ID: 912907016

View in Genome Browser
Species Human (GRCh38)
Location 1:113718253-113718275
Sequence ACTCCAGGTCTCACACATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 1, 2: 5, 3: 14, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912907013_912907016 -5 Left 912907013 1:113718235-113718257 CCAAAATGATCTCCTTTGACTCC 0: 1250
1: 1855
2: 1529
3: 901
4: 676
Right 912907016 1:113718253-113718275 ACTCCAGGTCTCACACATCCAGG 0: 1
1: 1
2: 5
3: 14
4: 158
912907012_912907016 22 Left 912907012 1:113718208-113718230 CCAGTGGGGGAGTCAAATTTTAA 0: 1
1: 129
2: 435
3: 674
4: 1086
Right 912907016 1:113718253-113718275 ACTCCAGGTCTCACACATCCAGG 0: 1
1: 1
2: 5
3: 14
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912907016 Original CRISPR ACTCCAGGTCTCACACATCC AGG Intronic
901209144 1:7514774-7514796 ACTCCAGGCCCCACAGCTCCAGG - Intronic
901491886 1:9600991-9601013 ACCCATGTTCTCACACATCCTGG - Intronic
901653302 1:10755356-10755378 ACGTCAGGTCTCACACATGGAGG - Intronic
901870710 1:12137748-12137770 GCTCCAGGTCCCCCACCTCCTGG - Intronic
901924292 1:12556255-12556277 GCTCCAGGTCCCACAGAGCCAGG + Intergenic
902631448 1:17706937-17706959 AACCCAGGTCTCCCAAATCCAGG - Intergenic
902834082 1:19035599-19035621 ACTGCAGGTGTCACACATCCAGG - Intergenic
903591998 1:24463595-24463617 ACTCCTGGTCTCACTCGGCCAGG - Intronic
907035699 1:51214146-51214168 ACTCCTGGGCTCACCCACCCTGG - Intergenic
910929655 1:92430482-92430504 GCCTCAGGTCTGACACATCCTGG - Intergenic
912490671 1:110060995-110061017 CCTCCAGGGCTCCCAGATCCTGG + Exonic
912570882 1:110620164-110620186 ACCCCTGTCCTCACACATCCCGG + Intronic
912907016 1:113718253-113718275 ACTCCAGGTCTCACACATCCAGG + Intronic
914688487 1:150003997-150004019 ACTCAATGTCTCAGACACCCAGG + Intronic
915132931 1:153708483-153708505 ACTCCAAGTCCCACAAAACCTGG - Intergenic
915170320 1:153972940-153972962 GACCCAGGACTCACACATCCTGG + Intronic
915315065 1:155023865-155023887 TCTCCATGTCTCCCTCATCCTGG + Exonic
915928931 1:160046375-160046397 AATCCAGGTCTCCCAGCTCCTGG + Intronic
917003433 1:170385886-170385908 ACTCCAGGTTGCACAACTCCTGG - Intergenic
920080582 1:203369897-203369919 CCTCCAGGTCTCACTCTTCTTGG + Intergenic
920848044 1:209609925-209609947 ACTCCATGTCTCACTCACCAGGG - Exonic
923015880 1:230126412-230126434 TCTCCAGGTCTCAAGAATCCAGG - Intronic
923250944 1:232179187-232179209 ACTCCAGGTCTTACCCACCAAGG - Intergenic
1064721022 10:18228579-18228601 AATCCAGGTCTTTCACGTCCTGG + Intronic
1068642936 10:59431596-59431618 ACTCCAGGACTGAGACATGCTGG - Intergenic
1072904365 10:99438146-99438168 ACTCCAGGCCTCACACATACCGG - Intergenic
1078105455 11:8355478-8355500 CCTCCAGGTCTCACCCAGCTGGG - Intergenic
