenic
931962094 2:67493493-67493515 AAGTTTAAGTGAGTTGTTCAAGG - Intergenic
932097394 2:68863786-68863808 AACCTTAAGAGATTTGTAAAAGG + Intergenic
932535027 2:72583683-72583705 AACTTTAAGGGTCTTTTTTAAGG - Intronic
932918327 2:75880794-75880816 CACTTTAAAAGATTTCTTAAAGG + Intergenic
933819540 2:86097757-86097779 AACAGGAAGAGATTTGTTAAAGG + Intronic
934306496 2:91827485-91827507 AATAGTAAGAGATTTGTTAATGG - Intergenic
934326760 2:92025257-92025279 AATAGTAAGAGATTTGTTAATGG + Intergenic
934465132 2:94255805-94255827 AATAGTAAGAGATTTGTTAATGG + Intergenic
938227430 2:129627929-129627951 AACATGAAGGGACTTTTTAATGG + Intergenic
938523872 2:132104534-132104556 AAGGCTAAAGGATTTGTTAAAGG - Intergenic
938937902 2:136144027-136144049 AAGATAAAGGGATTTTTTAAAGG - Intergenic
939993802 2:148901477-148901499 AAGTATAAAGGATTTTTTAAAGG - Intronic
940026083 2:149210000-149210022 AACTTAAAGCAAATTGTTAAAGG - Intronic
942437498 2:175996459-175996481 ATCATTAAGTGATTTGCTAAAGG - Intronic
943338378 2:186646361-186646383 AAGTTTAAGTGATTGGTTTAAGG + Intronic
943437301 2:187882020-187882042 GACTTTAAAGCATTTTTTAATGG + Intergenic
943640288 2:190350146-190350168 AATTTTAAGGTATTTCTAAATGG + Intronic
943709220 2:191071798-191071820 AGCTACAAGGGATTTGTTGAAGG + Intronic
943787522 2:191895149-191895171 AACTGTAAGAGATTTATTGAAGG + Intergenic
943824462 2:192371526-192371548 AAATTAAAGGGATTTGTTATTGG + Intergenic
944353289 2:198755536-198755558 TACTTTAAGGGATGTGTTTCGGG - Intergenic
944612583 2:201426608-201426630 AACTTTGGAGGTTTTGTTAATGG + Intronic
945032026 2:205674554-205674576 AACTTTAGGGTACTTTTTAAAGG + Intergenic
945212571 2:207398669-207398691 AAATTTGAGGAATTTTTTAAGGG + Intergenic
945519401 2:210805004-210805026 AATTTTAAGGTATTTGTTTGGGG + Intergenic
945812699 2:214568104-214568126 GAAATTAAGGGACTTGTTAAAGG - Intronic
946388802 2:219402950-219402972 CCCTTTAAGGTCTTTGTTAAAGG + Intergenic
947728128 2:232412994-232413016 AACTTTAAGATACTTGGTAAGGG - Intergenic
1168756326 20:320957-320979 AACATTAAAGAATTTGTGAAGGG + Intergenic
1169239737 20:3966381-3966403 AACTTTAAGGAATTCCTGAAAGG + Intronic
1172450165 20:35016494-35016516 AATCTTAAGGAATTTGTTTAAGG - Intronic
1173269650 20:41521101-41521123 AACTTTAACAGATTTCCTAAAGG - Intronic
1174879438 20:54262794-54262816 ATATTTAAGGGATATTTTAAAGG + Intergenic
1175575269 20:60056203-60056225 ACCTTTAAGGGAATTGGAAATGG + Intronic
1175998750 20:62822638-62822660 CACTTGAAGCCATTTGTTAAGGG + Intronic
1176514001 21:7769537-7769559 TACTTTGAGGGCTTTGTCAAGGG - Intronic
1176596164 21:8699025-8699047 AATAGTAAGAGATTTGTTAATGG + Intergenic
1176957556 21:15123775-15123797 AACTTTAAGGTCTTTGTTTCTGG - Intergenic
1177380719 21:20340137-20340159 AATTTTGAGGCATTTGTTGAGGG + Intergenic
1177916729 21:27097975-27097997 AACTTTCAGGGAAATGTTAGGGG + Intergenic
1178213331 21:30562936-30562958 AAGTTGAAGGGAATTATTAATGG + Intergenic
1178648114 21:34400061-34400083 TACTTTGAGGGCTTTGTCAAGGG - Intronic
1180279075 22:10676473-10676495 AATAGTAAGAGATTTGTTAATGG + Intergenic
