ID: 912902049

View in Genome Browser
Species Human (GRCh38)
Location 1:113661724-113661746
Sequence CAGAGAAAAGAGAAGGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1171
Summary {0: 1, 1: 0, 2: 8, 3: 100, 4: 1062}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912902045_912902049 0 Left 912902045 1:113661701-113661723 CCTGTGTAACGTCAGTTTGTGTG 0: 1
1: 0
2: 1
3: 6
4: 74
Right 912902049 1:113661724-113661746 CAGAGAAAAGAGAAGGGTGGAGG 0: 1
1: 0
2: 8
3: 100
4: 1062

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912902049 Original CRISPR CAGAGAAAAGAGAAGGGTGG AGG Intronic
900528385 1:3140462-3140484 CAGAGACAGGCGAGGGGTGGGGG - Intronic
900864204 1:5255690-5255712 CATAGATAAGGGAGGGGTGGGGG + Intergenic
901208063 1:7508650-7508672 GAGGGAAGAGAGAAGGGAGGAGG + Intronic
901905945 1:12411313-12411335 CAGAGAAAAGAAAAATTTGGAGG + Intronic
902129100 1:14243208-14243230 CAAAGAAAAGAGAAAGATGCTGG - Intergenic
902201939 1:14840031-14840053 CAGAAAAAATAGCGGGGTGGGGG - Intronic
902801523 1:18832978-18833000 CAGAAAAAAAAAAAGAGTGGGGG - Intergenic
902977553 1:20099880-20099902 AAGACAAAAGAGAAGGATGAGGG - Intergenic
903327120 1:22575682-22575704 CAGCAAGAAGAGCAGGGTGGAGG + Intronic
903455649 1:23484692-23484714 GAGAGAGGAGGGAAGGGTGGCGG - Intergenic
904272050 1:29356545-29356567 CAGAGCTAAGAGAAGGAAGGAGG + Intergenic
904491317 1:30861308-30861330 GAGAGAATAGAGAAGGATGCAGG - Intergenic
905456351 1:38090706-38090728 CAGTGAACACAGAAGGGTGAAGG + Intergenic
905479318 1:38250272-38250294 CAGTGAAAATAAGAGGGTGGAGG + Intergenic
905488981 1:38328844-38328866 CAGAGAAGAGGGAAGGATGTGGG - Intergenic
905615169 1:39391975-39391997 GGGAGAAGGGAGAAGGGTGGTGG + Intronic
905697968 1:39989809-39989831 CTGGGAGAAGAGAAGGATGGGGG - Intergenic
906547140 1:46627815-46627837 CAAAAAAAAAAAAAGGGTGGGGG - Intergenic
906651387 1:47515489-47515511 AGGAGAAAAGGGAAGGATGGTGG + Intergenic
906952941 1:50349305-50349327 GAGAGAAAAGAGCAGGGGAGAGG - Intergenic
907241460 1:53083563-53083585 CAGAGAAAACGGAAGACTGGAGG - Intronic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
907912260 1:58836897-58836919 CAGTCCAAAGAGAAGGTTGGTGG - Intergenic
907995589 1:59628491-59628513 CAGAGAAAGGACATTGGTGGAGG + Intronic
908066994 1:60416736-60416758 ATGAGGAAAGAGAAGGGAGGTGG + Intergenic
908378181 1:63567506-63567528 TAGAGAACAGAGAACAGTGGGGG + Intronic
908390589 1:63679945-63679967 AAGCAAAAAGAGAAGGGAGGTGG - Intergenic
908531263 1:65036495-65036517 AAGAGACCAGAGAAGGGTGAGGG + Intergenic
908661919 1:66445860-66445882 GAGAGAGAAGAGGAGGGTGCTGG + Intergenic
910248796 1:85171908-85171930 CAGAGAAGAGGGGAGGGCGGGGG + Intronic
910524880 1:88166156-88166178 CAGAGAGAAGAGAAGCCTGAAGG + Intergenic
910910399 1:92227977-92227999 AAGAGAAAAGAGAATGGAGCAGG - Intronic
910979162 1:92941835-92941857 CAGATAAAAGCCAAGAGTGGTGG + Intronic
911062075 1:93757333-93757355 CAGAGAAAAGAGAAAATGGGGGG - Intronic
911808506 1:102243098-102243120 AGGAGAAAACAGAAGGGTTGGGG + Intergenic
911895106 1:103423435-103423457 CAGAGAAAAGTGCAGTTTGGAGG + Intergenic
912323053 1:108732715-108732737 AAGAGAAAAGAGAGGGAGGGAGG - Intronic
912700892 1:111877532-111877554 CAGGGAAGAGAGGAGTGTGGAGG + Intronic
912902049 1:113661724-113661746 CAGAGAAAAGAGAAGGGTGGAGG + Intronic
913275788 1:117136690-117136712 CAAAGAAAAAAAAAGGGTGGGGG + Intergenic
913582992 1:120245781-120245803 CAGAGAAATGAAAAGTCTGGAGG - Intergenic
913625180 1:120652579-120652601 CAGAGAAATGAAAAGTCTGGAGG + Intergenic
914046378 1:144096676-144096698 AAAAGAAAAAAAAAGGGTGGGGG - Intergenic
914131732 1:144864010-144864032 AAAAGAAAAAAAAAGGGTGGGGG + Intergenic
914240531 1:145849870-145849892 CAGGGAAAGGGGAAGGGTGTAGG - Intronic
915122873 1:153642462-153642484 AAGAGAAAAGGGAAGGGAGTAGG - Intronic
915172078 1:153985382-153985404 AAGAAAGAAGAGAAGGGAGGAGG + Intronic
915590104 1:156865806-156865828 CAGAGAGATGGGAAGGATGGTGG + Intronic
916083464 1:161251572-161251594 AAGAGGAAAGACAAGGGTGCAGG + Intergenic
916300987 1:163274293-163274315 CTGGGAAAAGAGAAGGGAGCTGG + Intronic
916386598 1:164279950-164279972 CAGAGAAAAGGCAATGTTGGTGG + Intergenic
916888649 1:169095468-169095490 CAGGAAGTAGAGAAGGGTGGTGG + Intergenic
916954099 1:169813674-169813696 CAGAAAAAGGAGAAGGTTAGCGG + Intronic
917141177 1:171837627-171837649 CAGAGAGATGGGAGGGGTGGGGG + Intergenic
917416719 1:174818184-174818206 ATGAGCAGAGAGAAGGGTGGAGG + Intronic
917443981 1:175091258-175091280 GAGAGAAAAGGGAAGGCAGGGGG + Intronic
917509563 1:175659013-175659035 GGGAGAAAAGAGAATGGGGGTGG + Intronic
917683783 1:177395162-177395184 AACAGAGAAGAGAAGGTTGGGGG + Intergenic
917916289 1:179705659-179705681 AAGAACAAAGAGAAGGTTGGGGG - Intergenic
917931373 1:179824892-179824914 CAGAGTTAAGAGAAGGGCGGGGG - Intergenic
919008412 1:191928950-191928972 GAGAGGAAAAAGAAGAGTGGGGG + Intergenic
919750827 1:201037057-201037079 AAGAGAAAAGAGGAGATTGGAGG + Intergenic
919973056 1:202593098-202593120 CAGAGGAAAGGGAAGGGAAGGGG + Exonic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920092293 1:203463486-203463508 GAGAGGAAAAAGATGGGTGGTGG + Intergenic
920411646 1:205766255-205766277 CAGTGAACCAAGAAGGGTGGAGG + Intergenic
920551636 1:206866418-206866440 CAGAGACAAGACCAGGGTGATGG - Intronic
920828024 1:209440249-209440271 CAGAGAAAAGAAAAGACAGGAGG + Intergenic
920895548 1:210045565-210045587 CAGAGATAAGAAATGGCTGGAGG - Intronic
921114459 1:212074979-212075001 CAGAGAAAAGAGGATGGGGTGGG - Intronic
921203925 1:212831943-212831965 AACAGAAAACAGCAGGGTGGGGG - Intronic
921969688 1:221134433-221134455 AAGAGAAAAAAGATGGGAGGTGG - Intergenic
922176093 1:223199098-223199120 AAGAACAAAGAGAAGGTTGGGGG + Intergenic
922241201 1:223756428-223756450 CAGAGAAAAGAGATGGGCTTTGG - Intronic
922327806 1:224545305-224545327 GAGAGAAGAGACAAGGGTGAAGG - Intronic
922593229 1:226794615-226794637 GAGAGAGAGGAGAAGGGTAGGGG + Intergenic
922663032 1:227446962-227446984 AAGAGCAAACAGAAGGCTGGGGG - Intergenic
923216185 1:231850175-231850197 CAAGGAACAGAGGAGGGTGGAGG + Intronic
923429119 1:233904528-233904550 GAGTCAAAAGAGAAGGGTGGAGG + Intergenic
923727230 1:236517183-236517205 GAAAGAAAAGAGAAGGCTGAAGG + Intergenic
923842397 1:237687411-237687433 AAGAGAAAAGGGAAGGGGGAAGG - Intronic
923857060 1:237856590-237856612 AAGAACAAAGAGAAGGTTGGGGG + Intergenic
923943784 1:238859695-238859717 AAAAGAAAAGAGAAGGCTGGAGG + Intergenic
924040272 1:239977870-239977892 AAGAACAAAGAGAAGGTTGGAGG + Intergenic
924354351 1:243154478-243154500 TGGAGAAAAAAGGAGGGTGGTGG - Intronic
924529969 1:244885183-244885205 AAGAGAAGAGAGAAGAGAGGGGG - Intergenic
924887827 1:248238996-248239018 CAGAGAAAAAAGGAAGGTGTGGG - Exonic
1063206887 10:3840815-3840837 CGTAGAGAAGAAAAGGGTGGGGG + Intergenic
1063480053 10:6367507-6367529 AAGGGAGAAGAGAAGGGTGCAGG + Intergenic
1063614386 10:7589624-7589646 GAGAGAACAGAGAATAGTGGAGG - Intronic
1063703656 10:8410161-8410183 CAGAGAAGAGAATAGGGTTGGGG + Intergenic
1064050672 10:12056832-12056854 CAGAGAAGAGAGAAAGGAGGGGG - Intergenic
1064071132 10:12229058-12229080 CACAGAAAGGAGAAGCGTAGAGG - Intronic
1064246498 10:13671766-13671788 CAGAGACCAGAAAAGGCTGGGGG + Intronic
1064628526 10:17285728-17285750 CAGAGAGAAGGGAAAGGGGGAGG + Intergenic
1065082272 10:22140313-22140335 CAGAGGAAAGGGAAGAGTGCAGG + Intergenic
1065268772 10:24004966-24004988 CAAGGAAAAGAGATGGATGGTGG + Intronic
1065527926 10:26641192-26641214 CAGGGAAAAAAGAAGGGGTGGGG - Intergenic
1065889014 10:30104840-30104862 TAGAGAAGAGAGAAGAGCGGAGG + Intronic
1065952375 10:30663922-30663944 CAGAGAAAAGAGATGAGGGAAGG - Intergenic
1066056427 10:31685376-31685398 ATGAGGATAGAGAAGGGTGGTGG - Intergenic
1066253951 10:33660842-33660864 CAGAGAAGAGAGCAGGGGAGGGG - Intergenic
1067026851 10:42849931-42849953 TAGAGAGGAGAGAAGGCTGGGGG + Intergenic
1067156075 10:43782342-43782364 CAGGGCAAAGTGAAGGCTGGTGG - Intergenic
1067165708 10:43864861-43864883 CAGGGAAGTGAGGAGGGTGGGGG + Intergenic
1067273384 10:44811980-44812002 CAGAGATAAAAGAAGGGTCTGGG + Intergenic
1067491394 10:46707386-46707408 CAAAGGAAACAGGAGGGTGGAGG - Intergenic
1067603270 10:47632992-47633014 CAAAGGAAACAGGAGGGTGGAGG + Intergenic
1068043313 10:51854932-51854954 GAGAGAACTGGGAAGGGTGGAGG + Intronic
1068124780 10:52826241-52826263 CAAAGAAAAGCCAAGGGGGGAGG + Intergenic
1068140814 10:53004795-53004817 AAGAGCAAAGAGAAAGTTGGGGG + Intergenic
1068332953 10:55596948-55596970 CAAAGGAAACAGGAGGGTGGAGG + Intronic
1068335022 10:55623695-55623717 AAGAGAAAAGATAGGAGTGGTGG + Intronic
1068357217 10:55924053-55924075 GAGAGAAAAGAAAAGGAAGGAGG + Intergenic
1068459185 10:57304447-57304469 CATAGAAAAGAGAAAGATAGGGG + Intergenic
1068781419 10:60922642-60922664 AGGTGAAGAGAGAAGGGTGGAGG + Intronic
1069675106 10:70240731-70240753 GAGAGAAGAGAGAAGAGAGGAGG + Intergenic
1069675111 10:70240738-70240760 GAGAGAAGAGAGGAGGGAGGGGG + Intergenic
1070762119 10:79030351-79030373 CAAAGAGAAGAAAAGGATGGAGG - Intergenic
1070835865 10:79446480-79446502 CAGAAATAGGAGAAGGGGGGGGG - Intergenic
1070951942 10:80438018-80438040 CAGGCAAGAGAGAATGGTGGTGG + Intergenic
1070972503 10:80579082-80579104 CAGAGAAGGGAGATAGGTGGAGG + Intronic
1071499624 10:86194076-86194098 CAGAGAAAGGAGAAGTGTTCTGG - Intronic
1071778094 10:88811577-88811599 TAGAGAATAGAGAAGGATGAAGG - Intronic
1071780719 10:88841308-88841330 CAGAGAAGAGAGAAGGCAGTAGG + Intronic
1071807741 10:89142766-89142788 AAGAGAAAGGAGAAGGGGAGGGG + Intergenic
1073112684 10:101072018-101072040 CAGATAAAAGAGATGGATGGAGG - Intergenic
1073137793 10:101229374-101229396 CAGAGAAGAGAGAAGAGAGAGGG - Exonic
1073318415 10:102599150-102599172 CACAGGAAAGAAAAGGATGGTGG + Intronic
1073430910 10:103486299-103486321 GAGAGAAAAGAGGATGCTGGGGG + Intergenic
1073459507 10:103658557-103658579 CAGAGAAATGAAGTGGGTGGAGG - Intronic
1073771802 10:106743145-106743167 CAAAGAAAAGAGAGAAGTGGAGG + Intronic
1074165502 10:110871191-110871213 CAGAGAACAGCGAGGGGAGGTGG + Intergenic
1074522861 10:114240374-114240396 CAGACAGAAGAGAAGGGAGGAGG + Intronic
1074875156 10:117607833-117607855 CAGAGAAGAGAACAGGGAGGAGG + Intergenic
1074973334 10:118560972-118560994 GAGAGAGAAGACAGGGGTGGGGG - Intergenic
1075054533 10:119207629-119207651 CAGAGACACGCGGAGGGTGGGGG + Exonic
1075334832 10:121601069-121601091 AAGAGAAAGGAGAAGGGGGTGGG + Intergenic
1075780951 10:125016756-125016778 TAGAGAAGAAAGAAGAGTGGAGG - Intronic