1080038399 11:27733200-27733222 ACTTCAGCTCTCACAAAACCTGG + Intergenic
1081808850 11:45904236-45904258 ACTCCAGATCTCAGCCAGCCAGG + Intronic
1082212335 11:49520334-49520356 ACTCAAGGTCTCACACAAGGTGG - Intergenic
1082794662 11:57370448-57370470 ATCCCAGCTCTCTCACATCCTGG - Exonic
1082946870 11:58770671-58770693 ACCCCAGATCTCCCACATCCTGG - Intergenic
1086593077 11:88539301-88539323 ACTTTAGGTCTCACAAAGCCTGG + Intronic
1086637255 11:89104160-89104182 ACTCAAGGTCTCACACAAGGTGG + Intergenic
1088797670 11:113277498-113277520 CCTCCCGGTCTCAGACACCCAGG - Exonic
1088921132 11:114260507-114260529 CCTCCAGCACTCACACATCCAGG + Intronic
1090064761 11:123493168-123493190 ATTCCAGCTCTGCCACATCCTGG + Intergenic
1091295992 11:134474362-134474384 GCTCCAGGGCTCTCACATCAGGG - Intergenic
1091741062 12:2960332-2960354 CCTCCAGGTCTCTCCCTTCCAGG - Intronic
1095563159 12:43589396-43589418 CCTCCAGGTAGCAAACATCCTGG + Intergenic
1100517929 12:95346064-95346086 ACTCCAGGTCTGTCACTTTCAGG + Intergenic
1100576137 12:95893224-95893246 ACTCCAGCTCACACACATTAAGG + Intronic
1102116178 12:110404770-110404792 ATAGAAGGTCTCACACATCCAGG - Intergenic
1103319053 12:120079979-120080001 ACACCAAGTCTCACACAACCAGG + Intronic
1104614099 12:130254194-130254216 ACTCCAAGTCCAAAACATCCAGG - Intergenic
1104958525 12:132477334-132477356 ACTGCAGCTGTCACACAGCCTGG + Intergenic
1105931810 13:25059747-25059769 CCACTAGGCCTCACACATCCAGG + Intergenic
1106477004 13:30107663-30107685 GCTCATGGTCTGACACATCCAGG - Intergenic
1106780736 13:33056843-33056865 TCTCCTGGGCTCACATATCCTGG - Intronic
1107957872 13:45534002-45534024 ACTCCAGGTGTCTGACACCCAGG - Intronic
1109475603 13:62876880-62876902 ACTCCAGGGTTCTCACATCCAGG + Intergenic
1112790213 13:102995021-102995043 ATTCCATGTCTCACACATCCAGG + Intergenic
1113931573 13:113971644-113971666 ACCCCACGTCTCCCGCATCCCGG + Intergenic
1113931588 13:113971686-113971708 ACGCGGCGTCTCACACATCCGGG + Intergenic
1114358319 14:21940315-21940337 AATTCAGTTCTCACACAACCAGG + Intergenic
1114389686 14:22293741-22293763 ACTCCAGGACTCCCAAATTCAGG + Intergenic
1117635531 14:57739288-57739310 ACTCCAGGACTCAGGCATTCAGG + Intronic
1118737744 14:68714290-68714312 ACTCAAGGTCACACAGATCTAGG - Intronic
1121255040 14:92524996-92525018 CCTGCAGGCCTCACACAGCCTGG - Intronic
1122935775 14:104955419-104955441 CCTCCAGGTCCCTCCCATCCTGG + Intronic
1124821023 15:33045357-33045379 ACTGCAGGTCCCACTCAGCCTGG - Intronic
1127012839 15:54649285-54649307 ACTCCATGTCTCTCACATCCAGG + Intergenic
1129814868 15:78542896-78542918 ACTCCAGGCTTCACCCATGCAGG + Intronic
1130145600 15:81271643-81271665 ACTCAAAGTCTCACCCATCCTGG - Intronic
1132056053 15:98650408-98650430 ACTCCCGGCCTCGCACTTCCCGG - Intronic