1180586286 22:16895004-16895026 AATAGTAAGAGATTTGTTAATGG + Intergenic
1182791117 22:32953925-32953947 ATTTTTAAGGAATTTCTTAATGG + Intronic
949696084 3:6697626-6697648 AAATCTAAGGAATTTGTTATAGG - Intergenic
950876387 3:16278601-16278623 AAGTTTAAAGGACTTGTTCAAGG + Intronic
951341515 3:21493601-21493623 ACCTAAAAGGGATTTGTTCATGG - Intronic
951388811 3:22076485-22076507 AACTTTAAGTGGTTTGGTTATGG - Intronic
952869987 3:37890287-37890309 AACTGTAAGGGAGTTGTACAAGG + Intronic
954470870 3:50693945-50693967 AACCTTAAAGTATTTGTTTAAGG - Intronic
954831400 3:53424497-53424519 AACATGAAGGGATTTCTTGAGGG + Intergenic
955219112 3:57009179-57009201 AAGTTTAAGCAATATGTTAAAGG - Intronic
955719845 3:61869091-61869113 AACTCTGAGGGATTTGCTATTGG + Intronic
955982626 3:64542325-64542347 AAATTTAAGGAATTTGTTCAAGG + Intronic
956017231 3:64896346-64896368 AACTTTAAGAGACTTGACAAAGG - Intergenic
956093701 3:65694303-65694325 AACATTAAGTGATTTGCTCAAGG - Intronic
957595239 3:82256251-82256273 AACTTAAATGGATTTCTTTATGG - Intergenic
958562793 3:95769452-95769474 AATTTAAAGAGATTTATTAAAGG + Intergenic
958712323 3:97732288-97732310 AACCTTAAGGGTTATGTGAAAGG - Intronic
959258093 3:104040366-104040388 GACGTTAAGTGATTTGTTCAAGG - Intergenic
959564232 3:107818029-107818051 GACTTTCAGGGAGTGGTTAATGG - Intergenic
959634482 3:108548162-108548184 AACTCTAAGTGGATTGTTAAAGG + Intergenic
960004188 3:112765201-112765223 AAATTGAAGGGATTTGTCTAAGG - Intronic
962303184 3:134261611-134261633 ACCATTAAGAGATTTTTTAAAGG - Intergenic
963509831 3:146233486-146233508 AGTTTTAAGGCATTTTTTAAAGG + Intronic
963825926 3:149953189-149953211 AACTTAAATGGATTTATTTATGG + Intronic
964440938 3:156708659-156708681 AAGGTTAAGTGATTTGTTCAAGG - Intergenic
965047182 3:163594096-163594118 AATTTTAAAGCATTTCTTAAAGG + Intergenic
965062224 3:163798991-163799013 AACCTTAAGGGTTTTTTTAGTGG + Intergenic
965148883 3:164944720-164944742 AAATATAATGCATTTGTTAAAGG - Intergenic
965763011 3:172100164-172100186 AAATTTAAGGAATTCATTAACGG - Intronic
965918862 3:173887544-173887566 AACTTTAAGTGATTTCCTAAAGG + Intronic
965969908 3:174542295-174542317 AAGTTTAAGGGAGTTGCAAAGGG + Intronic
967224752 3:187280638-187280660 ATATTTAAGGGATTTTTTAATGG + Intronic
968297423 3:197587632-197587654 TACTTTAAGGGTTTTGCTTAAGG + Intergenic
969505023 4:7580574-7580596 AAGTTTCAGGGATATATTAATGG + Intronic
970329914 4:14970182-14970204 CACTTTGAGGGATTTATTCAGGG - Intergenic
971077053 4:23161944-23161966 AACTTTAAGTGATCTGTTCGCGG + Intergenic
974431421 4:61801736-61801758 TTTGTTAAGGGATTTGTTAAGGG + Intronic
975859933 4:78665973-78665995 AATTTTAATGTTTTTGTTAATGG + Intergenic
976175244 4:82345643-82345665 AACTTTAAGTCATTTGGTATTGG - Intergenic
976307989 4:83580369-83580391 AACATTATAGTATTTGTTAATGG + Intronic
976543633 4:86307459-86307481 AACTTTAAGGGAAGTGCAAAGGG + Intronic
976551501 4:86401689-86401711 AACTTTAAGAGATTTCTTTAGGG - Intronic
977214855 4:94269534-94269556 TACTTTATGGGATTTTTAAAGGG + Intronic