1075887890 10:125917693-125917715 CCAAGAAATTAGAAGGGTGGAGG + Intronic
1076165655 10:128280514-128280536 CAGAGAAGTGAGAAGGTGGGAGG - Intergenic
1076371096 10:129954414-129954436 CAGAGAAAAAAAAAGGGGGGGGG - Intronic
1076453257 10:130571608-130571630 AAGAACAAAGAGAAGGTTGGAGG - Intergenic
1076557408 10:131336281-131336303 CAGAGAAGTGAGAAGACTGGAGG + Intergenic
1076566123 10:131400665-131400687 CAGTGCAAAGGGGAGGGTGGAGG + Intergenic
1077553899 11:3216834-3216856 AAGAGAAGAGAGAAGGGGAGGGG - Intergenic
1077860652 11:6175856-6175878 AAAAGAAAAGAGAAAGCTGGTGG + Intergenic
1078155647 11:8797744-8797766 CAGGAAAAAGAGTAGGGTGCTGG - Intronic
1078162660 11:8855175-8855197 AAAAGAAAAGGGAAGGGAGGGGG + Intronic
1078670268 11:13358081-13358103 GAAAGGAAAGAGAAGGGAGGTGG - Intronic
1078688111 11:13551532-13551554 TAGATAAAAGAGGAGGTTGGGGG + Intergenic
1078738707 11:14046254-14046276 TAGAGAAAGGAGTAGGGTTGGGG - Intronic
1078744032 11:14094256-14094278 CAAAGAAAGGAGACGGGTTGAGG - Intronic
1078872601 11:15363031-15363053 CAGAGAACAGAGTGGAGTGGAGG - Intergenic
1079064425 11:17276926-17276948 CAGAGCAGAGAGGATGGTGGGGG + Intronic
1079119950 11:17674913-17674935 CAGAGAAAGAAGAAGCCTGGAGG + Intergenic
1079249115 11:18774296-18774318 CAGAGAAATGAGGGTGGTGGTGG + Intronic
1079475048 11:20821254-20821276 TAGAGGAAGGAGAAGGGTGGAGG - Intronic
1079807134 11:24946621-24946643 TAGAAAAAAAAGAAGGGTTGGGG - Intronic
1079901725 11:26195116-26195138 GAAAGAAAACAGAAAGGTGGTGG + Intergenic
1079995742 11:27293532-27293554 AAGAGAAAAGAAAAGAGGGGAGG + Intergenic
1079997570 11:27311049-27311071 AAGAGAAAAGAAAAAAGTGGGGG + Intergenic
1080226316 11:29965152-29965174 CAGAGATGAGAGGAGGGTAGGGG + Intergenic
1080232922 11:30037868-30037890 AAGAGACAAGAGAAGGAGGGAGG + Intergenic
1080756638 11:35206639-35206661 CAGAGAAAGGAAGTGGGTGGTGG + Intronic
1080908355 11:36569525-36569547 GAAAGAAAAGCTAAGGGTGGTGG + Intronic
1080946551 11:36980750-36980772 CAGGAGAAAGAGAAGGGAGGAGG + Intergenic
1080953154 11:37060349-37060371 CAGAGAAGGCAGATGGGTGGAGG + Intergenic
1081455146 11:43213906-43213928 GAGAGAAAAGAGAATTGAGGAGG + Intergenic
1081472540 11:43389138-43389160 CAAAAAAAAAAAAAGGGTGGAGG + Intronic
1081625223 11:44651439-44651461 AAGAGAAAAGACACGGGGGGTGG + Intergenic
1081871079 11:46382751-46382773 CAGCGAAAGGAGAAGGGGGTGGG + Intronic
1082657055 11:55869002-55869024 CTGAGCAAAGAGAAGGGGGTGGG + Intergenic
1082929137 11:58580545-58580567 CAGAGAAAATTGAAGTGAGGGGG + Intronic
1082960371 11:58913699-58913721 AAGGGAAAAGAGAATGGAGGAGG + Intronic
1082980312 11:59114854-59114876 AAGGGAAAAGAGAATGGCGGAGG + Intronic
1083058149 11:59842944-59842966 CCCAGAAAGGAAAAGGGTGGGGG - Intronic
1083179835 11:60978204-60978226 CAGAGAAAGGACAAAGGGGGTGG + Intronic
1083258489 11:61510519-61510541 AAGAGAACAGAATAGGGTGGGGG - Exonic
1083995392 11:66269115-66269137 CAGGAGAAAGAGAAGGGTAGAGG - Intronic
1084554401 11:69867361-69867383 CAGAGGGAAGAAAACGGTGGTGG - Intergenic
1084563593 11:69917570-69917592 AAGAGAAGAGAGAAGGGGAGGGG - Intergenic
1084583413 11:70038908-70038930 GAGAGAAAATAGAAGGGGGAAGG + Intergenic
1084933249 11:72573564-72573586 GGGAGAAAAGAGTGGGGTGGTGG - Intergenic
1085062756 11:73462923-73462945 AAGAGAAAAGAGAAGAGAAGAGG + Intronic
1085080738 11:73632113-73632135 AAGAGCAAACAGAAGGTTGGAGG + Intergenic
1085134421 11:74073022-74073044 CAGGCAAAAGAGAAGGGTGACGG + Intronic
1085146582 11:74204603-74204625 AAGAACAAAGAGAAGGTTGGAGG + Intronic
1085556378 11:77426235-77426257 CAGAGAAAAAAAGATGGTGGTGG - Intronic
1085658284 11:78337533-78337555 CAGGGAAAAGAGAAAGAAGGTGG + Intronic
1085745605 11:79111815-79111837 CAGAGAAAGGAGGTGGGAGGGGG + Intronic
1085802952 11:79608390-79608412 GGGAGAATAGAGTAGGGTGGGGG - Intergenic
1086103143 11:83122452-83122474 CAAAGAAAATAGAAGGGCTGGGG - Intergenic
1086116446 11:83256546-83256568 AAGAGAAAAGAGAGGGGGGTAGG - Intronic
1086307128 11:85493669-85493691 CAGAGAGGAGAGAAGGGGAGGGG + Intronic
1086761710 11:90639384-90639406 AAGAGAAAAAAGGAGAGTGGGGG + Intergenic
1086986995 11:93261585-93261607 CAGGGACAAGAGAAGGGTCTGGG - Intergenic
1087352363 11:97048123-97048145 AAGAAAAAAGAGGAGGGTGATGG - Intergenic
1087940669 11:104093231-104093253 TAGAGAAAAGTGATGGGGGGAGG + Intronic
1088735186 11:112722987-112723009 CAGAGAACAGAGACGGGAGCAGG + Intergenic
1088779069 11:113116338-113116360 GAAGGGAAAGAGAAGGGTGGTGG + Intronic
1089506911 11:118969519-118969541 GAGAGGGAAGAGAAGGGAGGAGG + Intergenic
1090197180 11:124826757-124826779 AAAAGAAAAAAAAAGGGTGGGGG - Intergenic
1090203865 11:124874397-124874419 CACAGAAGAGACAAGGGAGGAGG + Intronic
1090268153 11:125367820-125367842 CAGAGAGAAGAAAGGGGAGGTGG - Intronic
1090480277 11:127061760-127061782 CAAAGAAAGGAGAAGGGGGAAGG - Intergenic
1090594812 11:128310022-128310044 AAGAGACAAGAGTAGGGTGTTGG - Intergenic
1090878644 11:130814013-130814035 CAGATAAAACAAAAAGGTGGAGG + Intergenic
1091056010 11:132419908-132419930 CAGAGGAAAGGGAAGGGTCAAGG + Exonic
1091157073 11:133383912-133383934 GGGAGATAAGAGAAGGGTGCAGG + Intronic
1091422988 12:359741-359763 CAAAAAAAAAAAAAGGGTGGGGG + Intronic
1091560635 12:1610293-1610315 CACAGGCAAGAGAAGGTTGGAGG - Intronic
1091592024 12:1848243-1848265 CAAGGAAAAGAGAAGGGGAGAGG - Intronic
1091799182 12:3313947-3313969 CTGAGTAATGGGAAGGGTGGAGG - Intergenic
1091842300 12:3629835-3629857 CAAGGAAAAGACAAGGGGGGGGG + Intronic
1091954319 12:4625741-4625763 GAGAGAGAAGAGAAGGTTGTAGG + Intronic
1092127407 12:6084634-6084656 CTGACAAAGGAGAAGGGAGGGGG + Intronic
1092629343 12:10361671-10361693 AAGAGCAAAGAGAAGGTTAGAGG + Intergenic
1092650371 12:10628370-10628392 AAGAGAAGAGAGAAGTTTGGTGG + Intronic
1092874931 12:12839683-12839705 CAAAAAAAAGAGAAGAGTAGTGG + Intergenic
1092930344 12:13309609-13309631 CAAAGAACAGGGAAGGGTGTTGG - Intergenic
1093017637 12:14170943-14170965 GAGAGGAAGGAGAAGGGTGAGGG + Intergenic
1093318288 12:17678938-17678960 AAAAGAAAAGAGAAGGAGGGAGG + Intergenic
1093763352 12:22935297-22935319 CAGAGAAAAGAAAGGGGCGCTGG - Intergenic
1094059656 12:26300261-26300283 CAGAGAGAAGAGGAAGGAGGAGG - Intergenic
1094079384 12:26516147-26516169 CGAAGAAAAGAGAAGGGGAGAGG + Intronic
1094269026 12:28590783-28590805 TAGAGAAAATACAAGGGTGAGGG - Intergenic
1095169275 12:39014665-39014687 CAGGCAAAAGAAAATGGTGGTGG - Intergenic
1095747907 12:45680428-45680450 AAGAACAAAGAGAAGGTTGGAGG + Intergenic
1095873453 12:47055392-47055414 AGGAGAACAAAGAAGGGTGGTGG - Intergenic
1095960337 12:47830493-47830515 AAGAGGAAAGAGGAAGGTGGAGG - Intronic
1096079800 12:48825825-48825847 CAAAAAAAAGAAAAGGGAGGAGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096638758 12:52977648-52977670 GAGAGAAGAGAGAAGAGAGGGGG - Intergenic
1096813389 12:54185895-54185917 AAGGGAAGAGAGAAGGGAGGTGG + Intronic
1096913619 12:55009308-55009330 CAGGGAAGAGAAAAGGGAGGGGG + Intergenic
1097103226 12:56604167-56604189 CAGAGAGGAGAGAAGTGGGGCGG - Intronic
1097352810 12:58567142-58567164 CAGTGAAAAAAAAAGGGGGGGGG - Intronic
1097437453 12:59568898-59568920 CAGAGAAAATAGAAGAGTCGAGG - Intergenic
1097726289 12:63079196-63079218 CAGAAAAAGGGGCAGGGTGGGGG - Intergenic
1097834135 12:64256667-64256689 AAGAGGAAAGAGAAGGGAAGAGG + Intergenic
1098198421 12:68027419-68027441 CAGAGAAAATTGAGGGGTGGTGG + Intergenic
1098331098 12:69354587-69354609 CTGAGAGCAGAGGAGGGTGGAGG - Intergenic
1098353675 12:69589271-69589293 CAAAAAAAAAAGAGGGGTGGGGG - Intronic
1098974056 12:76883862-76883884 TGGATAAAAGAAAAGGGTGGGGG - Intergenic
1099927129 12:89031993-89032015 CAGAGAAAAGTCAAGCCTGGTGG + Intergenic
1099939089 12:89163647-89163669 CAGAGAAGAGAGATTGGGGGAGG - Intergenic
1100035309 12:90243666-90243688 CAAAGAAAAGAGAAGAGAAGGGG - Intergenic
1100700014 12:97137458-97137480 CATAGAAAAGAGAAGAGTTAGGG - Intergenic
1100867293 12:98870471-98870493 CAAAGAAAAGAAAAGGGTGAGGG - Intronic
1101008889 12:100429936-100429958 CAGAAGAAAGAGAAGGGAAGAGG - Intergenic
1101381094 12:104214767-104214789 TAGAGTAAAGTAAAGGGTGGGGG + Intergenic
1101384499 12:104244824-104244846 CAGGGAAAAGAAAGGGGTGTAGG + Intronic
1101409909 12:104458814-104458836 CAGTGAAAGGAGAAGGCGGGAGG - Intronic
1101455251 12:104824931-104824953 CAGGAAAGAGAGAAAGGTGGTGG - Intronic
1102756147 12:115342527-115342549 GAGAGAAGAGAGCAGGGAGGAGG + Intergenic
1102790687 12:115642743-115642765 AAGAGGAAAGAGAAGTGTGCAGG - Intergenic
1102852254 12:116259534-116259556 GAGAGAAAAGAGAATGGGAGAGG + Intronic
1102856540 12:116299338-116299360 CATAGAAAGGAGAAGTGTGGGGG + Intergenic
1104706445 12:130951111-130951133 CAAAGAACAAAGAACGGTGGTGG - Intergenic
1104774663 12:131384253-131384275 CACAGAGAAAAGGAGGGTGGGGG - Intergenic
1105438995 13:20400284-20400306 GAGAGAAAACAGAAGGGCAGAGG - Intergenic
1105459651 13:20571661-20571683 AAGAACAAAGAGAAGGTTGGAGG + Intronic
1106227975 13:27799348-27799370 CAAGGGCAAGAGAAGGGTGGTGG + Intergenic
1106301300 13:28468691-28468713 CAGGAACAAGAGAAGGGGGGAGG - Intronic
1106395877 13:29380453-29380475 CAGAGAAATGAGTAGGGCAGAGG - Intronic
1106397163 13:29392247-29392269 GACAGAAAATAGAATGGTGGTGG - Intronic
1106511571 13:30417845-30417867 GAAAGAAGAGAGAAGAGTGGAGG - Intergenic
1106519187 13:30482251-30482273 AAGAGAAAAGAGAAAGGGAGAGG - Intronic
1106632043 13:31484694-31484716 CAAAGAACAGAGTGGGGTGGGGG - Intergenic
1106738310 13:32611307-32611329 CATAGAGAAGAGAAGGGTTTGGG - Intronic
1106769643 13:32949353-32949375 CAGAGAACAGAAAAGGGCGGGGG + Intergenic
1106980000 13:35268314-35268336 GACAGAAAATAGAATGGTGGTGG + Intronic
1107095077 13:36527287-36527309 CAGAGGAGGGAGAAGGGAGGTGG + Intergenic
1107100572 13:36586504-36586526 TAGGGAAGAGAGATGGGTGGAGG - Intergenic
1107675441 13:42791813-42791835 CAGAGAGGAGAGAGGGATGGGGG - Intergenic
1107853518 13:44592541-44592563 CACAGACAAGTGAAGGGTGAAGG - Intergenic
1108086038 13:46794846-46794868 AAGAAAAAAGAAAAGGGAGGTGG - Intronic
1108221376 13:48236663-48236685 AAGAGAAAGGAGATGGGTAGAGG + Intronic
1108446299 13:50512150-50512172 CTGAGAAAAGAGGATGGGGGAGG + Intronic
1108495298 13:51018915-51018937 CAGAAAGAAGAGCAGGGTTGGGG - Intergenic
1108561147 13:51645523-51645545 GAGAGAAAAGGGAAGGCTGGGGG - Intronic
1108568143 13:51721983-51722005 GAAGGAACAGAGAAGGGTGGGGG - Intronic
1109175199 13:59146468-59146490 CAGAGAAAAGAGCAAGATGATGG + Intergenic
1109433287 13:62264699-62264721 AAGAAAGATGAGAAGGGTGGAGG + Intergenic
