ID: 912904170

View in Genome Browser
Species Human (GRCh38)
Location 1:113686521-113686543
Sequence CTAAAAATAAACCCACGGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912904167_912904170 -5 Left 912904167 1:113686503-113686525 CCATTGCAAGAACGCATACTAAA 0: 1
1: 0
2: 1
3: 5
4: 68
Right 912904170 1:113686521-113686543 CTAAAAATAAACCCACGGTCGGG 0: 1
1: 0
2: 0
3: 3
4: 122
912904166_912904170 2 Left 912904166 1:113686496-113686518 CCACTTACCATTGCAAGAACGCA 0: 1
1: 0
2: 0
3: 6
4: 87
Right 912904170 1:113686521-113686543 CTAAAAATAAACCCACGGTCGGG 0: 1
1: 0
2: 0
3: 3
4: 122
912904165_912904170 3 Left 912904165 1:113686495-113686517 CCCACTTACCATTGCAAGAACGC 0: 1
1: 0
2: 1
3: 1
4: 60
Right 912904170 1:113686521-113686543 CTAAAAATAAACCCACGGTCGGG 0: 1
1: 0
2: 0
3: 3
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912904170 Original CRISPR CTAAAAATAAACCCACGGTC GGG Intergenic
901393896 1:8966403-8966425 CAAAAAATAAACATACGGCCAGG - Intronic
903302913 1:22391736-22391758 GTAATAATAAGCTCACGGTCGGG + Intergenic
905018699 1:34794079-34794101 CTACAAAGAAACCCAGGCTCAGG - Intronic
905540155 1:38754296-38754318 CTAAAATTGAACCCATGGTGGGG + Intergenic
911365510 1:96932874-96932896 TAAAAAAAAAACCCATGGTCAGG + Intergenic
912509659 1:110180332-110180354 CTAAAAACAAACCCACATTTTGG + Intronic
912904170 1:113686521-113686543 CTAAAAATAAACCCACGGTCGGG + Intergenic
916614538 1:166426077-166426099 CCAAAAAAAAACCCAGGGCCAGG - Intergenic
917892033 1:179449179-179449201 ATAAAAATTAACCCAAGGCCAGG - Intronic
918764242 1:188458054-188458076 CTAAAAGTGAACCAAAGGTCAGG - Intergenic
918803187 1:189000038-189000060 CTAAAAATATACCCCCAGCCGGG - Intergenic
920790260 1:209083343-209083365 CTATAAATAAAACCACATTCAGG - Intergenic
921210170 1:212888990-212889012 TTAAAACAAAAACCACGGTCAGG - Intronic
921913093 1:220573616-220573638 ATAAAAATAAAGCCTCGGCCGGG - Intronic
923442600 1:234035448-234035470 ATGAAAATAAACCCACGTTAAGG - Intronic
924267941 1:242301733-242301755 ATAAAAATAAACCTACGGAAGGG - Intronic
1063778014 10:9286300-9286322 CTAAAAATAAAAACACTGTTTGG + Intergenic
1065705228 10:28466102-28466124 CTAAAAATAAAAAAATGGTCCGG + Intergenic
1071739036 10:88335772-88335794 CTAAAAATCAACCCATAGTGAGG - Intronic
1072598109 10:96894672-96894694 CAAAAGATAAACCCTCAGTCTGG - Intronic
1076111984 10:127867060-127867082 CTAAAACTAAACCTACAGGCAGG + Intergenic
1085663276 11:78389600-78389622 CTGAAAAGAAAACCACGGCCGGG - Intronic
1094109278 12:26844063-26844085 TTAAAAATAAATCCAGGGCCAGG + Intergenic
1098209395 12:68147659-68147681 CTAAAAGTAAACCCACTCTTAGG + Intergenic
1100433531 12:94551553-94551575 AGAAAAATAAACCCTCGGCCGGG + Intergenic
1102859106 12:116320085-116320107 ATAAAAAGAAACGCGCGGTCAGG - Intergenic
1103548390 12:121718185-121718207 CTAAATATCAACCCATGGCCTGG + Intronic
1103865892 12:124051696-124051718 CTAAGAATAAACACAGGGTTGGG - Intronic
1104699544 12:130891631-130891653 CTAAAAATAAAAATATGGTCGGG + Intergenic
1106317294 13:28605851-28605873 CTAAAAAGAAACCCTGGGGCTGG - Intergenic
1106321545 13:28644160-28644182 CTAAAAAAAAAACCAAGGCCGGG + Intergenic
1108398077 13:50009439-50009461 CTATAAAAAAATCCACGGCCAGG + Intronic
1109205233 13:59475917-59475939 CTAAAACTTAACCCTTGGTCAGG + Intergenic