1135226992 16:20669515-20669537 AGTCCAAGTCTCCCAGATCCTGG - Intronic
1135891855 16:26364643-26364665 ACTCCAGGTCACACAGATGTAGG - Intergenic
1135992171 16:27224749-27224771 AGGCCAAGGCTCACACATCCAGG + Intergenic
1136145008 16:28311337-28311359 TCGCCAGGTCTCACTCCTCCAGG - Intronic
1136657387 16:31718204-31718226 AATTCTGCTCTCACACATCCTGG - Intronic
1139195932 16:64918526-64918548 ACTCCAGCTGTCAGTCATCCTGG - Intergenic
1142744024 17:1946157-1946179 ACTGAAAGTCCCACACATCCTGG - Intronic
1143788350 17:9273521-9273543 ACGCCAGGCCACACACAGCCAGG + Intronic
1143924192 17:10355363-10355385 ACTCAAGATCTCAGACATCAAGG - Intronic
1144488389 17:15686599-15686621 ACTCCAGGACACACATCTCCCGG - Intergenic
1144912628 17:18695705-18695727 ACTCCAGGACACACATCTCCCGG + Intergenic
1152312253 17:79558497-79558519 ACACCAGGGCCCACACTTCCCGG + Intergenic
1153680507 18:7496147-7496169 ATTCTAGGTCTCACAAATCAAGG + Intergenic
1155149890 18:23114787-23114809 CCTCCAGGTCTAACATTTCCTGG + Intergenic
1155842825 18:30667801-30667823 ACTCCATGTCTCACATATCCAGG + Intergenic
1157600782 18:48891991-48892013 TCCCCAGGTCTCACAGAGCCGGG - Intergenic
1159009323 18:63043279-63043301 ACTCCAGTTCTCATACCTCGAGG - Intergenic
1162003718 19:7764040-7764062 ACACCAGGACTCAGGCATCCAGG - Intronic
1162576536 19:11502555-11502577 ACTACAAGTCACACACAGCCTGG - Intronic
1163763686 19:19150699-19150721 AATCCAGATCTCCCGCATCCTGG - Exonic
1163850264 19:19659022-19659044 ACTCAAGGTCTCACACCCCAGGG + Intronic
1164403036 19:27915710-27915732 ACCACAGGGCCCACACATCCAGG + Intergenic
1165428762 19:35759799-35759821 CATCCAGGTCTCAGAGATCCAGG + Exonic
1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG + Intronic
1165981658 19:39729277-39729299 ACTCCATCTCTCACACACCTGGG + Intergenic
925781901 2:7389102-7389124 ACTCCAGGTCTCTCACATCCAGG + Intergenic
928292402 2:30050906-30050928 ATTCCAGCTCCCACACTTCCGGG + Intergenic
932212801 2:69946048-69946070 TCTCCAGGTGTCACCCAGCCCGG - Intergenic
936927578 2:117753345-117753367 ACTCCAGCTCCCCCACTTCCTGG - Intergenic
937058799 2:118966054-118966076 CCTCCAGGTCTGCCACCTCCTGG - Intronic
938876972 2:135541931-135541953 ACTTCTGGTCTCACACATTTTGG - Intronic
939584033 2:143985211-143985233 ACTCCAGTTCCCACACCCCCTGG + Intronic
940389341 2:153113473-153113495 ACTCCAGGTTTCTCACAACCTGG + Intergenic
942222874 2:173788550-173788572 ACTCAAGGCCTCAGACACCCTGG - Intergenic
943126737 2:183803773-183803795 AGGCCAGCTCTCACAGATCCAGG - Intergenic
946169988 2:217889396-217889418 GCTCCAGGACTCACAGCTCCAGG + Intronic
947275321 2:228385276-228385298 ACTTCAGTTCTCACACATATGGG + Intergenic
1169005834 20:2206927-2206949 ACTCCTGGCCTCACACCTCGGGG - Intergenic