1109968969 13:69739528-69739550 CAGACAAAATAAAAGGATGGAGG + Intronic
1109977643 13:69860370-69860392 CAGAAAAAAGAGAATGTTAGTGG + Intronic
1110098437 13:71562387-71562409 CAGAGAGAAGAGATGGGAAGAGG + Intronic
1110455117 13:75682564-75682586 AAGAGGAAAGGGGAGGGTGGTGG + Intronic
1110613875 13:77519906-77519928 CAAAGAAACAAGAAGGCTGGAGG + Intergenic
1110754173 13:79152297-79152319 GAGAAAAAGGAGGAGGGTGGTGG - Intergenic
1110763757 13:79258902-79258924 GAGAAAAAAGAGAAGAGAGGAGG + Intergenic
1111734182 13:92116096-92116118 CAGAAAAAAAATAAGTGTGGTGG + Intronic
1112183155 13:97104782-97104804 CAGGGAACGGAGATGGGTGGGGG - Intergenic
1112234356 13:97621973-97621995 GAAAGAATAGAGGAGGGTGGGGG + Intergenic
1112343177 13:98568952-98568974 CACAGAAAATGGAAGGGGGGAGG + Intronic
1112643928 13:101307671-101307693 CCAAGAAAAGGGAAGGGAGGAGG + Intronic
1113147232 13:107220825-107220847 CAGAGAGAGGAGTGGGGTGGAGG + Intronic
1113531293 13:111029438-111029460 CAGAGAGAAGAGTGTGGTGGGGG - Intergenic
1113606699 13:111612998-111613020 TAGAGAAAAGCACAGGGTGGCGG + Intronic
1113898873 13:113784750-113784772 GAGAGAAAAGACAAGGCAGGTGG + Intronic
1114680266 14:24478317-24478339 CAGAGAAGTGAGGAGGCTGGAGG + Intergenic
1114708940 14:24757479-24757501 CAGAGAAAAGAAAGGGATAGAGG + Intergenic
1114811482 14:25905546-25905568 AAAAAAAAAAAGAAGGGTGGGGG - Intergenic
1115018863 14:28650278-28650300 TAGAGGCAAGAGAAGGGTTGAGG - Intergenic
1115070154 14:29312363-29312385 CAGAGACAATCGAAGGCTGGAGG + Intergenic
1115275599 14:31605807-31605829 ACGAGAAAGGAGAAGGGAGGAGG - Intronic
1115338155 14:32262988-32263010 AGAACAAAAGAGAAGGGTGGGGG + Intergenic
1115922848 14:38395875-38395897 CAGTGAAGAGAGCAGGGAGGAGG - Intergenic
1116319002 14:43435653-43435675 TAGGGAAAAGGGAAGGGTGAGGG + Intergenic
1116722615 14:48519184-48519206 CAGAAACAAGAGAAGGGTACTGG + Intergenic
1117050849 14:51858229-51858251 GAGAGAAAAGTAAAGTGTGGGGG - Intronic
1117275338 14:54188026-54188048 AAGATAAATGAAAAGGGTGGCGG + Intergenic
1117316696 14:54577766-54577788 CAGAGAAGACAGAATGGCGGGGG + Intronic
1117435997 14:55715776-55715798 CAGACAAAAGAGAAGAGATGGGG - Intergenic
1117480562 14:56140020-56140042 CAGGAAAAAGAGAAGGGGGAAGG - Intronic
1117587416 14:57224680-57224702 CAGAAAATTGAGAGGGGTGGTGG + Intronic
1118024209 14:61752277-61752299 CATAGAAGAGAGCAGGCTGGTGG + Intergenic
1118130809 14:62961360-62961382 CAGACAAAAGAAACGGTTGGTGG - Intronic
1118169406 14:63372089-63372111 AAAAAAAAAGAGAAAGGTGGGGG + Exonic
1118808947 14:69260147-69260169 CAGAAAAAGGAGAGAGGTGGGGG - Exonic
1119397662 14:74339456-74339478 AGGGTAAAAGAGAAGGGTGGAGG + Intronic
1119443776 14:74647303-74647325 CAGAGGAAGGAGAAGGGAGTCGG - Intergenic
1119600654 14:75974139-75974161 CAGAAAAAAAAGAAGGGAGATGG + Intronic
1119607322 14:76031839-76031861 CAGAGAAGAGAGAAGGTTAGAGG - Intronic
1119641255 14:76316692-76316714 CAGAGAGGAGAGAAGGATAGGGG - Intronic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1120005054 14:79347120-79347142 CAGAATACAGATAAGGGTGGGGG - Intronic
1120181087 14:81342866-81342888 CAGAGGAAAAAGAGTGGTGGTGG + Intronic
1120428882 14:84388439-84388461 CAAAGAAAAGAGTAGAATGGCGG + Intergenic
1120774020 14:88412482-88412504 CAGAAAAACGTGAAGGGTTGAGG - Intronic
1120993652 14:90398426-90398448 CAGAGAAAGCAGAAACGTGGAGG - Intronic
1120999992 14:90444663-90444685 CACAGAAAGGAGAAAGGAGGAGG - Intergenic
1121445945 14:93979009-93979031 CAGAGGAAAGAGAACTGTGCTGG + Intergenic
1121945275 14:98114812-98114834 CAGAGAACAGAGAGAGGTGCTGG - Intergenic
1122031735 14:98917262-98917284 AAGAAAGAAAAGAAGGGTGGGGG - Intergenic
1122213814 14:100190478-100190500 AAGAACAAAGAGAAGGTTGGAGG - Intergenic
1122277976 14:100605004-100605026 CAGGGAAAAGAGAAGTGTCTAGG - Intergenic
1122441788 14:101737033-101737055 CAGAGAAAATAGAAGGCAGAAGG - Intergenic
1122547943 14:102535057-102535079 CAGAGAAAAAAAAAAGGGGGGGG + Intergenic
1122832053 14:104403181-104403203 CAGAGAAGGAGGAAGGGTGGGGG - Intergenic
1122854969 14:104555712-104555734 CAGAACAAAGAGGAGGCTGGAGG + Intronic
1122874049 14:104655130-104655152 AAAAGAAAAGAGAAGGGAAGGGG + Intergenic
1124870573 15:33537965-33537987 AAAAGAAAAGAAAAAGGTGGTGG - Intronic
1124932222 15:34131772-34131794 GAGAAAATAAAGAAGGGTGGAGG - Intergenic
1125245836 15:37638045-37638067 CAGAGCAAACAGAAGGGAGGAGG + Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1126259576 15:46672587-46672609 AAGAACAAAGAGAAAGGTGGTGG + Intergenic
1126836925 15:52677954-52677976 CATAGAAAAGAAGGGGGTGGGGG + Intronic
1127453902 15:59140885-59140907 AAGAGAAAAGTGCAGGGGGGTGG - Intronic
1127815423 15:62604538-62604560 AAAAAAAAAGAAAAGGGTGGGGG + Intronic
1127922136 15:63502706-63502728 CGGAGGAAACAGAAGGTTGGTGG + Intergenic
1128546730 15:68573478-68573500 CAGAGAGCAGGGAAGGGTTGTGG + Intergenic
1128600346 15:68990613-68990635 CTGATAAAGGAGGAGGGTGGGGG - Intronic
1128668860 15:69559269-69559291 CAGCGCAAAGAGAAGGCTGTGGG - Intergenic
1129200591 15:73996251-73996273 CAAGGAAACTAGAAGGGTGGAGG - Intronic
1129274470 15:74436038-74436060 CAGAGAGAAGTCAAGGGTGTGGG - Intergenic
1129306412 15:74667420-74667442 GAAAGAAAGGAGAAGGGGGGAGG + Intronic
1129648277 15:77458934-77458956 CACAGAAAGGAGAAGGGGGTGGG - Intronic
1129761377 15:78131100-78131122 CCGAGAAAAGGGAGGGGCGGCGG + Intronic
1130141969 15:81235166-81235188 CAGAGAAAAGATAAGGTTGGGGG + Intronic
1130282695 15:82532018-82532040 CAGAGAAAAGGGAAGCCTGACGG - Intergenic
1130289588 15:82585766-82585788 CAGAGAAGAGAGTAGGATTGAGG - Intronic
1130303932 15:82700258-82700280 TAGAGATAAGAGAAGGTTGATGG - Intronic
1130537588 15:84798243-84798265 GAGAGAGCAGAGATGGGTGGAGG + Intronic
1130634982 15:85609824-85609846 CAGAGAAAATGGAAGAGAGGAGG - Intronic
1130750044 15:86701862-86701884 AAGAAAAAAGAGAAGGGAAGGGG - Intronic
1131058346 15:89389752-89389774 CAGGGAGTAGAGAAGGGTGGGGG - Intergenic
1131111014 15:89765572-89765594 AAGAGGAAAGGGAAGGGAGGAGG + Intronic
1131441501 15:92463213-92463235 AAGTGAAGAGAGAAGGGTGCAGG - Intronic
1131578286 15:93614274-93614296 AAGAGAAGAGAGAAATGTGGAGG + Intergenic
1131780411 15:95850545-95850567 CAGATAAAACAAAAGCGTGGAGG + Intergenic
1132007280 15:98239757-98239779 CAGAGAACAGAGAATGTTGAGGG + Intergenic
1132129725 15:99264757-99264779 CTTAGAAAAGAGAAGAGAGGGGG - Intronic
1132141348 15:99399289-99399311 AAGAGAAAAGAAGAGAGTGGTGG + Intergenic
1132712210 16:1274075-1274097 CAGAGACAAGCCACGGGTGGCGG + Intergenic
1132942661 16:2515648-2515670 CAAAGAACAGAGGAGGCTGGGGG - Intronic
1133288136 16:4700575-4700597 CACAGAAAGGAGGAGGATGGTGG + Intronic
1133569621 16:7027916-7027938 AAGGGAAAAGAGAAGGAAGGAGG + Intronic
1133942488 16:10321994-10322016 CAGAGAGAAGAGGACGTTGGAGG - Intergenic
1134369609 16:13610835-13610857 CAGAGAACAGAGAACAGAGGAGG - Intergenic
1135229230 16:20690091-20690113 CAGAGAAAAGAAAAAGAAGGTGG + Intronic
1135405164 16:22192316-22192338 CAAAGAGCAGAGGAGGGTGGGGG + Intergenic
1135472569 16:22744490-22744512 CAGAGAAAGGAAGAGGATGGAGG + Intergenic
1135706160 16:24676936-24676958 CAGAGAGAAAAGAAGGCTAGAGG - Intergenic
1135735031 16:24924116-24924138 CTGAGAAGAGGGATGGGTGGTGG - Intronic
1135775384 16:25253414-25253436 GGGAGAAAAGGGAAGGGAGGGGG - Intronic
1135934963 16:26771757-26771779 CAGAGCAAGGAGCAGGATGGAGG - Intergenic
1136074799 16:27809657-27809679 GAGAGAAAAGAGAGGGATGGAGG - Intronic
1136154431 16:28373742-28373764 CTCAGTCAAGAGAAGGGTGGGGG - Intergenic
1136532113 16:30876696-30876718 GAGAGAGAAGGGGAGGGTGGAGG + Intronic
1137438760 16:48480944-48480966 CAGAACAAAGAAAAGGTTGGGGG - Intergenic
1137590941 16:49693250-49693272 CACAGAAATGAGCAGGGTGTGGG + Intronic
1137911921 16:52386151-52386173 CACGGAAAAGAGCAGGCTGGTGG + Intergenic
1137977253 16:53042272-53042294 GAGAGAAAGGAGAGGGGTGAGGG - Intergenic
1138292661 16:55861295-55861317 CATAGAAAAGAGGAGGATTGAGG - Intronic
1138602354 16:58063614-58063636 CAGAGGAAAGAAGGGGGTGGGGG - Intergenic
1139122467 16:64037102-64037124 CATACAAAAGATTAGGGTGGGGG - Intergenic
1139194212 16:64899430-64899452 CAAAGAAAAGAGAAGGGTCAGGG + Intergenic
1139521053 16:67482993-67483015 CAGGGAAAAGGGTAAGGTGGTGG - Intronic
1139554089 16:67695295-67695317 AAGAGAAAAGAGAGAGATGGTGG - Intronic
1139588867 16:67922050-67922072 AACAGAAAAGGGAAGGGTGTGGG - Intronic
1139611613 16:68063033-68063055 CTGAGAAGAGAGGAGGCTGGAGG - Intronic
1139657374 16:68397241-68397263 CAGGTAAGAGGGAAGGGTGGTGG - Intronic
1139743304 16:69054133-69054155 GAGTGGAAAGAGAAGGATGGAGG + Intronic
1140235908 16:73158449-73158471 AAGAGAAAAGAGAAGGGAGGGGG - Intergenic
1140967668 16:79983004-79983026 GAGTGAAAATAGAAGGGAGGGGG - Intergenic
1141024338 16:80530409-80530431 AAAAGAAAAGAAAAGTGTGGTGG - Intergenic
1141227975 16:82137302-82137324 CAGAGGTCAGAGAAGAGTGGTGG + Intergenic
1141369585 16:83474580-83474602 CAGAAAAAACAAGAGGGTGGGGG + Intronic
1141645531 16:85365382-85365404 CAGGGAAAAGAGAAGAGTGAAGG - Intergenic
1141865369 16:86746520-86746542 CAGAGAAAAGAGAAGAGACACGG + Intergenic
1141998625 16:87650368-87650390 CAGAGGAGAGAGAGGGATGGGGG - Intronic
1142019371 16:87771421-87771443 AAGAACAAAGAGAAGGTTGGGGG + Intergenic
1142131977 16:88435290-88435312 CAGAAAAAAGAGAAGGCCGGAGG + Exonic
1143091264 17:4450253-4450275 GAGAGAAAAGAGGAGGAAGGAGG - Intronic
1143391586 17:6561856-6561878 CAGGGAAAAGGAAAAGGTGGAGG - Intergenic
1144023214 17:11255316-11255338 AAGAGAAAAATGAAGGGAGGAGG + Intronic
1144479393 17:15616502-15616524 CTAAGAAAAGAGAAGGTTGTTGG + Intronic
1144542172 17:16155004-16155026 CAGAAGAAAGAAAAGGGTGATGG - Intronic
1144918911 17:18747224-18747246 CTAAGAAAAGAGAAGGTTGTTGG - Intronic
1145191855 17:20848802-20848824 AAGAGAAAAGATAGGAGTGGTGG + Intronic
1145991721 17:29083062-29083084 CAGAGAAAGGAAAAGGGGCGGGG + Intronic
1146118927 17:30172104-30172126 CAGAGAAAATAGAATGGTACAGG - Intronic
1146357052 17:32142891-32142913 CAGCCAAAAGAGAAGAGTGAAGG - Intronic
1146712775 17:35056896-35056918 AAGAAAAAAAAAAAGGGTGGTGG - Intronic
1146841182 17:36155368-36155390 CAGGGGAAAAAAAAGGGTGGGGG + Intergenic
1146940066 17:36838281-36838303 CAAAGAAAAGAAAACAGTGGAGG - Intergenic
1147575453 17:41596350-41596372 CAGAGAACAGAGAAGAGTCCAGG + Intergenic
1147966202 17:44195524-44195546 CAGAGAAAAGAGAAGGACAGGGG + Intronic
1148125211 17:45233194-45233216 CCGAGAACAGGGAAGGCTGGTGG - Intronic
1148282641 17:46361155-46361177 AAGAGGAAAGAGAAGGGAGAGGG - Intronic