977446049 4:97134130-97134152 AACTTAATGGGATTTTTAAATGG + Intergenic
977882720 4:102224180-102224202 ATCTTGAAGGGATTTTTAAATGG - Intergenic
979923566 4:126531021-126531043 AACTTTAATCAATTTGTTAGTGG + Intergenic
979938842 4:126733698-126733720 AAATTCAAGAGAGTTGTTAAAGG + Intergenic
980540629 4:134189219-134189241 AACTTTAGTGAATATGTTAAGGG - Intergenic
982802877 4:159726057-159726079 AACTTTAAGAGATTTGAGAAGGG + Intergenic
983350649 4:166583499-166583521 AAGTTTCAGGGTTTTGTTGAAGG + Intergenic
984310971 4:178057430-178057452 AAATTCAAGGGATTTGGTCATGG - Intergenic
987729937 5:21756917-21756939 AACTTTATGGGATATGATTAGGG + Intronic
987912478 5:24166414-24166436 AACAGTAAGGTATTTGCTAAAGG - Intronic
988024146 5:25662907-25662929 GTCTTTAAGGGTTTTGTCAAGGG + Intergenic
988377979 5:30462744-30462766 ATCTGTAAGGGATTTGTTCCAGG - Intergenic
988586969 5:32515543-32515565 AACTTGAAAGGATTTGCAAATGG + Intergenic
991099671 5:62778848-62778870 TAGTTTGAGGGATTTGCTAAGGG + Intergenic
991307767 5:65198530-65198552 AATTTAAAGGGCTTAGTTAAAGG - Intronic
992010641 5:72523386-72523408 AATTTTAAAGGATTATTTAAGGG + Intergenic
992075600 5:73190137-73190159 AAGTGTAAGGGATTCCTTAAAGG + Intergenic
992883328 5:81131850-81131872 ACCTTTCAGGGAATTTTTAATGG + Intronic
993223237 5:85131113-85131135 ATCTTCAAGGGATTTTTAAATGG - Intergenic
993315743 5:86403752-86403774 AACTTTAACTGATTGGATAAGGG + Intergenic
993770625 5:91920457-91920479 AACTTTAATGCATATGTTAGTGG - Intergenic
993865247 5:93186753-93186775 AAATAGAAGGGATTTTTTAAAGG + Intergenic
994000426 5:94772906-94772928 AAATTTAAGTGAATTGCTAAAGG - Intronic
994173878 5:96689340-96689362 AAGATTAAGGAAATTGTTAATGG - Intronic
994573798 5:101549705-101549727 AACCAAAAGGGATTTTTTAAAGG - Intergenic
995168508 5:109077378-109077400 TACCTTAAGGTATTTTTTAAAGG - Intronic
995693641 5:114855893-114855915 TACTGTAAGGGATATGTAAATGG + Intergenic
996488372 5:124063682-124063704 AATTTTAAGGAATTTGATTATGG + Intergenic
997847332 5:137299348-137299370 AACTTTATTGGATTTGTAAGGGG - Intronic
998665120 5:144288265-144288287 AAATTTAAGCAATTTGTTCAAGG - Intronic
998828044 5:146125634-146125656 AAATTTAAGTGATTTGTCCAAGG + Intronic
999086892 5:148900563-148900585 AATTTGGAGGGATTTGTTTATGG + Intergenic
999413040 5:151369104-151369126 AAACTTCAGGGATTTGTTTATGG - Intergenic
999417363 5:151410187-151410209 AACTTTATCTGATTTGTTCACGG + Intergenic
999417639 5:151413080-151413102 AACTTTATCTGATTTGTTCACGG + Intergenic
1000458320 5:161480826-161480848 AACTTTTATGCATTTCTTAATGG - Intronic
1000754115 5:165135160-165135182 AACTTTAATAGATTGGCTAATGG - Intergenic
1000944376 5:167402342-167402364 CAGTTTAAGGGATTTGTCAGGGG - Intronic
1003335700 6:5170020-5170042 AAGTGTCAGGGATTTGGTAATGG + Intronic
1003820732 6:9893886-9893908 TACTTTAAGGGAAATGATAATGG - Intronic
1005244874 6:23872291-23872313 AGCTTTAAGGCATTTGTGACAGG - Intergenic
1005326754 6:24709475-24709497 AAGTTTAAGGGATTTGCATACGG - Intronic
1007469693 6:42080803-42080825 AACTTTATGGGACTTCTTAGAGG + Exonic