1174451501 20:50623562-50623584 TCTCCTCCTCTCACACATCCTGG - Intronic
1175892543 20:62321953-62321975 AATCCAAGTCCCACACAGCCTGG - Intronic
1180206634 21:46265013-46265035 ACCCCAGGTCACACCCATCAGGG + Intronic
1183874322 22:40765972-40765994 ACTCCTGGTCTCGAACATCATGG - Intergenic
1184103819 22:42355742-42355764 CCTCCAGGTCCTCCACATCCAGG - Intergenic
1185030154 22:48438473-48438495 ACACCATGCCACACACATCCAGG + Intergenic
949871204 3:8590724-8590746 ACTCCAGGTCTCTCCTTTCCTGG + Intergenic
950212891 3:11136859-11136881 ACTCAGGCTCTCACACACCCAGG + Intergenic
954254162 3:49392205-49392227 GCTCCTGGCCTCAGACATCCTGG - Intronic
954534743 3:51351185-51351207 GCTCCAGGGCCCACACATCAGGG - Intronic
955051089 3:55411723-55411745 ACTCCAGCAATCACACATCTTGG - Intergenic
956202140 3:66717691-66717713 ACTCCAAGTCTCACATATTCTGG + Intergenic
956380146 3:68656597-68656619 AGGCCAGGTCTCACTCATGCAGG + Intergenic
961107749 3:124256674-124256696 GCTCCAGGTCTGATAGATCCAGG - Intronic
961125328 3:124412360-124412382 ACTCCAGGTCACACATTTCCAGG - Intronic
962475894 3:135754919-135754941 GGTCCAGGTCTCATGCATCCTGG + Intergenic
966105680 3:176330666-176330688 TATCCAGCTCTCACACTTCCAGG + Intergenic
967805475 3:193711400-193711422 CCTCCAGGGCCCACACATTCAGG - Intergenic
967854442 3:194105964-194105986 CCTCCAGTTCTCACTGATCCTGG + Intergenic
970568900 4:17360215-17360237 ACTCTAGGGCTCACACTTCTGGG + Intergenic
971175244 4:24276423-24276445 ACACAAGGTCTCAGACATCGAGG + Intergenic
976838677 4:89406079-89406101 ACTTCAGGTCCCACAAAACCTGG + Intergenic
976924159 4:90476103-90476125 ACTTCAGGGCTCACATAACCTGG + Intronic
977298539 4:95239455-95239477 AGTCTAGGTCTCACAAAGCCAGG + Intronic
980987490 4:139709846-139709868 ACTGCAGCTCTCACACATGTGGG - Intronic
982898563 4:160967086-160967108 ACTGGAGGTATCACACTTCCTGG - Intergenic
985062983 4:186096619-186096641 TCTCCAGGTCGCACACTTACGGG - Intergenic
985714482 5:1447626-1447648 ACTAGAGGTCACACAGATCCAGG + Intergenic
986010649 5:3711819-3711841 ACTCCAGGTGTCCCAGCTCCAGG - Intergenic
986210645 5:5668079-5668101 CCTCCAAGACTCACACATCTTGG + Intergenic
990213293 5:53503918-53503940 TCTCCAGGGCTCACCCTTCCAGG - Intergenic
993853031 5:93034997-93035019 ACTCCAGGAGCAACACATCCAGG - Intergenic
994502767 5:100601040-100601062 ACTCCTGGACTCAAGCATCCTGG - Intergenic
996359346 5:122628188-122628210 ACTTCAGGTTCCACACAACCTGG + Intergenic
997459662 5:134043347-134043369 ACTCCAGGTCACACAGAGGCAGG + Intergenic
997582492 5:135026583-135026605 ACTCCAGGTCTCACAGCATCAGG + Intergenic
997648442 5:135497371-135497393 GCTTCAGGTCTCACCCATTCTGG - Intergenic
998637427 5:143971629-143971651 CCTCCAGGTCTCAAACACCCAGG - Intergenic