1148304859 17:46579080-46579102 AAGAGGAAAGAGAAGGGAGAGGG - Intronic
1148342620 17:46882646-46882668 GAAAGAAATGGGAAGGGTGGGGG - Intronic
1148489025 17:48011601-48011623 GAAAGAAAAGAAAAGGGTGGAGG + Intergenic
1148628211 17:49086669-49086691 CACAGAACTGAGAAGGGTGAAGG + Intergenic
1148847788 17:50539273-50539295 GAGAGAAGAGAGAAAGGAGGAGG + Exonic
1148907648 17:50921361-50921383 CAGAGAAAGCAGAAGTGTGGAGG - Intergenic
1148919967 17:51022241-51022263 AAGAGAAAAGAGTAGGGAGTAGG + Intronic
1149013674 17:51884034-51884056 CAAAGAAAAAAGAAGGGTCAAGG - Intronic
1149159327 17:53671981-53672003 TAGAGAAAGAAGAAGTGTGGTGG + Intergenic
1149576532 17:57717249-57717271 CAGAGGACTGTGAAGGGTGGTGG - Intergenic
1150082684 17:62254313-62254335 CAGGGAAAAAAAAGGGGTGGGGG + Intergenic
1150485616 17:65541381-65541403 TAAAGAAAAGAAATGGGTGGTGG - Intronic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1150707893 17:67504074-67504096 CAGAGAAATGAGGGGTGTGGAGG + Intronic
1151315596 17:73320147-73320169 CAGTAAAAAGAGAAGGAAGGAGG - Intergenic
1151345707 17:73500143-73500165 CAGAGAATGGAGGAGAGTGGAGG - Intronic
1151624459 17:75267914-75267936 GAGAGGAAGGTGAAGGGTGGGGG + Intronic
1151652103 17:75476398-75476420 AAGAGGAAAGAGAAGGAGGGAGG - Intronic
1151757682 17:76083909-76083931 GGGAAAAAGGAGAAGGGTGGTGG - Intronic
1151780794 17:76243838-76243860 GGGAGAAAGGAGAAGGGTGGGGG + Intergenic
1151958221 17:77391259-77391281 CACAGAAAAGAAACGGGAGGAGG - Intronic
1152432147 17:80254407-80254429 CAGTGAGAAGAAAGGGGTGGAGG - Intergenic
1153096981 18:1418286-1418308 CAGAGAAATGAGAAGGGAGCTGG + Intergenic
1153421138 18:4906661-4906683 AAGAACAAAGAGAAGGTTGGGGG - Intergenic
1153554115 18:6293001-6293023 AAGAACAAAGAGAAGGTTGGAGG - Intronic
1153682382 18:7512831-7512853 CAAATGAAAGAGAAGGGAGGGGG - Intergenic
1153815342 18:8785850-8785872 CAAACAAAGGACAAGGGTGGAGG - Intronic
1155520052 18:26658335-26658357 AATAGCAAAGAGAAGGGAGGAGG - Intergenic
1155728134 18:29115747-29115769 GAGAGAAAAGAGAAGAGGTGAGG - Intergenic
1155839720 18:30630300-30630322 GAGAGACAAGAAAATGGTGGAGG - Intergenic
1155946780 18:31861923-31861945 CAGAAAAAAAAAAAGGGGGGGGG + Intronic
1156358714 18:36364894-36364916 GGGAGAAAGCAGAAGGGTGGTGG + Intronic
1157448224 18:47764332-47764354 CAGAGAAAACAGAATGCTGTTGG + Intergenic
1157820336 18:50762964-50762986 CAGAGAGAGAAGAAGGGTGAAGG - Intergenic
1158102951 18:53851374-53851396 AAGAGAGAAGGAAAGGGTGGGGG - Intergenic
1160001878 18:75032496-75032518 GAGAGAAGAGAGAAGGTTGGTGG - Intronic
1160002047 18:75033864-75033886 CAGGGAAAGGAGAAGGGAAGAGG - Intronic
1160290977 18:77593325-77593347 CAGAGAAAATGGAAAGTTGGAGG - Intergenic
1160298970 18:77661664-77661686 CAGGTAGAAGCGAAGGGTGGGGG - Intergenic
1160584408 18:79904452-79904474 CACAGAGAAGTCAAGGGTGGGGG - Intronic
1161403071 19:4077530-4077552 CAGAGAGGAGAGAAGTGTGTGGG - Intergenic
1161776986 19:6269012-6269034 CAGAGAAAAGGGGAGGGGTGAGG + Intronic
1162127676 19:8508059-8508081 CAGAGAATGGAGAAAGGAGGAGG + Intergenic
1162589821 19:11584178-11584200 CAAGGAACAGAGAAGGGTGTGGG + Intronic
1162875240 19:13616584-13616606 TAGAGAAAAGAAAACGGTAGAGG + Intronic
1162943516 19:14028462-14028484 CAGAGATAAGAGGAGGTTGCTGG + Intronic
1162985830 19:14268983-14269005 CAGGGGAAAAAGTAGGGTGGGGG - Intergenic
1163064541 19:14783683-14783705 CAAAGGAGAGAGTAGGGTGGGGG + Intergenic
1163110346 19:15156819-15156841 CAGAGCACAGAGAAGAGTTGAGG + Intergenic
1163442689 19:17329629-17329651 CAGACAGGAGAGAAGGATGGAGG + Intronic
1164550890 19:29211786-29211808 CAGAGTAAAAAGAAAAGTGGCGG + Intronic
1164587441 19:29484866-29484888 CAGGGAAAAGAAAAGGGGGCTGG - Intergenic
1165076748 19:33283564-33283586 CAGCTTCAAGAGAAGGGTGGAGG - Intergenic
1165186041 19:34022672-34022694 GAGAGACAAGAGACTGGTGGTGG - Intergenic
1165704706 19:37967249-37967271 CAAAAAAAAAAAAAGGGTGGGGG - Intronic
1165977659 19:39691498-39691520 CAGAGAAAAGAAAAGGGTGTGGG + Intergenic
1166009183 19:39928404-39928426 GAAAGGAAAGAGAAGGGTGGTGG - Intronic
1166121937 19:40691512-40691534 CAGAGAAAAGAGCTGGGGGAAGG + Exonic
1166424140 19:42661222-42661244 CAGAGAAAACAACTGGGTGGTGG + Intronic
1166875181 19:45892595-45892617 CTGAGGAAGGAGCAGGGTGGGGG - Intronic
1166936646 19:46337597-46337619 CAGAGAGGAGAGAAAGGTGAGGG + Intronic
1167011833 19:46813685-46813707 AGGAGAGAGGAGAAGGGTGGAGG - Intergenic
1167228609 19:48267160-48267182 CAGAGAAAATAGAAGGGAATTGG + Intronic
1167268472 19:48494730-48494752 CAGGGGCAAGAGGAGGGTGGAGG + Intronic
1167478171 19:49712877-49712899 CAGAGGAAAGAGGGGGCTGGGGG + Intronic
1168196212 19:54775826-54775848 CAAAGAAAAGTAAAGGGTGTAGG - Intronic
1168259819 19:55187042-55187064 CAAAGAAAAAAAAAAGGTGGGGG + Intronic
1168326249 19:55540143-55540165 CAGAGAAATGGGAGAGGTGGAGG + Intergenic
1168509290 19:56961596-56961618 CGGAGAGAAGAGAAGAGGGGAGG - Intergenic
1168677318 19:58288187-58288209 AAGAGAATAAAGAAGGGTGTGGG - Intronic
1202685931 1_KI270712v1_random:50091-50113 AAAAGAAAAAAAAAGGGTGGGGG - Intergenic
925055428 2:853525-853547 GAGAGAGAAGAGAAGGGTGAAGG - Intergenic
925118553 2:1399968-1399990 TGGAGAAGAGGGAAGGGTGGCGG - Intronic
925309518 2:2872541-2872563 CAGAGAAGAGAGATGGGTCGGGG - Intergenic
925856683 2:8135723-8135745 TGGAGAAAAGAGAAACGTGGAGG + Intergenic
925970393 2:9102755-9102777 CAAAGAACAGAGAAGTTTGGAGG + Intergenic
926053373 2:9758671-9758693 AAGAGCAAAGAGAAGGTTGTAGG + Intergenic
926198762 2:10778764-10778786 CTCAGAAAGGAGACGGGTGGAGG - Intronic
926848331 2:17166835-17166857 CCTAGAAAAGTGAAGGGTGGAGG - Intergenic
927431688 2:23031672-23031694 CACTGAAAAGAGAAGGGTCATGG + Intergenic
928133445 2:28670186-28670208 GAGAGAAGAGAGATGGATGGTGG + Intergenic
928467236 2:31533460-31533482 TAGAGAAAAGATCAGGGTAGAGG + Intronic
928857012 2:35814285-35814307 CAGAGAAAAGAGAGGAGAGAAGG - Intergenic
929561613 2:42959888-42959910 CAGAAAAAAGAAAAGGCTGGGGG - Intergenic
929595896 2:43175633-43175655 CAGGGGCAAGAGAAGGATGGAGG + Intergenic
930301242 2:49618667-49618689 CAGGCAAAAGAGAAGGGATGGGG - Intergenic
930710973 2:54550947-54550969 AGGAGAAAAGAGAAAGGTGAGGG - Intronic
930882803 2:56291453-56291475 CAGAGAAAATAGCAGTGTGGGGG + Intronic
931174075 2:59835325-59835347 AAGAAAAAAGAGAAGGGGGAAGG - Intergenic
931853795 2:66280652-66280674 CAGAGAAATGAAAAGACTGGAGG - Intergenic
931936513 2:67203220-67203242 CAGAGCAGAGAGAAGGGTTTTGG + Intergenic
932182483 2:69660862-69660884 GAGAGATAATAGAAGGGAGGGGG + Intronic
932300570 2:70664070-70664092 CAGAGAAAGGAGAAGGCGTGAGG + Intronic
932358964 2:71089516-71089538 CAGAGAAAAGAGTAGAGTCACGG + Intergenic
932375998 2:71236284-71236306 CTAAGAAAAGAGAAGAATGGCGG + Intergenic
932578814 2:72980120-72980142 GAGAGAAGAGAGAAGAGGGGAGG - Intronic
933077583 2:77949164-77949186 AAGATAAAATAGAAGGGAGGAGG + Intergenic
933256392 2:80085826-80085848 GAGAAAAGAGAGAAGGGTGAGGG + Intronic
933704669 2:85280846-85280868 CCGAGCAAAGAGAAGGCTGCGGG + Intronic
933897129 2:86821831-86821853 CAGGGGGAAGAGAAGGGTGGAGG - Intronic
934518507 2:95004664-95004686 CAGAGAGAAGAGCAAGGAGGAGG + Intergenic
935143335 2:100375948-100375970 CACAGAAAAAAAAGGGGTGGGGG + Intergenic
935335709 2:102014028-102014050 CAAAAGAAAGAGAAGGGTGAGGG - Intronic
935635750 2:105248569-105248591 GAGAGGCAAGAGGAGGGTGGAGG + Intergenic
935712830 2:105914237-105914259 CAGGGAAATGAGCAGGGAGGCGG - Intergenic
935729272 2:106051661-106051683 CAGAGAGAAGAGAAAGCAGGTGG + Intergenic
937027450 2:118711265-118711287 CAGGGAGAAGAGGAGGTTGGTGG - Intergenic
937028793 2:118721014-118721036 CAGAAAAATGATGAGGGTGGAGG - Intergenic
937110583 2:119364063-119364085 CAGAGATAGGAGAAAGGGGGAGG + Intronic
938744014 2:134260011-134260033 CAGTGGAAAGAGAGAGGTGGAGG + Intronic
938773820 2:134523732-134523754 CAGAGAAACGGGAAGTGGGGAGG + Intronic
938848900 2:135239982-135240004 CAAAAAAAAAAAAAGGGTGGAGG + Intronic
938881893 2:135598827-135598849 CAAAGGAAAGAAAAGGATGGGGG - Intronic
938977571 2:136494542-136494564 CAGAGAAGAGGGATGGATGGGGG + Intergenic
939222369 2:139318929-139318951 TAGAATAAAGAGATGGGTGGGGG - Intergenic
939428250 2:142069055-142069077 CAGAGAAGGGAGAAGGGTGGAGG - Intronic
939441864 2:142260485-142260507 CACAGAGAAGAGAAAGGTGCTGG - Intergenic
940219383 2:151335847-151335869 CAGGGAAAGGAGAAGGGCGGTGG - Intergenic
940988414 2:160072923-160072945 CAGAGTACAGAGCAGAGTGGAGG + Intergenic
941959731 2:171241740-171241762 AAGAGAAAAAAGGAGGGTGAGGG - Intergenic
942320799 2:174734026-174734048 TACAGAAATGTGAAGGGTGGGGG - Intergenic
942398379 2:175576162-175576184 AAGAGAAGAGAGCAGGGAGGAGG - Intergenic
942546556 2:177070675-177070697 CAGACACAAGAGGAGGGTGGTGG - Intergenic
942650158 2:178158082-178158104 AATAGCAAAGAAAAGGGTGGTGG - Intergenic
942855501 2:180541741-180541763 CAAAGTAATGAGTAGGGTGGGGG - Intergenic
942919248 2:181351259-181351281 GGGAGAAAAGAGAAGTGTGGAGG - Intergenic
943035823 2:182744917-182744939 CACAGAGAAGAGAAGAGGGGGGG - Intronic
943498275 2:188652327-188652349 CTGAAAAAAGGGAAGTGTGGAGG - Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944184842 2:196936371-196936393 AAGAGATAAAAAAAGGGTGGGGG + Intergenic
944218464 2:197278755-197278777 GAGAGAAAGGAAAGGGGTGGTGG - Intronic
944256944 2:197632666-197632688 GTGAGAAAAGAGGAGGGTGGTGG + Intronic
944349406 2:198709188-198709210 GAGAGAAAAAAGAAGGGAGGAGG - Intergenic
944509633 2:200451812-200451834 AAGAAAAAAGAAAACGGTGGGGG - Intronic
944818918 2:203409137-203409159 CAGTGAAAAGAGAAGGTAGTTGG - Intronic
944962227 2:204888124-204888146 CAGGGAGGAGAGAAGGGTAGAGG + Intronic
945455657 2:210049301-210049323 GAGAGGAAAGAGAAGTGTGGTGG - Intronic
945554546 2:211262689-211262711 CAGAGAAAAGAGAGGAGAGAGGG - Intergenic
945641480 2:212436881-212436903 CAGAGACAAGAATAGGTTGGAGG + Intronic
945690532 2:213029195-213029217 CAGACAATAGAAAAGGGAGGAGG - Intronic
945986587 2:216359353-216359375 CAGAGAAAAGAGAAAAGAAGAGG - Intronic
946270118 2:218585059-218585081 AAGAGAAGAGAGAAGGGAAGAGG - Intronic
946621681 2:221570019-221570041 CAGAGAGAAGAGAATGGTTGCGG - Intronic
947139727 2:227009744-227009766 AAGAGAGAAGAGAAGAGGGGAGG + Intronic
947282497 2:228470931-228470953 GAGAGAATAGAGAAAGATGGGGG - Intergenic
947428887 2:230008234-230008256 CTGAGAGAAGAGAAGGGAGAAGG - Intronic
947518509 2:230827533-230827555 AAAAGAAAAGAGAAGGGGAGGGG - Intergenic
947651181 2:231787148-231787170 AAGGGAAAAGAGAAGGGGAGAGG - Intronic