1008258215 6:49331193-49331215 AACTTTGAGGTATTTCTTATGGG - Intergenic
1009411926 6:63375695-63375717 AACTTTAAGAAACTTTTTAAAGG + Intergenic
1009593364 6:65703149-65703171 CACTTTAAGGAATTGGTTCATGG - Intronic
1010150054 6:72720767-72720789 GAGATTAAGGGATTTGTTCAAGG + Intronic
1010290021 6:74124713-74124735 AAGTATAAGAAATTTGTTAAGGG - Intergenic
1010441017 6:75894082-75894104 ATTTCTAAGGGACTTGTTAATGG + Intronic
1011228400 6:85133132-85133154 AACTTTTAGGGATATTTTTATGG - Intergenic
1011674444 6:89718558-89718580 AACTGTAAGGGCACTGTTAAGGG - Exonic
1012618985 6:101316028-101316050 AACCTTTAGGGAATAGTTAATGG + Intergenic
1013469983 6:110455403-110455425 AAATTAAAGGGCTTTGTTATGGG - Intronic
1013821881 6:114164236-114164258 AACTGTAAGGTATTTTGTAAAGG - Intronic
1014432248 6:121384652-121384674 AATATTAAGGGATTTGTCATAGG - Intergenic
1015014133 6:128389622-128389644 GATTTTAAGGTATATGTTAAAGG + Intronic
1016163029 6:140905620-140905642 AACATTTCTGGATTTGTTAATGG + Intergenic
1016606827 6:145938724-145938746 ATGTTTAAGGAATTTGTTTATGG + Intronic
1017364606 6:153620268-153620290 AATTTCAAGTGATTTGTTATAGG + Intergenic
1018841750 6:167522446-167522468 GACTTTAAGGGCTTAGTTTATGG - Intergenic
1019099199 6:169614002-169614024 AACTTTAAGTGCCTTGTTGAGGG - Intronic
1019169243 6:170122161-170122183 TGCTTTAAAGGAATTGTTAAAGG - Intergenic
1020529055 7:9306682-9306704 AACTTAATGGGATTTTTTGAGGG - Intergenic
1020902764 7:14026287-14026309 AACTCTAAGAGATTGGGTAAGGG + Intergenic
1020971978 7:14954978-14955000 AACATTAAGAGATTTGGAAAAGG + Intronic
1023110877 7:36809353-36809375 CATCTTATGGGATTTGTTAAGGG + Intergenic
1023540571 7:41260908-41260930 ATCTTTAATGGATTTATTATTGG - Intergenic
1023783028 7:43675960-43675982 AATTTTTAGGGGTCTGTTAAGGG - Intronic
1024756205 7:52535748-52535770 AACTTTAATTGATTTATTATGGG + Intergenic
1028736807 7:94222942-94222964 AACTTTAAGCAATTTGATCAAGG + Intergenic
1029655585 7:101922444-101922466 AACTTTCATGGATATTTTAAAGG - Intronic
1030099936 7:105936960-105936982 AAATTGAAGGGAATTATTAATGG + Intronic
1030561845 7:111096980-111097002 AACTTTAGAAGATTTTTTAAAGG - Intronic
1030804219 7:113894387-113894409 AACTTTGAGTTTTTTGTTAATGG - Intronic
1030967774 7:116015296-116015318 AACATTGAGGGATTGATTAAAGG - Intronic
1031436949 7:121744032-121744054 AACTTCCAGGTCTTTGTTAAAGG - Intergenic
1031522518 7:122783843-122783865 AACTTTAAGCTATTTACTAAAGG + Intronic
1031638046 7:124125989-124126011 AACTTGAAGTTATTTGTTAAGGG + Intergenic
1031888876 7:127271011-127271033 AACTTTGAGGTAATTGATAAAGG + Intergenic
1033681671 7:143601336-143601358 TAATTTAAGGGATTTGGGAAAGG + Intergenic
1033703220 7:143860477-143860499 TAATTTAAGGGATTTGGGAAAGG - Intronic
1035425005 7:158764777-158764799 TACCTTAAGGGACTTGTCAAGGG - Exonic
1036570449 8:9975646-9975668 AACATTAAAGGATTTGTTCAAGG - Intergenic
1037127712 8:15370865-15370887 AACTGTAATAAATTTGTTAAAGG + Intergenic
1037258639 8:16982498-16982520 ACCTTTGTGGGACTTGTTAAGGG - Intergenic
1039305430 8:36256862-36256884 GATGTTAAGGGATTTGTTCAAGG - Intergenic