999016924 5:148116907-148116929 ACTCAATGTCTCACAAGTCCAGG - Intronic
1001943906 5:175761625-175761647 ATTCCATGTCTCTCACATCCAGG - Intergenic
1007165751 6:39827808-39827830 ACTCCAGGGCTCAGACATGAAGG - Intronic
1007225348 6:40309852-40309874 ACTCCAGGTCTCAAATCTGCTGG + Intergenic
1007356194 6:41319458-41319480 ACTTCCGGTCTCACATTTCCTGG - Intergenic
1008749802 6:54718809-54718831 TTCCCAGGTCTTACACATCCAGG + Intergenic
1009493898 6:64326682-64326704 ACCCCAAGTCTCCCACATCCTGG - Intronic
1013623950 6:111918912-111918934 ACTCCTGGACTCACACATCTGGG - Intergenic
1016325718 6:142898946-142898968 ACACCATGTCTCCCAAATCCGGG + Intronic
1018962677 6:168459539-168459561 ACCCCAGGGCTCACCCACCCTGG - Intronic
1018962743 6:168459711-168459733 ACTCCAGTGCTCACCCACCCTGG - Intronic
1018962778 6:168459804-168459826 ACCCCAGGGCTCACCCAGCCCGG - Intronic
1020061963 7:5159382-5159404 AGACAAGGTCTCACTCATCCAGG - Intergenic
1022846528 7:34215509-34215531 ACTCCAGGCCCCACAAAACCTGG - Intergenic
1024589701 7:50870738-50870760 ATTCCTGGAGTCACACATCCTGG + Intergenic
1029595888 7:101537524-101537546 TCTCCAGGTCAGACACAGCCAGG + Intronic
1033318557 7:140318691-140318713 TCTCCAGGTCTCTCGCATCATGG + Intronic
1035575842 8:704295-704317 ACTCCCGGTCTCACCTCTCCCGG - Intronic
1035684962 8:1517284-1517306 ACTCCAGGTCTAACTCTTCAGGG - Intronic
1036514263 8:9429283-9429305 ACTCCAAGTCTCTCAGATACAGG - Intergenic
1037626444 8:20611414-20611436 TCTCCAGGGCTCAGCCATCCTGG + Intergenic
1037689144 8:21168243-21168265 TCTCCAGGTCTCTCCCATCGGGG + Intergenic
1043485605 8:80696380-80696402 ACTTCTGGTCTCAAACATTCTGG - Intronic
1044274482 8:90284221-90284243 ACTCCAGTTCCCACACATGAAGG + Intergenic
1045597134 8:103669703-103669725 ACTCCATGTGGCTCACATCCAGG + Intronic
1047013819 8:120701284-120701306 AATCCAGGTCTCAGACTCCCAGG - Intronic
1047891523 8:129316818-129316840 ACTCAACGCCTCACACTTCCAGG - Intergenic
1048963378 8:139597919-139597941 ACTCCTGGCCTCACAGACCCTGG + Intergenic
1057110819 9:92469330-92469352 AATCCAGCTCTCACACTGCCCGG - Intronic
1059023990 9:110604998-110605020 ACATCAGGTTTCCCACATCCTGG + Intergenic
1060947040 9:127575822-127575844 AATCCATGTTTCACACAGCCAGG - Intronic
1185836264 X:3347446-3347468 ATTCCAGGTCTGACTTATCCAGG - Intergenic
1186015582 X:5189231-5189253 ACACCAGGTCTCAGCCATCCAGG - Intergenic
1186611638 X:11143737-11143759 ACTCCAAGTCTCAGATATCTGGG - Intronic
1187089830 X:16084333-16084355 AGTCCAGGTGTCCTACATCCTGG + Intergenic
1187977885 X:24722082-24722104 ACTCCTTTTTTCACACATCCTGG - Intronic
1190254874 X:48754802-48754824 ACTCCAGGAATCACACACACTGG - Intergenic
1193296317 X:79836078-79836100 ACTCCAGGGGTCACACTTCTGGG - Intergenic