947752082 2:232538449-232538471 GGGAGAAAACAGGAGGGTGGAGG + Intergenic
947776426 2:232714700-232714722 CACAGAAAACAGAACAGTGGTGG - Intronic
948233098 2:236366117-236366139 CAGGGAGAAGTGAAGGGTGGGGG - Intronic
1168942693 20:1726938-1726960 AAGAGAAAAGAAGAGGGAGGGGG + Intergenic
1168947267 20:1771750-1771772 CAGAGAAAAGGAAAGGGTTTTGG - Intergenic
1169267241 20:4174214-4174236 CAGAGACAAGAGAAGGGGCAAGG + Intronic
1170126722 20:12971840-12971862 CATAGAAGAGTGAATGGTGGAGG - Intergenic
1170274517 20:14569566-14569588 AAGAGAAAAAAAAAAGGTGGGGG - Intronic
1170394438 20:15910918-15910940 CAGAGCACAGAGATGGGTAGAGG - Intronic
1171030073 20:21669176-21669198 CAGAGAAAGGAGGGGTGTGGTGG - Intergenic
1171216396 20:23355752-23355774 CAGATAATAGAGAAGGGAAGGGG - Intergenic
1171293465 20:23995751-23995773 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1171896317 20:30813467-30813489 CAGAGAAAGGGAAAGGGTGAGGG + Intergenic
1172452586 20:35038028-35038050 CAGAGAAAAAAGCAGAATGGTGG + Intronic
1172705956 20:36882007-36882029 CAGAGAGCTGTGAAGGGTGGTGG + Intronic
1172766875 20:37355752-37355774 GAGAAAAAAAAGAAGGGTGAGGG + Intronic
1172878923 20:38184838-38184860 AAAAAAAAAGAAAAGGGTGGTGG + Intergenic
1173131233 20:40395616-40395638 GAGAGAAAACAGAAGATTGGAGG + Intergenic
1173507319 20:43598257-43598279 GACAGAAAATAGAAGGGTGGTGG + Intronic
1173575025 20:44107352-44107374 CAGGGAGAAGAGAAGGATGTGGG - Intergenic
1173823996 20:46035673-46035695 TAGAGAGAAGAGGAAGGTGGGGG + Intronic
1174543181 20:51305739-51305761 CAGAGATAACACAAAGGTGGGGG + Intergenic
1174555369 20:51391456-51391478 AAAAGAAAAGAGGAGGGGGGGGG + Intronic
1174670989 20:52307543-52307565 CAGAAAAAGCAGAAGGGTGGGGG - Intergenic
1175031339 20:55957559-55957581 GAGAAAGAGGAGAAGGGTGGGGG - Intergenic
1175490979 20:59381147-59381169 CAGGGAGCAGAGAAGGGTGAAGG - Intergenic
1175533808 20:59693286-59693308 CAAAGAGAAGAGAAGGGAGATGG - Intronic
1175862882 20:62159562-62159584 CAGAGGATAGAGATGGGGGGAGG - Intronic
1175974777 20:62705222-62705244 CTGAGGGAAGAGAAGGTTGGAGG + Intergenic
1175979971 20:62733765-62733787 CAGAGGAGAGAGAGGGGAGGAGG + Intronic
1176263589 20:64196770-64196792 CAGAGAATAGAGAGGGTTGCAGG - Intronic
1176383954 21:6127757-6127779 CAGAGAAGAGAGAGGGGGAGAGG + Intergenic
1177500626 21:21950062-21950084 CAGACAAAACAAAAAGGTGGAGG - Intergenic
1177890394 21:26797699-26797721 AAGAGAAAAAAAAAGGGCGGGGG - Intergenic
1178128784 21:29545963-29545985 AAGAGAAGAGAGAAGGGATGTGG - Intronic
1178452086 21:32711304-32711326 CAGAAAAAAGAAAAAGGTGGAGG - Intronic
1178477997 21:32954797-32954819 GAGAGAAAAAAAAAGGGAGGGGG - Intergenic
1178481084 21:32979589-32979611 AAGAGAAATGAAAAGGATGGAGG + Intergenic
1179046226 21:37847764-37847786 GAGAGAGGAGAGAAGGGAGGGGG + Intronic
1179253644 21:39696719-39696741 CAGAGAAACAAGAAGGGAGGAGG - Intergenic
1179285520 21:39974613-39974635 CACCTATAAGAGAAGGGTGGAGG - Intergenic
1179285533 21:39974687-39974709 CACCTATAAGAGAAGGGTGGAGG - Intergenic
1179285546 21:39974761-39974783 CACCTATAAGAGAAGGGTGGAGG - Intergenic
1179285559 21:39974835-39974857 CACCTATAAGAGAAGGGTGGAGG - Intergenic
1179285572 21:39974909-39974931 CACCTATAAGAGAAGGGTGGAGG - Intergenic
1179285585 21:39974983-39975005 CACCTATAAGAGAAGGGTGGAGG - Intergenic
1179285598 21:39975057-39975079 CACCTATAAGAGAAGGGTGGAGG - Intergenic
1179346626 21:40564470-40564492 TAGAGGAAGGAGGAGGGTGGTGG - Intronic
1179535273 21:42047429-42047451 CAGAGAAAGGACAAGAGTCGTGG - Intergenic
1179568933 21:42266620-42266642 CAGAGGACAGAGATGGGAGGAGG - Intronic
1179708225 21:43194668-43194690 CTGAGAAATGAGGAGGGGGGAGG - Intergenic
1179739520 21:43410481-43410503 CAGAGAAGAGAGAGGGGGAGAGG - Intergenic
1180237628 21:46473454-46473476 CAGGGAAAAAAAAAGGGGGGGGG + Intronic
1180261796 21:46675258-46675280 CAGAGGGAACAGAAGGTTGGAGG - Intergenic
1180638055 22:17276410-17276432 AAAAGAAAAGAGAAGAGGGGAGG + Intergenic
1180824521 22:18853467-18853489 CAAAGAAAACAGAAGCATGGAGG - Intronic
1181014880 22:20063170-20063192 AAGAGAAAAGAGAAGAGAAGAGG + Intronic
1181097746 22:20517508-20517530 CAGTGAAAAGAGCAGGGTGGTGG - Intronic
1181124943 22:20696622-20696644 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181188214 22:21121081-21121103 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181210982 22:21289412-21289434 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181333608 22:22113623-22113645 CCGATAAGAAAGAAGGGTGGGGG - Intergenic
1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181417409 22:22770677-22770699 CAGAGAAAAGGGCAGGGAGGTGG - Intronic
1181423474 22:22817967-22817989 CAGAGCAAAGGGCAGGGAGGGGG - Intronic
1181650897 22:24258584-24258606 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181706484 22:24652155-24652177 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1182050668 22:27310495-27310517 GAGAGAGAAGAGAAGGAGGGAGG + Intergenic
1182309737 22:29396074-29396096 AAGAGAAAAGAGAAGAGAAGAGG + Intronic
1182310581 22:29402800-29402822 CTGAGAAAAGTGCAGGGGGGCGG - Intronic
1182333827 22:29570065-29570087 TACAGAAAAGAACAGGGTGGAGG + Intronic
1182690469 22:32157946-32157968 CTGAGAAAAGTGCAGGGGGGCGG + Intronic
1182880011 22:33725108-33725130 AAGAGAAGACACAAGGGTGGGGG + Intronic
1182995955 22:34812641-34812663 CAGAAAGAAGAGAGAGGTGGGGG - Intergenic
1183123602 22:35752737-35752759 CAAAGGAAAGAAAAGGCTGGTGG - Intronic
1183216906 22:36486601-36486623 CAGAGATAGGAGAAGGGTCTGGG + Intergenic
1183464337 22:37972108-37972130 AAGAGAGGAGAGAAGGGAGGGGG + Intronic
1183467267 22:37986023-37986045 CACAGGGAAGAGAAGGGAGGCGG - Intronic
1183912278 22:41088901-41088923 CAAAGAAATGAGAAATGTGGAGG - Intergenic
1184291150 22:43498773-43498795 CAGAGAGGAGAGATGGGAGGTGG - Intronic
1184986439 22:48139359-48139381 CATAGAGAAGAGAGGGGTTGGGG - Intergenic
1184987885 22:48147762-48147784 CAGAAAAAAGAGAATGGAGCTGG - Intergenic
1203215964 22_KI270731v1_random:6018-6040 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1203239170 22_KI270732v1_random:38858-38880 AAGAGAAAAGAGATGAATGGTGG + Intergenic
1203274659 22_KI270734v1_random:79372-79394 CAAAGAAAACAGAAGCATGGAGG - Intergenic
949121258 3:387323-387345 CAGAGGGAAGGGAAGGCTGGTGG + Intronic
949396615 3:3621311-3621333 CAGAGGATAGAGAAGGCTGGAGG - Intergenic
949449131 3:4166106-4166128 AAGAGGAAAGACAAGGGTGCAGG - Intronic
949482820 3:4510199-4510221 CAGGGAACAGAGCATGGTGGGGG + Intronic
950475765 3:13214025-13214047 CAGAGGAAGGAGCCGGGTGGCGG - Intergenic
951486340 3:23215701-23215723 AACAGCAAAGAGAAGGGTGGTGG - Intronic
951955666 3:28250539-28250561 CAGAAAGAAGAAAAGGGTGGTGG - Intronic
953014190 3:39056974-39056996 CTGAGAAAATAAAGGGGTGGGGG + Intronic
953380975 3:42472894-42472916 GGGGGAAAAGAGAAGGGAGGTGG - Intergenic
953412799 3:42699703-42699725 CAGAGAGCAGAGAAGGGTTCGGG + Intronic
953536868 3:43783279-43783301 GAGAGAAAAGAGAGGTATGGGGG - Intergenic
953583847 3:44181701-44181723 CACAGGAAAGAGAAGGCAGGGGG + Intergenic
953606934 3:44418479-44418501 CAGAGATGAGGGAAGGGTGAGGG - Intergenic
953822656 3:46221889-46221911 CAGAGCTAAGTGAGGGGTGGCGG - Intronic
953850483 3:46462785-46462807 CTGAGAACAGAGAAGGGGGCAGG + Intronic
954689037 3:52386112-52386134 CAGAGAAGAGAAAAGGGGGGAGG + Intronic
954759154 3:52861538-52861560 CACAAAAAAGAGGAAGGTGGGGG + Intronic
954954274 3:54505457-54505479 CAAAGTAAAGAGTAGGGTAGAGG - Intronic
955029579 3:55203352-55203374 CAGAGAAGAGGGAAGGGGAGAGG + Intergenic
955075558 3:55609894-55609916 CAGGGCAAAGTGCAGGGTGGAGG - Intronic
955088078 3:55722197-55722219 CAGAGATAAGAGAATGGGGTTGG + Intronic
955251121 3:57283440-57283462 CTGGGAAATGAGAAGTGTGGTGG + Intronic
955892031 3:63660427-63660449 CAGAGAACAGACTAGGGTTGGGG + Intronic
956135936 3:66098994-66099016 CAGAGAGAAGGGAAGGGAAGGGG - Intergenic
956423082 3:69104831-69104853 CAGACACAATAGGAGGGTGGTGG - Exonic
956599817 3:71008897-71008919 CAGAAAAAAGAGAGGTGGGGGGG - Intronic
957155429 3:76538296-76538318 CGTAGAAAAGAGAAGGGAGAGGG - Intronic
958117167 3:89234980-89235002 AAGAGAAAAAAGAAAGGAGGAGG - Intronic
958271819 3:91509152-91509174 GAGAGACAAGAAAAGGGTGAAGG - Intergenic
958884270 3:99708528-99708550 CAGAGATCAAAGAAGGGCGGAGG - Intronic
958941473 3:100320122-100320144 AAGAGAAAAGGGAAGCGAGGGGG - Intronic
958990883 3:100843436-100843458 GACAGAAGAGAGAAGGGAGGAGG + Intronic
959131747 3:102364555-102364577 GAAAGACAAGAGAAGGGTAGAGG + Intronic
959390326 3:105764529-105764551 GAGAGAAAAGAGAACAGTGTTGG - Intronic
959695184 3:109241534-109241556 CAGGGGAAGAAGAAGGGTGGGGG + Intergenic
959821728 3:110743180-110743202 CAGTTAAAAGAGAAAGGTGATGG + Intergenic
960538758 3:118842377-118842399 CAGAAAAAAGAAAAGGGGAGGGG + Intergenic
961100737 3:124196416-124196438 AAGAGAGAAGGGCAGGGTGGAGG + Intronic
961564607 3:127754570-127754592 CAGAGAGGAGAGAGGGCTGGCGG + Intronic
961616320 3:128184368-128184390 CAGAGAGAATAGAATGGCGGTGG - Intronic
962162602 3:133014578-133014600 CAGAGCAGAGGCAAGGGTGGTGG - Intergenic
962681162 3:137801792-137801814 GAGAGAAGAGAGAAAGGTCGGGG - Intergenic
962731478 3:138287447-138287469 TAGAGAAAATTGGAGGGTGGAGG - Intronic
962768612 3:138592123-138592145 GAGAGAGAAGAGAAGGGAAGAGG - Intronic
962862680 3:139419143-139419165 GAGAGGAGAGAGAAGAGTGGAGG - Intergenic
962932443 3:140050750-140050772 CACAGAAGAGAGAAGGGTAGTGG + Intronic
963073315 3:141323019-141323041 CAGACAAAACAGAAGGGTACAGG - Intergenic
963204263 3:142616327-142616349 TAGAGAAAAAAGAATGATGGAGG + Intronic
963240165 3:142995101-142995123 TGGAGAAGAGATAAGGGTGGAGG + Intronic
963833662 3:150034842-150034864 CAGGGGAAAGCTAAGGGTGGGGG + Intronic
964450506 3:156808183-156808205 CAAAAAAAAGAGAAGGGAAGGGG + Intergenic
964558165 3:157963962-157963984 CAGAAAAAAAAAAAGGGGGGCGG + Intergenic
964564319 3:158033115-158033137 AAGAAGAAAAAGAAGGGTGGGGG + Intergenic
964698173 3:159533627-159533649 CAGAGAACAGAGATGTGGGGGGG - Intronic
965247624 3:166294326-166294348 CAGAAAAAAGAAAATGGTGATGG + Intergenic
965333839 3:167410524-167410546 CAGAGAGAAGACATGGCTGGAGG + Intergenic
965565436 3:170111467-170111489 AGAAGAAAAAAGAAGGGTGGGGG + Intronic
965762764 3:172097218-172097240 CAGCTAAAAAAGAGGGGTGGGGG - Intronic
966016546 3:175146284-175146306 CAGAAAAAAGAGAAGGACTGTGG + Intronic
966033841 3:175385451-175385473 CAAAGAACCTAGAAGGGTGGAGG - Intronic
966055782 3:175687828-175687850 CAGAAACAAGAGAAAGGTGGGGG - Intronic