1113125091 13:106969135-106969157 TTAAAAATAAACCCACAGGCTGG - Intergenic
1120453700 14:84703888-84703910 TTATATATAAACCCAGGGTCTGG + Intergenic
1120753130 14:88216859-88216881 ATAAAAATAAACTCACGGCAGGG + Intronic
1120938528 14:89922223-89922245 CAAAAACTAAACCCAGGGTTGGG + Intronic
1124056986 15:26250431-26250453 ATAAAAATAAAAACACGGTGGGG - Intergenic
1125042395 15:35205857-35205879 TAAAAAATAATCCCACTGTCGGG + Intergenic
1125844912 15:42843278-42843300 CTCAAAACAAACCCACTCTCTGG + Intronic
1128200318 15:65799820-65799842 CTAAAAATAATCCTATGTTCTGG - Intronic
1129049845 15:72771648-72771670 CTAACAAAAGACCCAGGGTCTGG + Intronic
1134516194 16:14889233-14889255 TTAAAAAAAAACCCATGGGCTGG + Intronic
1135562939 16:23490437-23490459 TTAAAAATAAATCCACAGCCGGG + Intronic
1142382436 16:89740644-89740666 AAAAAAAAAAACCCACGGCCTGG + Intronic
1147229258 17:39005229-39005251 CTCAAAATAGACCCATGGTTAGG - Intergenic
1149474100 17:56944720-56944742 CTAAAAATAAACAGAAGGCCAGG + Intronic
1151641135 17:75394945-75394967 ATAAAAATAAAGCCCCGTTCTGG + Intronic
1157168198 18:45377815-45377837 CTTAAAATGAACCCTTGGTCTGG + Intronic
1161376342 19:3941001-3941023 CTAAGAATATACCCCCGGTGGGG - Intronic
1161802245 19:6422823-6422845 CTAAAAAAAAACACACTTTCTGG - Intronic
1162665162 19:12204152-12204174 CTAGAAATATACACATGGTCAGG - Intergenic
1165817591 19:38651614-38651636 CAAAAAAAAAGCCAACGGTCAGG - Intronic
1165911667 19:39232444-39232466 TTAAAAATACACACACGGCCGGG + Intergenic
1167946955 19:52995793-52995815 CTAAAAATAAACAAACAGCCAGG + Intergenic
1168491840 19:56817535-56817557 CAAAAAATCAACCCACCGGCGGG - Exonic
1168578891 19:57536791-57536813 CTGAAAACAAACCCATGGCCTGG + Intronic
927595982 2:24397839-24397861 TTAGAAATAAACCCAAGGCCAGG - Intergenic
927778416 2:25920186-25920208 TTAAAAATAAACACCCGGCCAGG + Intergenic
928868799 2:35950373-35950395 TTAAAAATATACCCATGCTCAGG + Intergenic
931964234 2:67515802-67515824 CTCCAAATAAACACAGGGTCAGG + Intergenic
944696213 2:202202515-202202537 ATAAGAGTAAACCCATGGTCTGG - Intergenic
945249401 2:207751556-207751578 CTAAAAATACACACACAGGCCGG + Intronic
945541652 2:211094965-211094987 TTAAAAATAAATCCAAGATCTGG + Intergenic
947205622 2:227658493-227658515 CAAAATATAAAACCTCGGTCTGG - Intergenic
948400763 2:237683237-237683259 CTAAAATCAAGCCGACGGTCAGG + Intronic
1172379596 20:34477233-34477255 TTAAAAATAAAATCACGGCCGGG + Intronic
1174226877 20:49007756-49007778 CCAAAATTAAACCCAGAGTCTGG + Intronic
1174835198 20:53850391-53850413 CTAATAATAAACTCAAGCTCTGG + Intergenic
1176001519 20:62833696-62833718 CTCAAAAAAAACCCCCGGCCGGG - Intronic
1177955281 21:27590701-27590723 ATAAAAATTAACCCACAGTACGG - Intergenic
1178354411 21:31898560-31898582 CTAATAAAAAATCCACGGCCGGG - Intronic
951342948 3:21511147-21511169 CTAAATAGAACCCCACTGTCTGG - Intronic
951347404 3:21562391-21562413 CCAAAAATAGAACCACTGTCTGG + Intronic
952310680 3:32186487-32186509 TTAAAAACATACCCACGGCCTGG + Intergenic
953483620 3:43273914-43273936 CTAATAATAAAACCAGGGTAAGG + Intergenic
961726699 3:128935413-128935435 TTAAAAACAAACCCAGGGGCCGG + Intronic
966156909 3:176926459-176926481 ATAAAGTTAAACCCACAGTCTGG + Intergenic
978390342 4:108218514-108218536 CTAAAAATAAAACCAATGACAGG + Intergenic
