ID: 912911283

View in Genome Browser
Species Human (GRCh38)
Location 1:113760898-113760920
Sequence CTGTTGAGCTTCAAGACAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912911281_912911283 5 Left 912911281 1:113760870-113760892 CCTTTCCTTAGTGCTAAACATTA 0: 1
1: 0
2: 2
3: 11
4: 142
Right 912911283 1:113760898-113760920 CTGTTGAGCTTCAAGACAAATGG 0: 1
1: 0
2: 0
3: 8
4: 162
912911282_912911283 0 Left 912911282 1:113760875-113760897 CCTTAGTGCTAAACATTACAATT 0: 1
1: 0
2: 0
3: 19
4: 182
Right 912911283 1:113760898-113760920 CTGTTGAGCTTCAAGACAAATGG 0: 1
1: 0
2: 0
3: 8
4: 162
912911280_912911283 19 Left 912911280 1:113760856-113760878 CCTTGACAGCTTTTCCTTTCCTT 0: 1
1: 0
2: 12
3: 83
4: 662
Right 912911283 1:113760898-113760920 CTGTTGAGCTTCAAGACAAATGG 0: 1
1: 0
2: 0
3: 8
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912911283 Original CRISPR CTGTTGAGCTTCAAGACAAA TGG Intergenic
903224013 1:21884919-21884941 CTGGTGAGCCCCAAGACAAGTGG + Intronic
903242466 1:21992658-21992680 TTGTTGAGCTGCTAGAGAAAAGG + Intronic
903245975 1:22015843-22015865 TTGTTGAGCTGCTAGAGAAAAGG + Intergenic
905420399 1:37839105-37839127 CTGTAGAACTTTATGACAAAGGG - Intronic
908032574 1:60016864-60016886 CTGTTCAGCATCAAGCCCAAGGG + Intronic
912911283 1:113760898-113760920 CTGTTGAGCTTCAAGACAAATGG + Intergenic
913942524 1:125121116-125121138 CTGATGAGCTTAAAAAAAAAAGG + Intergenic
915281404 1:154824802-154824824 GTTTTGAGCTTTAGGACAAAAGG - Intronic
915816199 1:158968451-158968473 CTGGTGAGCTTGCAGAGAAAAGG + Intronic
917302541 1:173591510-173591532 CTGTCGAGGTTCCAGAGAAAAGG - Intronic
919137798 1:193532528-193532550 CTGGTGAGGTTCCAGAGAAAGGG + Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921763135 1:218940331-218940353 ATGTTAATCCTCAAGACAAAGGG + Intergenic
922412822 1:225392300-225392322 CTGCTGTGCTTCAAGACTATGGG + Intronic
923291468 1:232550210-232550232 CTGTTGAGCTTTTAGACAGATGG - Intronic
924831331 1:247598473-247598495 CTGTTGACCCACAAGACAACTGG - Intergenic
1064064259 10:12167443-12167465 CTGTTGAGCTTTAAAAAAATTGG + Exonic
1065836296 10:29661217-29661239 CTGGTTTGCTTAAAGACAAAGGG + Intronic
1072240884 10:93494822-93494844 CTGTTCACCTTCAAGCCAAATGG - Intergenic
1075189249 10:120291280-120291302 CTGGTGACCTTAAAGAAAAATGG + Intergenic
1083536195 11:63468822-63468844 CTCTTGTACTGCAAGACAAAGGG + Intronic
1086022101 11:82242576-82242598 CTGGTGAGGTTGAAGAGAAAAGG - Intergenic
1088270939 11:108033812-108033834 CTCTTCAGTTTGAAGACAAATGG + Exonic
1089658073 11:119966371-119966393 CTGTAGAGCTTTGAGACTAACGG - Intergenic
1095553204 12:43469819-43469841 TTGTTGTGCTTTAAGAGAAATGG + Intronic
1095703190 12:45211977-45211999 CTGTTGAGGTTGTAGAGAAAAGG + Intergenic
1100016027 12:90011875-90011897 ATGTTGAGTTTCAAGAGAAAGGG + Intergenic
1100660064 12:96687066-96687088 CTGTTGGTCTTGAAGACAGAAGG - Intronic
1100793353 12:98154299-98154321 CTGTTCAGGTTCCAGACAAGTGG - Intergenic