966374948 3:179286852-179286874 CAGAGAAATGAGAAAGTTGGGGG + Intergenic
966774731 3:183533839-183533861 GAGGGAAAAGAGAAGAGGGGAGG - Intronic
966879036 3:184339259-184339281 CAGAGAAAAGAAGAGGCTGTCGG + Intronic
967274057 3:187756602-187756624 GAGAGAAGAGAGAAGGGGAGGGG + Intergenic
967407883 3:189137758-189137780 CAGAGACACGAGAAGGGGGAAGG - Intronic
967574767 3:191077058-191077080 CATAGAATACAGATGGGTGGGGG - Intergenic
967818193 3:193816551-193816573 AAAAGAAAAGAAAAGGGTGTTGG + Intergenic
967909313 3:194528054-194528076 CAAAAGAAAGAGAAGGGCGGGGG - Intergenic
968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG + Intergenic
968274339 3:197428385-197428407 CTGAGCAAGGAGAAGGGCGGTGG + Intergenic
968810206 4:2796348-2796370 GGGAGAAGAGAGAAGGTTGGGGG - Intronic
969118754 4:4891255-4891277 TAGTGAAATGAGAAGGGTGTGGG + Intergenic
969198756 4:5584887-5584909 CAGTGAGTAGAGGAGGGTGGAGG + Intronic
969199308 4:5589971-5589993 TAGAGAAAAGAGAAGGTGGAGGG + Intronic
969296478 4:6273132-6273154 CAGAGAGAACAGAATGGGGGTGG + Intronic
969321829 4:6417226-6417248 AAGAGAAAAGGGAAGGGTCCAGG + Intronic
969349665 4:6591150-6591172 CAAAAAAAAAAGAAGGCTGGAGG + Intronic
969728820 4:8941213-8941235 AAGAGGAAAGAGATGGGTGATGG - Intergenic
969948061 4:10805223-10805245 CAGACAGAACAGAAAGGTGGAGG + Intergenic
970005878 4:11410306-11410328 CAGAGGAAAGAGATGGGAGCTGG + Intronic
970079628 4:12265671-12265693 AAAAGAAAAGAGAAGGGGAGGGG + Intergenic
971013110 4:22460752-22460774 CTGAGAAATTAGAAGGGTAGAGG + Intronic
971307546 4:25496794-25496816 ATGAGAAAGGGGAAGGGTGGGGG - Intergenic
972065005 4:34931123-34931145 TAGAGAAAAGAGTAGAATGGTGG + Intergenic
972640245 4:40918737-40918759 CAGAGAAAAAATAAGGAAGGAGG - Intronic
972663629 4:41142714-41142736 CAGAGAAGAGAGAAGGACGTTGG - Intronic
972894087 4:43597540-43597562 AAGAAAATAAAGAAGGGTGGAGG - Intergenic
972913972 4:43853140-43853162 CAGAGACAATAGAAGTGTGTGGG + Intergenic
973110115 4:46388898-46388920 AACAGAAAGGAAAAGGGTGGGGG - Intronic
974002076 4:56521965-56521987 AAAAGAAAAGAGAGGAGTGGAGG - Intronic
974229113 4:59086588-59086610 CTGCGGAAAGAGAAGGATGGAGG + Intergenic
974483016 4:62470349-62470371 CTGAAAAAAGAGAAGGGAAGGGG - Intergenic
975245578 4:72117073-72117095 AAGGAAAAAGAAAAGGGTGGGGG - Intronic
975507897 4:75159664-75159686 GAGAGAGAAGAGGAGAGTGGGGG + Intergenic
975659403 4:76673534-76673556 GAGAAAAAAGCCAAGGGTGGAGG + Intronic
976302076 4:83524832-83524854 ACGAGAACCGAGAAGGGTGGAGG + Intergenic
976331307 4:83833786-83833808 TAGAGAAAGGAGCGGGGTGGCGG + Intergenic
976352065 4:84070867-84070889 GAGAGAAAAGAAAAGGATGCTGG + Intergenic
976717138 4:88135192-88135214 CAGGGATGATAGAAGGGTGGAGG - Intronic
976944463 4:90747480-90747502 CAGAGAAAAAAAAAGAGAGGTGG + Intronic
977174183 4:93798951-93798973 CAGAGAAAAAAGCAGGGGGTAGG + Intergenic
977705383 4:100064887-100064909 CAGAGAGAAGGGAAGGAGGGAGG - Intergenic
977745174 4:100538475-100538497 CAGAGAAATGAGCAGGAGGGTGG + Intronic
977783216 4:101003814-101003836 CAAAGAAAAATGAAGAGTGGAGG - Intergenic
977914721 4:102578592-102578614 GAGAGGAAAGGGAAAGGTGGGGG + Intronic
977924722 4:102687042-102687064 CAGAAAGAAGAGAAGGTTTGGGG - Intronic
978013630 4:103718667-103718689 GACAGAAGAGGGAAGGGTGGAGG + Intronic
978367217 4:107995045-107995067 CAGATAAGAGAGAAGGGAGAGGG - Intronic
978486987 4:109265948-109265970 CTGAGAAAAGAGAAGGGCTATGG - Intronic
978685851 4:111442290-111442312 CAGAGAATAGGAAGGGGTGGGGG - Intergenic
978752011 4:112260288-112260310 CTGAGAAAAGGGAAGGATGAAGG + Intronic
979247453 4:118525167-118525189 TGGAGAAAAAAGGAGGGTGGTGG + Intergenic
979512088 4:121566475-121566497 AAGTAAAAAGAGAAAGGTGGAGG + Intergenic
979778906 4:124624807-124624829 ATGAGAGAAGAGAAGGGAGGAGG - Intergenic
980255786 4:130379458-130379480 CAGAGGAAACATCAGGGTGGGGG + Intergenic
980289230 4:130824359-130824381 TAGAGAAAAGAGAGGGAGGGAGG - Intergenic
980402755 4:132313877-132313899 CAGATAAAATAAAAAGGTGGAGG - Intergenic
981500567 4:145447111-145447133 AAGAGAAAAGAGGAGGGAAGCGG + Intergenic
981579744 4:146239459-146239481 GAGAGGAAAGAGATGGGTGGAGG - Intergenic
981696441 4:147563875-147563897 CAGAGGATAGAGTTGGGTGGGGG - Intergenic
982134390 4:152259437-152259459 CAGAGGAAGGAGAGGGGTGCAGG - Intergenic
982753163 4:159187297-159187319 CAGAGAAAAAAAAGGGGAGGAGG - Intronic
983801944 4:171942290-171942312 CAGAGAAAAATGAGGGGAGGAGG + Intronic
983813101 4:172088806-172088828 CAGAGATAACAGCAGGGTAGGGG + Intronic
984272750 4:177567661-177567683 CAGAGAAGAGAGATGGCTGGAGG + Intergenic
984473201 4:180203482-180203504 CTGAGAAAAGAGTAGGAGGGAGG + Intergenic
984542694 4:181060358-181060380 CAGAGGGAAGAAAAGGATGGGGG - Intergenic
984617560 4:181915701-181915723 GAGAGAAAAGAGGAGGGGAGAGG + Intergenic
984631458 4:182065486-182065508 GAGAGCAAAGATAAGGGAGGAGG + Intergenic
984786171 4:183569308-183569330 AGGAGAGAAGAGAAAGGTGGAGG - Intergenic
984789324 4:183600448-183600470 CAGAGAAAAGGGAATGGAGATGG + Intergenic
985236415 4:187880284-187880306 GAGAGAGAGGAGAAGGGTTGGGG + Intergenic
985346625 4:189012168-189012190 GGGAGAAAATATAAGGGTGGCGG + Intergenic
986283831 5:6345593-6345615 CAGAGAACAGAGGAGGAGGGAGG + Intergenic
986922717 5:12707329-12707351 AAGAGAAACAAGAATGGTGGTGG - Intergenic
987112311 5:14699833-14699855 CAGACAAAAGGCAAGGGTAGGGG - Intergenic
987216909 5:15747102-15747124 CAGAAAGATGAGAAGGGAGGTGG + Intronic
987490768 5:18578047-18578069 GAGAGAAAAGAGAAGGTAGTAGG + Intergenic
988001204 5:25351467-25351489 AAGACAAAAGAGAAGACTGGAGG + Intergenic
988276347 5:29085585-29085607 CAGAGGAAATAGGAGGGAGGGGG + Intergenic
988455950 5:31387421-31387443 CGGAGAAAACAGGAGGATGGAGG + Intergenic
988487993 5:31682839-31682861 CAGGGGAAAGGGAGGGGTGGAGG - Intronic
988926110 5:35992403-35992425 AAGGGGAAAGAGAAGTGTGGAGG + Intergenic
988927978 5:36008359-36008381 CAGAGAAAAAGGAAGGCAGGGGG + Intergenic
989085674 5:37673589-37673611 GAAAGAAAAAAAAAGGGTGGGGG - Intronic
989168165 5:38450575-38450597 CAGAGAAAAGAGGAAGGCTGAGG - Intronic
990154236 5:52856606-52856628 CAGAGGAGGTAGAAGGGTGGTGG - Intronic
990184829 5:53201583-53201605 AAGATAAAAGAGGAGGCTGGCGG - Intergenic
990332227 5:54739512-54739534 CAGTGGAGAGAGATGGGTGGAGG - Intergenic
990367074 5:55082038-55082060 CAGAAAAAAAAAAAGGGGGGGGG - Intergenic
990489302 5:56288372-56288394 CAGAGGCAAGAGAAAGGTGTGGG + Intergenic
990609572 5:57443963-57443985 CAGAGATAAGAGCAGGCTGAGGG - Intergenic
990673520 5:58159130-58159152 CAGTAAACAGTGAAGGGTGGTGG + Intergenic
990830504 5:59951928-59951950 CAGAGAAAGGAGAAGTGAGGAGG - Intronic
991001989 5:61792128-61792150 CAGAAAAAAGAGATGAGTGCTGG + Intergenic
991541333 5:67732580-67732602 TAGAGAACAGAGGAGGGTGGAGG + Intergenic
992426338 5:76661897-76661919 CAGAGCAAGGGGAAAGGTGGTGG + Intronic
992644314 5:78797848-78797870 CTGAGAAAAGAACAGGGAGGAGG + Intronic
992912670 5:81412608-81412630 CAGATAAATGAGAATGGAGGAGG - Intergenic
993453531 5:88101106-88101128 CAGAGGAGAGAAAAGGGTGGGGG - Intergenic
993456555 5:88133657-88133679 GAGAGAAAAGAGAAGAGGAGAGG + Intergenic
993761492 5:91801677-91801699 CAGAGTGAAGGGCAGGGTGGGGG + Intergenic
993864513 5:93176257-93176279 CAGAGTAGACAGAAGGGTTGGGG - Intergenic
995013823 5:107288061-107288083 CAAAGGAAGGAGAAGGGTTGTGG - Intergenic
995308315 5:110680971-110680993 GAGGGAAAAGAGAAGGGTGAGGG + Intronic
995374765 5:111461675-111461697 GGGAGAAGAGTGAAGGGTGGAGG - Intronic
996029165 5:118685578-118685600 CACATCATAGAGAAGGGTGGGGG - Intergenic
996052206 5:118947547-118947569 CAGAGAGAAGAGAAGGGGAGAGG - Intronic
996361742 5:122655842-122655864 CAAAGAGAAGGGAGGGGTGGGGG - Intergenic
996382898 5:122880075-122880097 CAAAGTAAACAGAAGGTTGGAGG - Intronic
996393241 5:122986480-122986502 CAGAAAAAAGAGAAGTGGGAGGG + Intronic
996905199 5:128591510-128591532 CAGAGAAAATAGTGAGGTGGAGG + Intronic
997253249 5:132407620-132407642 AAGAGAAGAGGGAAGGATGGAGG + Intergenic
998064877 5:139149958-139149980 GAGAGATAAGAGAAGGGAGAAGG + Intronic
998103649 5:139454929-139454951 CAGAGAAAAGAATGGGGTGAAGG + Intronic
998382020 5:141732379-141732401 CAGAGAAGAGAGAGGGGAGAAGG - Intergenic
998574315 5:143297093-143297115 AAAAGAAAAGAAAAAGGTGGAGG + Intronic
998771935 5:145555747-145555769 CAAGAAAAAGAGAAGGATGGAGG + Intronic
998845240 5:146302328-146302350 CAGAAAAAAGTCAGGGGTGGGGG - Intronic
999881179 5:155866213-155866235 TAGAGAAAAGAGATGGAGGGAGG - Intergenic
1000030184 5:157394742-157394764 CAGGGAAGAGAGAAGGGAGGAGG + Intronic
1000905762 5:166963895-166963917 GAGAGAGAAGAGAAAGGCGGGGG + Intergenic
1001108495 5:168875790-168875812 GAAGGGAAAGAGAAGGGTGGAGG + Intronic
1001666259 5:173435891-173435913 CAGAGCAAAAAAGAGGGTGGAGG - Intergenic
1001867471 5:175117754-175117776 CAGACATTAGAGAATGGTGGGGG - Intergenic
1001909534 5:175504043-175504065 GAAAGAAAAGAGGGGGGTGGGGG + Intronic
1002301613 5:178260492-178260514 CAGTGAAAAGAGATCAGTGGTGG + Intronic
1002606236 5:180384691-180384713 AAAAGAAAAGAAAAGAGTGGAGG + Intergenic
1002939792 6:1705896-1705918 CACAGCAATGAGAAGGGTGGCGG + Intronic
1003123768 6:3339052-3339074 CAGAGGGAAGAGCAGGGTCGAGG + Intronic
1003218728 6:4137468-4137490 CACAGAAAAGAGTGGGGTGTGGG + Intergenic
1003850991 6:10222402-10222424 GAGAGTAAAGGGCAGGGTGGAGG - Intergenic
1004128613 6:12898238-12898260 CAGAGAAGAGAAAATGGTAGAGG - Intronic
1004761428 6:18670868-18670890 AAGAGAAGAGAGAAGGGGAGGGG - Intergenic
1004893164 6:20121443-20121465 CAAAGAAAAGGGAAGCATGGGGG + Intronic
1004955659 6:20725129-20725151 GAGAGAAAAGAAAAAGGCGGGGG - Intronic
1005178404 6:23074579-23074601 CATAGCAGAGAGAAGTGTGGAGG + Intergenic
1005436845 6:25821228-25821250 GAGAGAAAAAAGAAGAATGGAGG - Intronic
1005534784 6:26744415-26744437 CAGAGAAAGAAGGAGAGTGGTGG + Intergenic
1005631597 6:27713276-27713298 CAGAGAAAAGTGAAGACGGGTGG + Intergenic
1005755581 6:28922989-28923011 CAGAGAAAAGAGAGTGGGGGTGG + Intronic
1006183993 6:32170105-32170127 CAGAGATGAGGGAATGGTGGGGG + Intronic
1006241345 6:32682007-32682029 CAAAGAGAAAAGAAGAGTGGGGG + Intergenic
1006303684 6:33207166-33207188 CAGAGAAAGGAGAGGGGTGGGGG - Intergenic
1006489950 6:34378750-34378772 CAGAGAAGAGAGCTAGGTGGAGG + Intronic
1006714627 6:36108696-36108718 CAGAAAGAAGAGCAAGGTGGAGG - Exonic
1006945045 6:37779306-37779328 GAGGGAAAAGGGTAGGGTGGAGG + Intergenic
1006985250 6:38171907-38171929 TAATGAAAAGTGAAGGGTGGGGG + Exonic