983871596 4:172830651-172830673 CTATAAATAATGCCACGGTGTGG - Intronic
986606394 5:9527438-9527460 CTAAAAATAAAACCAGGGCTTGG - Intronic
987883848 5:23786941-23786963 AGAAAAAAAAACCCATGGTCTGG - Intergenic
989467531 5:41774598-41774620 ATAAAAATAAACACAGGGCCAGG + Intronic
993512304 5:88786253-88786275 TTAAAAATAAACCTACCCTCTGG + Intronic
997734769 5:136205160-136205182 TTAAAAAGAAACCCAGTGTCTGG - Intergenic
997792291 5:136771737-136771759 CTAAATCTAAAGCCATGGTCTGG + Intergenic
1005005341 6:21282138-21282160 CTAATAGTTAACCCACGGTCTGG - Intergenic
1005637244 6:27764195-27764217 CAAAGAAAAAACCCAAGGTCTGG + Intergenic
1006384542 6:33722769-33722791 CCAAAAATATAGCCAGGGTCTGG + Exonic
1008897122 6:56569025-56569047 TTAAAAACACACACACGGTCGGG + Intronic
1009931961 6:70187284-70187306 CTAAATATATACCCACGGGATGG - Intronic
1010674680 6:78728082-78728104 CTAAAAAAAACCCCACAGACTGG - Intergenic
1015221292 6:130806378-130806400 CCAAAAAGATACCCACGTTCAGG - Intergenic
1015524330 6:134161030-134161052 CCAAAAACAAAACCACTGTCTGG - Intergenic
1016366679 6:143326229-143326251 TTAAAAATCAACCCATGGTTTGG + Intronic
1020085237 7:5306902-5306924 CAAAAAACAAACCCAAAGTCTGG + Exonic
1020464465 7:8461533-8461555 TTAAGAATAAACACACGGCCGGG + Intronic
1023431006 7:40091047-40091069 CTAAAAATAAAACAACTGGCCGG + Intronic
1025209083 7:57010369-57010391 CAAAAAACAAACCCAAAGTCTGG - Intergenic
1025662866 7:63566487-63566509 CAAAAAACAAACCCAAAGTCTGG + Intergenic
1025946213 7:66106925-66106947 ATAAAAATAAAAACATGGTCTGG - Intronic
1026942902 7:74298048-74298070 CTAAAGCTGCACCCACGGTCCGG + Intronic
1031952801 7:127909730-127909752 CTAAAAATTAAGCCATGGTTTGG + Intronic
1032147220 7:129394992-129395014 AAAAAAAAAAACCCACTGTCAGG - Intronic
1034982139 7:155485885-155485907 CTAAAAATATAACTACCGTCTGG - Intronic
1035092967 7:156329690-156329712 CTACAGATAATCCCACGGTTGGG - Intergenic
1038370870 8:26989071-26989093 CTAAATATAGACCCACGTTAAGG + Intergenic
1039635726 8:39162706-39162728 GTAAAAAAAAACCCTTGGTCGGG + Intronic
1040390843 8:46949340-46949362 ATAAAAATTAACCCATGGCCTGG - Intergenic
1042641594 8:70941407-70941429 CTAAAGATAAAGCCAGGGTCTGG + Intergenic
1046058218 8:109104099-109104121 CTAAATATAAGCCCACTGCCAGG + Intronic
1049456843 8:142696657-142696679 TTAAAAATAAAATCAAGGTCAGG + Intergenic
1050760143 9:9058742-9058764 TTAAAAAAAAACCCTCGGCCGGG - Intronic
1051378462 9:16430000-16430022 CTAAAAAGAACCCCAGGGACAGG + Intronic
1051768621 9:20551198-20551220 CTAAAAATAAACTCAAGGATTGG - Intronic
1053126920 9:35589243-35589265 CAAAAAACAATCCCAGGGTCGGG + Intergenic
1060586010 9:124786422-124786444 TTAAAAATACACGCACGGGCCGG + Intronic
1061875894 9:133543835-133543857 CTAGAAAGAAACCAAGGGTCTGG - Intronic
1062189476 9:135240471-135240493 CTAAATATAAAGCCAGGCTCAGG + Intergenic
1186230510 X:7448799-7448821 CTAAAAATCAGCCCACGCTTTGG - Intergenic
1190458427 X:50646805-50646827 CTACAAAGAAACCCAGGGTAGGG + Intronic
1190859446 X:54330076-54330098 CAAAAAATAAAAACACGGCCAGG + Intronic
1194179235 X:90692449-90692471 CTAAAAATAGACCCGAAGTCAGG - Intergenic
1198007126 X:132506540-132506562 CAAAAATTAAACCCACTCTCAGG + Intergenic
1200370771 X:155722225-155722247 CTAAAAATAAAAGCATGGCCAGG + Intergenic
1200525902 Y:4274614-4274636 CTAAAAATAGACCCGAAGTCAGG - Intergenic