1101523726 12:105508172-105508194 GTGGTGAGCTTCAGGAAAAACGG - Intergenic
1102079873 12:110089434-110089456 CTGAAGAGCTCCAAGTCAAATGG + Intergenic
1102200747 12:111056055-111056077 CTGTTGAGATCCGAGGCAAAAGG + Intronic
1109086940 13:57985961-57985983 CTGGTGAGGTTGCAGACAAAAGG + Intergenic
1112830682 13:103446427-103446449 CTGGTGAGGTTGCAGACAAAAGG + Intergenic
1113440425 13:110324118-110324140 TTCTTGAGCTTCAATGCAAAGGG + Intronic
1113975421 13:114224494-114224516 CAGTTGCGCTTCACGACACAGGG - Intergenic
1114380459 14:22198376-22198398 ATGTTAATCCTCAAGACAAATGG + Intergenic
1114413835 14:22525785-22525807 CTCTTTAGTTTCAAGACTAAAGG - Intergenic
1115012569 14:28567211-28567233 CTGTTGAGGTTGCAGAGAAAAGG - Intergenic
1115391850 14:32862751-32862773 CTGGTGAGCTTGTAGAGAAAAGG - Intergenic
1116724525 14:48545567-48545589 CTGGTGAGGTTGTAGACAAAAGG - Intergenic
1118178447 14:63466125-63466147 ATGTTAATCTTCAAAACAAATGG - Intronic
1119108299 14:71945649-71945671 CTGTTCTGCTTCTAGAAAAAAGG - Intronic
1125016480 15:34941766-34941788 CTATTGAGCTTATAGAGAAAGGG - Intronic
1126986597 15:54318165-54318187 CTGTTGTGCTGCAATACACATGG + Intronic
1127359689 15:58234266-58234288 CTATCAAGGTTCAAGACAAAAGG - Intronic
1127704444 15:61533206-61533228 CTGTTGACCTTCAAGTCAGAAGG + Intergenic
1129996005 15:80006821-80006843 CTGCTGTGCTCCAGGACAAATGG - Intergenic
1132049157 15:98592447-98592469 CCCTTGAGCTTCATGAGAAAGGG + Intergenic
1136696025 16:32082960-32082982 CTGATGAGCTTAAAAAAAAAAGG - Intergenic
1136796519 16:33026214-33026236 CTGATGAGCTTAAAAAAAAAAGG - Intergenic
1137246995 16:46713910-46713932 CTGTTCAGCTTCAAAAGATAAGG - Intronic
1138730696 16:59191003-59191025 CTGTTCAATTTCAAGACAGAAGG + Intergenic
1140503334 16:75453701-75453723 ATGTTTGGCTTGAAGACAAATGG + Intronic
1144503111 17:15806797-15806819 CTGTTGAGGTTCCAGGCCAAAGG + Intergenic
1145165292 17:20609503-20609525 CTGTTGAGGTTCCAGGCCAAAGG + Intergenic
1148570944 17:48668561-48668583 CTGTGGGGCTTCCAGACAAATGG + Intergenic
1149303151 17:55324135-55324157 CTGTTGTATTTGAAGACAAAAGG - Exonic
1157801770 18:50626943-50626965 TTGTTAATCTGCAAGACAAATGG + Intronic
1157972280 18:52284316-52284338 CTCTTGAGCTTCGAGCCAATTGG - Intergenic
1160097296 18:75886580-75886602 CTTTTGTGCTTCAAGACCTAAGG - Intergenic
1160597368 18:79985933-79985955 CTGTTGAGCTTCTCCAAAAAAGG + Intronic
1161741631 19:6024468-6024490 CTTTTTTGCTTCAAGACAATCGG + Intronic
1163526823 19:17826540-17826562 TTGTTAAGGTTCAAGACAGATGG - Exonic
1165122284 19:33567870-33567892 CTTTTCAGCTTCAATAAAAACGG + Intergenic
1168575858 19:57508287-57508309 CTCTGGAGCTCCAAGACAGAGGG - Intronic
926693413 2:15753611-15753633 CTGTTGAGATTTAGGACAAGAGG - Intergenic
927332402 2:21881099-21881121 CTGGTCAGCTTCATGAGAAATGG + Intergenic
929913664 2:46115507-46115529 CTGAGGAGCTTGAAGAGAAATGG - Intronic
931169861 2:59791200-59791222 CTGTGGATCTTCATGTCAAAAGG - Intergenic