1007017878 6:38487696-38487718 AAAAGAAAAAAGAAAGGTGGAGG + Intronic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1007260279 6:40558545-40558567 AAGAGCAGAGAGAAGGCTGGAGG + Intronic
1007261622 6:40568056-40568078 GAGAGAGAAGAGAAGGAAGGGGG - Intronic
1007285001 6:40741258-40741280 CAGAGTTCAGAGAAGGCTGGAGG - Intergenic
1007403850 6:41621242-41621264 CAGAGAGAAAATGAGGGTGGGGG - Intergenic
1007642391 6:43352510-43352532 AATAGAAAAGAGAATGTTGGAGG - Intronic
1007944864 6:45817226-45817248 GAGAGAAGAGAGGAAGGTGGGGG + Intergenic
1007950594 6:45868730-45868752 CAGATAAAGGAGTAGGGTGTGGG + Intergenic
1008265886 6:49425790-49425812 CAGAGAAAAAAGTAGAATGGTGG - Intergenic
1008591416 6:52997069-52997091 CAGATCAAAGGGAAGGGAGGAGG + Intergenic
1008690259 6:53971073-53971095 CAATGTAAAGAGAAGGGAGGGGG + Intronic
1008966024 6:57313632-57313654 CAGTGAAATGGGGAGGGTGGAGG + Intergenic
1008971103 6:57369168-57369190 CACAGTAAATAGAAGGGTAGTGG - Intronic
1008983296 6:57511982-57512004 GAGAGACAAGAAAAGGGTGAAGG + Intronic
1009171355 6:60404849-60404871 GAGAGACAAGAAAAGGGTGAAGG + Intergenic
1009195930 6:60684371-60684393 AAGAGAAGAGAGAAGGAGGGAGG + Intergenic
1009423707 6:63491147-63491169 CATAGAGAAGAGAAAGGTGCTGG - Intergenic
1009448521 6:63773342-63773364 GAGAGAAAAGCAAAGGGAGGAGG + Intronic
1009470153 6:64022847-64022869 AAGAACAAAGAGAAGGTTGGCGG - Intronic
1010004525 6:70981105-70981127 CAGAGAGGAGAGGAGGGTAGCGG + Intergenic
1010631101 6:78199376-78199398 CAGAGAGGAAACAAGGGTGGGGG - Intergenic
1010720861 6:79281988-79282010 CAAAGAATCTAGAAGGGTGGAGG - Intergenic
1011232479 6:85178498-85178520 CTCAGAAAAGAGAGGGGTGGGGG - Intergenic
1011355345 6:86467620-86467642 CAAAGAATCTAGAAGGGTGGAGG - Intergenic
1011532863 6:88343183-88343205 CAGGGAAAAGATATGAGTGGGGG + Intergenic
1011540846 6:88426729-88426751 CAGAAACAAAAGTAGGGTGGTGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012362311 6:98397801-98397823 AAGAGAAAAAAAAAGGGGGGGGG - Intergenic
1012531533 6:100243896-100243918 CAGGAGAAAGAGAAGGGTAGGGG - Intergenic
1012621101 6:101344875-101344897 AAGATAAAAGGAAAGGGTGGAGG + Intergenic
1012626369 6:101408390-101408412 GAGAGAGAAGAGGAGGGTGTGGG + Intronic
1012931957 6:105326785-105326807 CAGAGAAAAGAGAAAAATGGAGG + Intronic
1012961344 6:105625317-105625339 AAGAGAAAAGGGAAGGGGGGGGG + Intergenic
1012971667 6:105738084-105738106 CAGAGTAGAGACAAGGGGGGTGG - Intergenic
1013348236 6:109282957-109282979 AAGAGAAAAGAGAAGAGGGGAGG - Intergenic
1013484741 6:110585929-110585951 AAGAGAAAAGAGAGAGGAGGAGG - Intergenic
1013604551 6:111735636-111735658 GGGAGAAAAGAGAAGCATGGGGG + Intronic
1013956727 6:115850899-115850921 CAGAGAAGAGAGAAGAGAGTAGG + Intergenic
1014020715 6:116585498-116585520 CAGAGTAGAGAGTAGGGAGGGGG + Intronic
1014321697 6:119937613-119937635 CAGAGAAAAGGGAATGCTGGTGG - Intergenic
1014429742 6:121353948-121353970 CAGAGAGAAGAGAAGCTTTGGGG + Intergenic
1014810821 6:125883677-125883699 TAGGGGAAAGAGAAGGATGGGGG - Intronic
1015041687 6:128728158-128728180 CAGAGAAAAGAGGAGAGAGATGG - Intergenic
1015465415 6:133543345-133543367 CAGAGAACAGAGGGAGGTGGTGG + Intergenic
1015536544 6:134272627-134272649 AAGAGAGAAGAGTTGGGTGGTGG - Intronic
1016370310 6:143366636-143366658 CAGAAATAAGAGAATGTTGGAGG - Intergenic
1016386550 6:143536251-143536273 CAAAGAACCTAGAAGGGTGGAGG + Intergenic
1017786808 6:157763252-157763274 CAGGGAAAAGGGGAGGGCGGCGG + Intronic
1018581796 6:165314287-165314309 AAGAGAAAAAAGCAAGGTGGAGG - Intergenic
1018582732 6:165321468-165321490 CAGAGAAAAGAGAAGGCAACTGG + Intergenic
1018719269 6:166560623-166560645 CAGAAAAAAGAGAAATGGGGTGG + Intronic
1018788281 6:167126041-167126063 CATTTAAAAGAGTAGGGTGGTGG + Intronic
1019026267 6:168966125-168966147 CAGAGAAAAGAGGAGAGGGGAGG - Intergenic
1019124103 6:169827786-169827808 GAGAATAAAGAGAAGGATGGAGG - Intergenic
1019144167 6:169966279-169966301 CAGAGCTCAGAGAAAGGTGGAGG - Intergenic
1019772998 7:2895484-2895506 CTGAAAAATGAGAGGGGTGGGGG - Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019908944 7:4086621-4086643 CAGAGAGATGAGAAGGAAGGAGG - Intronic
1020080034 7:5282229-5282251 GGGAGAAAAGAGGAGGATGGAGG + Intronic
1020339755 7:7097122-7097144 AAGAAAAAAGAGAAGGTTGGAGG + Intergenic
1020963012 7:14829471-14829493 CAGGGAAACTAGAAGGGAGGAGG + Intronic
1021583639 7:22184238-22184260 CACAGAATAAACAAGGGTGGAGG + Intronic
1021584546 7:22193789-22193811 GAGAGAAAAGAGAGGGAGGGAGG + Intronic
1021814646 7:24435394-24435416 GGCAGAAAAGAGAATGGTGGAGG + Intergenic
1022029175 7:26476658-26476680 AAGAGAAAAAAAAAGGGGGGAGG - Intergenic
1022090911 7:27107858-27107880 CAAAGAAAAAAGGTGGGTGGGGG + Exonic
1022315396 7:29240693-29240715 CAGACCAAAGATGAGGGTGGGGG + Intronic
1022508545 7:30921520-30921542 CAGAGGAGAAAGAGGGGTGGAGG + Intronic
1022624414 7:32019935-32019957 CAGGGAAAAGAGCAAGCTGGAGG + Intronic
1022715755 7:32896530-32896552 AAGAAGAAAGAGAAGGCTGGAGG + Intergenic
1023305827 7:38825898-38825920 CAGAGAAATGAGGACGGAGGTGG + Intronic
1023308498 7:38856601-38856623 CAGAGAAAAGAGAAAGGGTGGGG + Intronic
1023556597 7:41429923-41429945 CCGAGAAAAGAGAAGCGTTGGGG + Intergenic
1023612293 7:41983260-41983282 CAGAGAAAAGAAAAGGCAGTAGG + Intronic
1023654546 7:42406648-42406670 GAGAGAAAAGAGAGAGGGGGCGG - Intergenic
1023809665 7:43902099-43902121 GACAGAACAGAGAAGGGAGGAGG + Intronic
1024389642 7:48793594-48793616 AAGGGAAAAAAGAAGTGTGGAGG + Intergenic
1024438789 7:49390422-49390444 AAGAGAAAAGGGAATGTTGGTGG - Intergenic
1024742533 7:52370630-52370652 GTGAGAAAAGGGAAGGGTGAAGG + Intergenic
1024763828 7:52632274-52632296 CAGACAGAAGAAAAAGGTGGGGG + Intergenic
1024869428 7:53945151-53945173 AAGAAAAAAAAAAAGGGTGGGGG - Intergenic
1025035270 7:55589713-55589735 CACAGAAAAGAGAAGGGTGAGGG - Intergenic
1025198882 7:56949987-56950009 GGGAGAAAAGAGGAGGATGGAGG - Intergenic
1025673064 7:63626946-63626968 GGGAGAAAAGAGGAGGATGGAGG + Intergenic
1026097647 7:67359183-67359205 CAGGGGAAAGAGAAGGGCTGGGG - Intergenic
1026378529 7:69775943-69775965 CAGAGAAAGAAGTGGGGTGGGGG - Intronic
1026518756 7:71096522-71096544 AAGAACAAAGAGAAGGTTGGAGG + Intergenic
1026544063 7:71306412-71306434 CAGAGAAAGAAGAATAGTGGGGG - Intronic
1027233777 7:76286287-76286309 CAGTGATAAGAGAGGAGTGGAGG - Exonic
1027633305 7:80636164-80636186 CAGAGAACGGAGAGGGGAGGAGG + Intronic
1027948644 7:84783582-84783604 CAAAGAAAAGAGAAAGGAGGTGG + Intergenic
1028157383 7:87446963-87446985 CAAAGAAAAGAGAAGGTAGATGG + Intronic
1028544735 7:91985646-91985668 CACAGAAAAAAGAAAGGGGGTGG - Intronic
1028791069 7:94853586-94853608 CAGGGAGAAGAGAAGGATGGGGG - Intergenic
1029503873 7:100950370-100950392 CAGAGAAAAGAGAAGTATAGAGG - Intronic
1029532424 7:101134164-101134186 CAGAGAAATGAGGGAGGTGGGGG + Intronic
1029884951 7:103858958-103858980 CAGAGAAAGAAGAAGACTGGAGG + Intronic
1030665944 7:112278698-112278720 GAGAGAAAAGTCAAGGCTGGAGG - Intronic
1030741369 7:113113804-113113826 CCGAAAAAAAAAAAGGGTGGGGG + Intergenic
1030819615 7:114080059-114080081 CAGAGAGAAGAAAAAGGAGGAGG + Intergenic
1031250944 7:119379698-119379720 AAGAGAAAAGAGAAAGATTGTGG - Intergenic
1031528872 7:122852855-122852877 TAGAGAACAGATAAGGGTTGGGG + Intronic
1031608585 7:123798301-123798323 CTGAGCAAGTAGAAGGGTGGAGG - Intergenic
1031743337 7:125462760-125462782 AAAAGAAAAGAGGAGGGGGGAGG - Intergenic
1031978460 7:128108305-128108327 CAGGGCAGAGAGCAGGGTGGAGG + Intergenic
1032166303 7:129547733-129547755 CAGAGGAAACAAAAAGGTGGAGG - Intergenic
1032479757 7:132236854-132236876 GAGAGAAAGGAGAAGGCTGGGGG - Intronic
1032605463 7:133346137-133346159 CAGAGATAAGACATGAGTGGAGG + Intronic
1032622737 7:133553871-133553893 CAAAGAATAGACATGGGTGGAGG - Intronic
1032676279 7:134132743-134132765 CTGAGGAAAGAGAAGGGTGTGGG + Intronic
1032975825 7:137221511-137221533 GAGAGAGAAGAGAAGGGGAGGGG + Intergenic
1033152153 7:138924882-138924904 CAGAGAAAGGAAAGGGGTTGGGG + Intronic
1033502381 7:141965259-141965281 CATTCAAAAGAAAAGGGTGGGGG - Intronic
1033551488 7:142451871-142451893 GAGAGAAAACATGAGGGTGGGGG - Intergenic
1033993864 7:147321168-147321190 CAGAGAGAAGAAAAGGAGGGAGG - Intronic
1034054982 7:148024829-148024851 CAAAGAAAGGAGAAGGCAGGGGG - Intronic
1034395773 7:150824083-150824105 AAGAACAAAGAGAAGGCTGGAGG - Intergenic
1034457233 7:151177437-151177459 CAGAGAGGAGAGCAGGATGGTGG - Intronic
1034563482 7:151896112-151896134 CAGTGAAAAGTGGGGGGTGGGGG - Intergenic
1034849723 7:154482239-154482261 CAGAGATAAGATCAGAGTGGAGG + Intronic
1035004447 7:155644769-155644791 CGGAGGACAGAGAAGGGAGGGGG - Exonic
1035088122 7:156278935-156278957 CAGAGGAATGGGAAGGGTTGAGG + Intergenic
1035113040 7:156500490-156500512 CAGACAACAGAGAATTGTGGCGG + Intergenic
1035229824 7:157458292-157458314 CAGAGAAAGGAGGAGAGCGGTGG + Intergenic
1035741359 8:1930598-1930620 CAGAGCAGAGAGAACGGGGGTGG - Intronic
1037835218 8:22211567-22211589 CAGAGAAAAGAGATGGGGTAAGG - Intronic
1037933108 8:22895710-22895732 AAGAGAGAAAAGAAGGCTGGGGG - Intronic
1038020747 8:23550337-23550359 CAGAGAAACGTGAAGGAGGGCGG - Intronic
1038117692 8:24576229-24576251 CAGGGTAAAGGGAAGGGTAGTGG - Intergenic
1038404604 8:27311820-27311842 GAGAAACAAGAGAGGGGTGGCGG + Intronic
1038432153 8:27509056-27509078 TAGAGAAAAAAGCAGGATGGGGG - Intronic
1038795590 8:30706570-30706592 CAAAGACAAATGAAGGGTGGCGG + Intronic
1038955334 8:32462157-32462179 AAGAACAAAGAGAAGGTTGGAGG + Intronic
1039042986 8:33425592-33425614 CAGAGGAAGGGGGAGGGTGGAGG + Intronic
1039129226 8:34242667-34242689 GTGAGAAAAGGGAGGGGTGGGGG + Intergenic
1039582088 8:38675219-38675241 GAGACAAAAGAGCAGGGGGGAGG - Intergenic
1039671030 8:39598786-39598808 CAAAAAAAAGAAAAGGGTGTTGG + Intronic
1039705893 8:40007095-40007117 CAGTGAAAAATGAAAGGTGGAGG + Intronic
1039798102 8:40932642-40932664 CAAAGGCAAGAGAAGGGAGGTGG - Intergenic
1039925765 8:41930805-41930827 GAGAGAAAAGAGAATGGAGTTGG + Exonic
1040449229 8:47527304-47527326 CAGAGAAACAGGAAGGCTGGAGG - Intronic
1040592887 8:48811424-48811446 AAGAGAAAAGAAGAAGGTGGAGG + Intergenic
1041289666 8:56296889-56296911 AAAAGAAAAGAGAAGGGGAGGGG - Intergenic
1041964570 8:63660170-63660192 AAGAACAAAGAGAAGGTTGGAGG + Intergenic
1042030366 8:64469560-64469582 CAGAGGAAGGAGAAAGGTAGAGG - Intergenic
1042515206 8:69652101-69652123 CAGAAAACAGAGGAAGGTGGGGG - Intronic
1042719517 8:71812276-71812298 GAGAGAAAGGAGAAGGCTGAAGG - Intergenic