1040704906 8:50113803-50113825 AATTTTAAATGATTAGTTAATGG + Intronic
1041237838 8:55822419-55822441 ATTTTTAAGTTATTTGTTAAAGG + Intronic
1043461381 8:80463780-80463802 TACTGTAAGAGTTTTGTTAATGG - Intergenic
1046677235 8:117123283-117123305 AACATTAAGGTATTTGGTCAGGG - Intronic
1047661153 8:127038413-127038435 ATCCTTAAGGAGTTTGTTAAAGG + Intergenic
1049930820 9:454947-454969 AACTCTAATGACTTTGTTAAAGG - Intronic
1050655731 9:7826684-7826706 AACTTTGATGGTTTTTTTAAAGG - Intronic
1051699449 9:19805366-19805388 AACATTAAGGTATTGATTAATGG - Intergenic
1051787296 9:20759198-20759220 AACTTTAAAGTAGTTTTTAATGG - Intronic
1052732000 9:32297780-32297802 AACTTTGATTGATATGTTAAAGG + Intergenic
1052735639 9:32339456-32339478 CACATGACGGGATTTGTTAAGGG - Intergenic
1053109163 9:35442116-35442138 AACTTTAAGGGAATTCTAAGTGG + Intergenic
1053695206 9:40632599-40632621 AATGGTAAGAGATTTGTTAATGG + Intergenic
1053942192 9:43262985-43263007 AATAATAAGAGATTTGTTAATGG + Intergenic
1054306450 9:63431824-63431846 AATGGTAAGAGATTTGTTAATGG + Intergenic
1054405189 9:64755816-64755838 AATGGTAAGAGATTTGTTAATGG + Intergenic
1054438814 9:65241306-65241328 AATGGTAAGAGATTTGTTAATGG + Intergenic
1054491590 9:65780640-65780662 AATGGTAAGAGATTTGTTAATGG - Intergenic
1054742771 9:68825532-68825554 AAATTTAAGGTATTTGTAAAGGG - Intronic
1055096835 9:72422673-72422695 AAGATTAAGGGATTTGCTCATGG + Intergenic
1056065529 9:82929754-82929776 GACTTTAAGTGATTTGTAACGGG - Intergenic
1057776670 9:98016611-98016633 ATCTTAAAGGGATTTGAGAAAGG + Intergenic
1058042751 9:100322405-100322427 ACCTTGAAGGGAATTTTTAAAGG - Intronic
1058306172 9:103443127-103443149 GACTTTTAAGGATTTGTGAATGG + Intergenic
1058746397 9:107995470-107995492 AATTTTAAGTAATTTTTTAATGG + Intergenic
1060837935 9:126771590-126771612 AAGTTTAAGGTAATTGTTAAAGG + Intergenic
1061190221 9:129078574-129078596 AACTTTGAGGGCACTGTTAATGG - Intergenic
1202777648 9_KI270717v1_random:6217-6239 AATGGTAAGAGATTTGTTAATGG + Intergenic
1186074099 X:5857688-5857710 AACTGTGAAGGATTTGTTCAAGG + Intronic
1189571130 X:42298772-42298794 CAGTTTAAGGGATTTGTCCATGG - Intergenic
1190314199 X:49139258-49139280 GGCTTTAAGGAATTTGTTCAGGG - Intergenic
1191000483 X:55655558-55655580 GATTTTAAGGGACTTTTTAACGG - Intergenic
1191157023 X:57284854-57284876 GACATTAAGTGATTTGTTCAAGG + Intergenic
1191835916 X:65461746-65461768 AATGTTAAGTGATGTGTTAATGG + Intronic
1193194491 X:78615080-78615102 AATTTTACTGAATTTGTTAATGG + Intergenic
1194639374 X:96384382-96384404 AACTATAAATGATTGGTTAAGGG + Intergenic
1195376378 X:104231802-104231824 AACTTTAAGAGTTTTATTATGGG + Intergenic
1195524303 X:105868747-105868769 AACTGTAAGGGATATATTGAGGG + Intronic
1196079238 X:111613671-111613693 AACTCTAAGGAACTTGTTCAGGG + Intergenic
1198114073 X:133527999-133528021 AAGGTTAAGAGATTTGTTTAAGG - Intergenic
1199376717 X:147121259-147121281 AACTTTATGAGATTAGTGAAGGG + Intergenic
1201192988 Y:11464502-11464524 AATAGTAAGAGATTTGTTAATGG + Intergenic