931202581 2:60113254-60113276 ATGTTTAGCTTCATGACAAAGGG + Intergenic
931826998 2:66010961-66010983 CTGTAAAGCTTCATGAGAAATGG - Intergenic
931882582 2:66582318-66582340 CTAATCTGCTTCAAGACAAAGGG - Intergenic
933498534 2:83082639-83082661 CAGTGGAGCTACAAGATAAAAGG + Intergenic
939188382 2:138886925-138886947 GTGTTTAGCTTCATGACAAAGGG - Intergenic
939654281 2:144803719-144803741 GTCTTGAGCTTCAAGAGATATGG + Intergenic
940344769 2:152617814-152617836 CTGGAGAGCTTTAAGGCAAATGG + Intronic
942460752 2:176166739-176166761 CTGTTCCTCATCAAGACAAATGG + Intronic
943128740 2:183829898-183829920 ATGCTGAGTTTCAAGACAGATGG - Intergenic
943599994 2:189905533-189905555 CTGCAGACCTTGAAGACAAAAGG - Intronic
944014445 2:195017808-195017830 CTGTTGAGCTTACAGTCTAAGGG + Intergenic
948371464 2:237492224-237492246 CTGATGAACTTCAAAAAAAAAGG + Intronic
1169639007 20:7727305-7727327 CTGCTGAGATTCAAGGGAAAGGG + Intergenic
1170642453 20:18166638-18166660 CTGCTGAGTTTCACAACAAAGGG - Intronic
1172864373 20:38084348-38084370 CTGTTGTGCTACAGGACATATGG - Intronic
1174701109 20:52610643-52610665 CAGTTGAGCTTTAAAAGAAAAGG - Intergenic
1174779390 20:53374620-53374642 CTGGTGAGCTTGCAGAGAAAAGG - Intronic
1174879820 20:54267060-54267082 CTGCTGCGCTTGAAGACACAAGG + Intergenic
1181377033 22:22467362-22467384 CTGGTGAGCTGCATGGCAAAAGG + Intergenic
1182696038 22:32199964-32199986 CTGAGGAGCTCCAAGCCAAAAGG + Intronic
1182716056 22:32356920-32356942 CTGAGGAGCTCCAAGCCAAAAGG - Intronic
1182867992 22:33621708-33621730 GAGTTGAGATACAAGACAAAAGG - Intronic
1183562186 22:38583965-38583987 CATTTGAGCTTCAAGGCACAAGG - Intronic
1203324737 22_KI270738v1_random:3372-3394 CTGATGAGCTTAAAAAAAAAAGG - Intergenic
951337964 3:21447152-21447174 CTGATAAGCACCAAGACAAATGG + Intronic
951575880 3:24113471-24113493 CTGGTGAGCGCCAAAACAAAGGG - Intergenic
951907574 3:27720290-27720312 TTCTTGAGCTTCAACATAAACGG - Exonic
955344143 3:58148684-58148706 CTGGTCAGCATCAAGAAAAATGG + Exonic
957313353 3:78546770-78546792 TTGTTGGGCTCCAAGTCAAAAGG + Intergenic
957380400 3:79420741-79420763 CTGGTGAGCTTGCAGAGAAAAGG + Intronic
959008783 3:101050309-101050331 TGGGTGAGCTTCAAAACAAAGGG - Intergenic
961320717 3:126072625-126072647 CTGGTGAGGTTGTAGACAAAAGG + Intronic
966539677 3:181075382-181075404 CTGTTGAGCTTCCAGGGAGAGGG - Intergenic
967996976 3:195174188-195174210 CTTTTGAGGCTCTAGACAAAGGG - Intronic
971350020 4:25847136-25847158 CTTTGGAGTTTGAAGACAAAAGG - Intronic
971733489 4:30416646-30416668 ATGTTAATCTTCAAGACAATGGG + Intergenic
974365644 4:60945753-60945775 ATGCAGAGCGTCAAGACAAAGGG - Intergenic
974600887 4:64077774-64077796 CTGTTAAACTTCAAGTTAAACGG + Intergenic
974915442 4:68173341-68173363 ATGTTAATCTTCAAGACAATGGG + Intergenic
977156398 4:93579328-93579350 ATATTGAGCTTCCCGACAAAAGG - Intronic
977189082 4:93977584-93977606 ATGTTAATCTTCAAGACAATGGG + Intergenic
978043447 4:104098135-104098157 CTGGTGAGGTTGAAGAGAAAGGG + Intergenic