1043277196 8:78413550-78413572 AAGAGAACAGAGAAGAATGGGGG - Intergenic
1043321308 8:78989969-78989991 TAGACAAAAGAGAATGGAGGTGG - Intergenic
1043501387 8:80860937-80860959 CAGAAATGAGAGATGGGTGGTGG + Intronic
1043508352 8:80924814-80924836 CAGAGAAATGGAAAGGTTGGTGG + Intergenic
1043623207 8:82223743-82223765 AAAAGAAAAGAGAAAGGAGGAGG + Intergenic
1043832925 8:85011947-85011969 CAAAGAGAAGAAAAGGGAGGAGG - Intergenic
1044539563 8:93394126-93394148 AAAAGAAAAAAAAAGGGTGGGGG - Intergenic
1044855369 8:96469907-96469929 CAGAAAAAATAGAAAGGTGGTGG - Intergenic
1044867377 8:96585520-96585542 AAGAGAAATGAGAAGGATGGGGG + Intronic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045441872 8:102221868-102221890 TAGAGAAAAAAGAAGGGAAGAGG - Intronic
1045454088 8:102358752-102358774 AAAAGAAAAGAAAAGGGTTGTGG - Intronic
1045493817 8:102691194-102691216 CAGAGGAAACAGATGGGTTGTGG + Intergenic
1045567184 8:103331468-103331490 GTGAGAAAAGAGCAGGGAGGTGG + Exonic
1045687464 8:104726989-104727011 CAGAGGACAGAAAAGGGTGGAGG - Intronic
1046137359 8:110045967-110045989 CAGAGAAAAAAGAATGGTTCTGG + Intergenic
1046532536 8:115466645-115466667 AGGATAAAAGAGAAGGGGGGCGG + Intronic
1046751584 8:117932604-117932626 AATAGAAAAAAGAGGGGTGGAGG - Intronic
1046936186 8:119887497-119887519 CAGAAAGAAGAGAAGGGAAGGGG - Intronic
1047255807 8:123212690-123212712 CAGGGGAAAGAGAATGGTGCTGG + Intergenic
1047330719 8:123884457-123884479 CAGAGGAAAGAGAAAGGCAGAGG + Intronic
1047354887 8:124111179-124111201 AAGAGAAAAGAAAAGGGGGAAGG + Intronic
1047498959 8:125428075-125428097 CAGAGAAACTACAAGGGTGGTGG - Intergenic
1047614606 8:126553933-126553955 CAGAGGAAGAAGACGGGTGGGGG + Exonic
1048456614 8:134584247-134584269 CAGAGAAAGCTGCAGGGTGGAGG - Intronic
1048498709 8:134956920-134956942 CAGGGCAAACAGAAGGGAGGTGG + Intergenic
1048533297 8:135270425-135270447 CTGGGAAAAGAGAAGGTTGGAGG + Intergenic
1048606804 8:135977166-135977188 CTCAGAAAATAGAAGGGGGGAGG + Intergenic
1049226102 8:141451255-141451277 GAGAGAAAAAAGCAGCGTGGGGG + Intergenic
1049288125 8:141787571-141787593 CAGAGAACAGAGAGGGAGGGAGG + Intergenic
1049335939 8:142085330-142085352 AAGAGAAAAGAGAAGAGAGAGGG + Intergenic
1049474134 8:142789106-142789128 TAGAGAACAGAGGAGGGAGGAGG - Intergenic
1050020432 9:1278972-1278994 CAGAGAAAAGAGAAAGCTTTGGG - Intergenic
1050638759 9:7642450-7642472 CAGAGAAGAGAAAAGGGGAGAGG - Intergenic
1051348537 9:16175455-16175477 CAGAGCCAAGAGAAGGGTAAGGG - Intergenic
1051398954 9:16658830-16658852 AAGAGAAAAAAGTTGGGTGGGGG - Intronic
1051423884 9:16915379-16915401 CAGAGAAAAGAGATGGAAGAGGG - Intergenic
1051527603 9:18064204-18064226 AAGAGCAAGGAGAAGGGTGTGGG + Intergenic
1051744635 9:20283738-20283760 AAGAGAAAAAAAAAGGGGGGGGG + Intergenic
1051745827 9:20293745-20293767 AACAGAAAATAGAAGGGTTGGGG - Intergenic
1052020974 9:23524886-23524908 TAGAGAGAGGAGAAGGGAGGTGG - Intergenic
1052161597 9:25267677-25267699 AAGAGAAAGAAGAAGAGTGGTGG - Intergenic
1052301640 9:26958837-26958859 GAGAGAAAAGAAAAAGATGGTGG + Intronic
1052467176 9:28843606-28843628 CAGAGAAAGGGGAGGGATGGAGG + Intergenic
1052765996 9:32641473-32641495 CAAAGAAAAGGGAAGGGAAGGGG + Intergenic
1053033488 9:34803476-34803498 CAGAGAAAAGCAAAGGGGTGAGG + Intergenic
1053567731 9:39270764-39270786 TAGAGGGAAGATAAGGGTGGGGG - Intronic
1053833742 9:42111711-42111733 TAGAGGGAAGATAAGGGTGGGGG - Intronic
1054129412 9:61348235-61348257 TAGAGGGAAGATAAGGGTGGGGG + Intergenic
1054810765 9:69432300-69432322 CAGATGAAAGAGAAGGCTGAGGG + Intronic
1054877646 9:70113227-70113249 CAGGGAAGAGAGGAGGGAGGAGG + Intronic
1055729627 9:79267179-79267201 CATACAAAAGAGAATGCTGGAGG + Intergenic
1055919646 9:81445796-81445818 CAGAGGAAAGAGTATGGGGGAGG - Intergenic
1056214133 9:84392360-84392382 CAAATAAAAGAAAAGGCTGGGGG - Intergenic
1056774974 9:89505214-89505236 CAGTGTAGAGAGCAGGGTGGGGG - Intergenic
1056798973 9:89678217-89678239 CAGAGACAAAAGGAGGGAGGGGG + Intergenic
1056813654 9:89783598-89783620 TAGAGAAGAGAGGAGGCTGGAGG + Intergenic
1056874152 9:90311917-90311939 CATAGAAATGAGAAGGTTGTGGG - Intergenic
1057159272 9:92875060-92875082 CTGAGAAAACAGATGGGTAGAGG + Intronic
1057397270 9:94691288-94691310 CAGAGGCAGGAGCAGGGTGGAGG - Intergenic
1057425788 9:94948497-94948519 CAAAGATAAGAGATGGGGGGCGG - Intronic
1057448757 9:95137897-95137919 CAGAGAGAGGAGAGGAGTGGAGG + Intronic
1057516607 9:95727274-95727296 AAGAGGAAAGAGAAGGGGGGTGG - Intergenic
1057825152 9:98367431-98367453 CATAGAAAGGAGAATCGTGGTGG + Intronic
1057839855 9:98477523-98477545 CAGAGAAAATGGAGGTGTGGTGG - Intronic
1058400540 9:104613163-104613185 CAGAAGGAAGAGAAGGATGGAGG + Intergenic
1058940953 9:109812224-109812246 CTGAGAAGGGAGAAGGGAGGAGG + Intronic
1059363383 9:113765865-113765887 AAGAGAAAGGAAAAGGGTGGTGG - Intergenic
1059514237 9:114878119-114878141 GAGAGAATAGAGAAGAGAGGAGG + Intergenic
1059518142 9:114914737-114914759 CCCAGAAAGGAGAAGGGTGTGGG + Intronic
1059667884 9:116466345-116466367 CAGAGATAAGAGAAGGTGGCTGG - Intronic
1060017094 9:120096306-120096328 CAGGGAATAGAGAATGGAGGAGG - Intergenic
1060723685 9:125994203-125994225 CAGAGCTAAGAGCAGGATGGAGG - Intergenic
1061209565 9:129182926-129182948 CAGACAACAGCGAAGGGCGGGGG - Intergenic
1061268794 9:129524457-129524479 AAGAAAAAAAAAAAGGGTGGAGG - Intergenic
1061297760 9:129686237-129686259 CAGAGTCAAGACAAGGGTGAGGG + Intronic
1061652859 9:132065365-132065387 CAGGGAAAGGAGAAGAGCGGCGG + Intronic
1061890124 9:133614886-133614908 CAGAGAAAGGAGAATGGCAGGGG + Intergenic
1061942579 9:133891493-133891515 CAGATAGAGGAGAAGGATGGAGG + Intronic
1062192701 9:135256001-135256023 AAGAGCAAAGAGACGGATGGAGG - Intergenic
1062590335 9:137271799-137271821 CAGGGACAGGAGGAGGGTGGAGG - Intronic
1062707045 9:137951517-137951539 GAGAGAAACCAGGAGGGTGGTGG - Intronic
1203734194 Un_GL000216v2:120217-120239 CCAAGAAATTAGAAGGGTGGAGG + Intergenic
1185545400 X:939789-939811 AAGAGAAAAGAGGAGGAGGGGGG - Intergenic
1185640650 X:1588143-1588165 CAGAGGAAAGGGGAGGGGGGAGG - Intergenic
1185884893 X:3773667-3773689 CAGAGAAATGAGAAGGCAGGAGG - Intergenic
1185943571 X:4348774-4348796 AAGGGAAAAGAGAAGGGAGGTGG - Intergenic
1186209495 X:7234477-7234499 CAGAGCAAATAAAAGGGTGGTGG + Intronic
1186363836 X:8871194-8871216 GAGAGGATGGAGAAGGGTGGAGG + Intergenic
1186746245 X:12572655-12572677 CAAAGAATGTAGAAGGGTGGAGG - Intronic
1187131251 X:16505306-16505328 AGGAGAAGAGAGAAGGGAGGAGG - Intergenic
1187215136 X:17268570-17268592 CAAAGAAAAGGGAGGGGTAGGGG + Intergenic
1187270329 X:17774959-17774981 AAGACAGAAGAGAAGGGGGGTGG - Intergenic
1187426827 X:19185355-19185377 GAGAGAAAGGAGAGGGGAGGAGG - Intergenic
1187552957 X:20324205-20324227 GAGAGAGAAGAGAAGGAGGGAGG - Intergenic
1187665265 X:21601567-21601589 CATAGGAAAGAGATGGGAGGAGG - Intronic
1188510613 X:30932151-30932173 CAGAGAAAGGGGAAGGGCTGGGG + Intronic
1188740208 X:33769135-33769157 AAGGGAAAAGGGAAGGGAGGAGG + Intergenic
1188767404 X:34112441-34112463 CAGAGATAACGGAGGGGTGGGGG - Intergenic
1188779950 X:34269590-34269612 CAGAGTAAAGAGAAAGGTAAAGG + Intergenic
1188786985 X:34359154-34359176 GAGAGAAAAGAAAAGGGTATAGG - Intergenic
1189205549 X:39235451-39235473 AAGGGAAAAGAGCAAGGTGGGGG - Intergenic
1189546982 X:42051538-42051560 AAGAGAAAAGAAAAAGTTGGGGG - Intergenic
1189722540 X:43934763-43934785 AAAAGAAAAGAGAAGGCTGCAGG - Intergenic
1189911287 X:45812849-45812871 CAGAAAGAAGAGGAGGGAGGAGG + Intergenic
1190384657 X:49873160-49873182 GAGACAAAAAAAAAGGGTGGGGG - Intergenic
1190541716 X:51484265-51484287 AAGATAAATGAGAATGGTGGGGG - Intergenic
1190713558 X:53086324-53086346 AAGAGGGAAGACAAGGGTGGGGG - Intronic
1190853335 X:54267884-54267906 CAGTGAAAAGAGCAGGCTTGGGG + Intronic
1191159071 X:57308254-57308276 CAGAGAAAAGGGAATGTTGATGG - Intronic
1191625946 X:63271688-63271710 CAGAAAAAAAAAAAGGGTGGGGG - Intergenic
1192194073 X:69016972-69016994 CAGAGGAAAGAGTAAGGTGGAGG - Intergenic
1192246672 X:69378761-69378783 GAGAGAGAAGAGAAGAGTGAGGG - Intergenic
1192575600 X:72240799-72240821 CAAAAAAAAGAAAAGGGTTGGGG + Intronic
1193140085 X:78018074-78018096 TTTAGAAAAGAGATGGGTGGTGG - Intronic
1193467015 X:81861817-81861839 TAGAGAAAAGAGAATGCTGATGG + Intergenic
1193847790 X:86496560-86496582 CAATGTAAAGAGAAGGGAGGGGG + Intronic
1193893188 X:87077529-87077551 AAGGGAAAAGAGAAGGGGAGAGG + Intergenic
1194031815 X:88826181-88826203 CAGAGAAAAGTGAAAAGTGGGGG - Intergenic
1194792824 X:98172092-98172114 CAGACAAAAGAGAAGGTTCAAGG + Intergenic
1195089557 X:101445577-101445599 TGGAGATTAGAGAAGGGTGGAGG + Intronic
1195455873 X:105069076-105069098 AAGAAAAAAGATAGGGGTGGTGG + Intronic
1195792158 X:108599727-108599749 CAGACAAAAGTGAATGGTTGTGG - Intronic
1195837570 X:109134614-109134636 CAAATAATAGAGAAGAGTGGAGG + Intergenic
1195897010 X:109756018-109756040 AAGAGAAAAAAAAAGAGTGGAGG + Intergenic
1196385661 X:115146270-115146292 CAGAGGCTAGAGAAGGGTAGTGG + Intronic
1196754076 X:119142796-119142818 AAGAGGAAAGAGAGGGGAGGAGG + Intronic
1197072610 X:122317998-122318020 CAGAGATCACAGAAGGCTGGTGG - Intergenic
1197634417 X:128898675-128898697 CAGAGAAAGGAGGAAGGTAGAGG + Intergenic
1197745784 X:129931776-129931798 CAAGGATTAGAGAAGGGTGGCGG - Intergenic
1198026392 X:132711877-132711899 AAGAGAAATGTGGAGGGTGGTGG - Intronic
1198121336 X:133595282-133595304 CAGAGGAAAGAGAATGGCAGTGG + Intronic
1198437739 X:136633420-136633442 AAGAACAAAGAGAAGGTTGGAGG - Intergenic
1198640958 X:138756252-138756274 CAGAGAAAAGAGAAGGCAGCTGG + Intronic
1198864282 X:141105038-141105060 AAAAGAAAAAAGAAGGGAGGAGG - Intergenic
1198898407 X:141482378-141482400 AAAAGAAAAAAGAAGGGAGGAGG + Intergenic
1199633956 X:149797449-149797471 CAGAGAAAATAGAAGAGAAGGGG - Intergenic
1200100138 X:153686094-153686116 GAGACAGAAGTGAAGGGTGGGGG - Intronic
1200137806 X:153883425-153883447 CAGAGGAGAGAGCAGGGGGGCGG + Intronic
1200307757 X:155045719-155045741 CACAGAAAAGGGAAGGGGGCTGG + Intronic
1201360849 Y:13147227-13147249 CAGAAATAAGACAAGTGTGGTGG + Intergenic
1201773679 Y:17642529-17642551 CAAATAAAAGAAAAAGGTGGGGG - Intergenic
1201827877 Y:18263456-18263478 CAAATAAAAGAAAAAGGTGGGGG + Intergenic
1202101232 Y:21310105-21310127 CACAGAAAAGAGGTGGGTAGGGG + Intergenic
1202187109 Y:22197263-22197285 CACAGAAAAGAGGTGGGTAGGGG + Intergenic
1202204251 Y:22389133-22389155 CACAGAAAAGAGGTGGGTAGGGG - Intronic
1202626819 Y:56868206-56868228 CCAAGAAATTAGAAGGGTGGAGG - Intergenic