978440864 4:108731971-108731993 GTGTTAAGCTTCATGACAATGGG - Intergenic
979626153 4:122847769-122847791 ATGTTGTGGTTCAAGACCAAAGG + Intronic
979923061 4:126525032-126525054 ATGTTAATCTTCAAGACAATGGG - Intergenic
982386310 4:154807707-154807729 CTGTGAAGCTTCAAAACAGAAGG + Intronic
984219518 4:176955769-176955791 ATGTTAAGCATCAAGACAATGGG - Intergenic
984881741 4:184415471-184415493 CTGTAGAGATCCCAGACAAACGG + Intronic
987461942 5:18223057-18223079 ATGTTAAGCATCAAGACAATGGG + Intergenic
987815646 5:22898120-22898142 ATGTTCAGATTCAAGAGAAAAGG - Intergenic
988018319 5:25590309-25590331 CTCTTGAGCTTCAAGGCACCAGG + Intergenic
988465599 5:31488485-31488507 GTGTTTAGCTTCTAGAAAAATGG + Intronic
990020324 5:51118657-51118679 CTGGTGAGCCTGAAGAGAAAAGG + Intergenic
992134925 5:73734679-73734701 CTGTTGATCTTCTAAACAGATGG + Intronic
992966100 5:82002145-82002167 CTGGTGAGGTTGAAGAGAAAAGG + Intronic
993276987 5:85872705-85872727 ATGTGCAGCTTCATGACAAAAGG - Intergenic
993528941 5:89001809-89001831 TTATTGAGCTGCAAGAAAAAGGG + Intergenic
994408725 5:99379375-99379397 CTGTAGAGCAACAAGAAAAAGGG - Intergenic
995539545 5:113171194-113171216 CTCTTGAACCTAAAGACAAAAGG + Intronic
996309774 5:122091798-122091820 CTGGGAAACTTCAAGACAAATGG + Intergenic
998253063 5:140565440-140565462 ATGCTGAGCTTCTAGACCAATGG - Exonic
999826313 5:155276792-155276814 CTGAGGAGCGTGAAGACAAAAGG - Intergenic
1003002551 6:2349735-2349757 ATGTTTAGCTTCACCACAAAAGG - Intergenic
1003176630 6:3757097-3757119 CTGTTTCTCTTCAAAACAAAAGG + Intergenic
1003693196 6:8375259-8375281 CTGTTGAGCTCTAAGTCAACTGG - Intergenic
1004268373 6:14170200-14170222 CTGTTGAAGCTAAAGACAAAGGG + Intergenic
1010005482 6:70991344-70991366 ATGTTAAGCATCAAGACAATGGG + Intergenic
1012141098 6:95627907-95627929 CTGGTGAGGTTGAAGAGAAAAGG + Intergenic
1013933089 6:115558897-115558919 TTGTAGAGGTTCATGACAAAAGG + Intergenic
1016525557 6:144998149-144998171 CTTCTGAGCTTAAAGAAAAAAGG + Intergenic
1017173664 6:151481430-151481452 CTGTTGACCTTGTAAACAAAGGG - Intergenic
1021572437 7:22080131-22080153 CTGGTGAGGTTCCAGAGAAAGGG + Intergenic
1021973495 7:25987930-25987952 CTGGTTAGCTTCCAGATAAAAGG + Intergenic
1022669771 7:32445071-32445093 CTGGTGAGGTTGAAGAGAAAAGG + Intergenic
1024430538 7:49283158-49283180 CTCTTGAGATACAAAACAAATGG - Intergenic
1024987637 7:55209108-55209130 CTGTGGAGCTTCAAAAGAAGGGG + Exonic
1025320628 7:58089581-58089603 CTGATGAGCTTAAAAAAAAAAGG + Intergenic
1033021223 7:137726256-137726278 ATGGAGAGCTTCAAGACATATGG - Intronic
1035852529 8:2934824-2934846 CTGTTGAACTGCAAGACATTCGG + Intergenic
1037184245 8:16042399-16042421 ATGTTGAGGTTCAGGCCAAATGG + Intergenic
1043737920 8:83770051-83770073 CTGGTGAGGTTGAAGAGAAAAGG + Intergenic
1052679147 9:31666533-31666555 CTGATTTGCTTCAACACAAATGG - Intergenic
1053616676 9:39773978-39774000 GTGTTAAGTATCAAGACAAATGG + Intergenic
1053874842 9:42533295-42533317 GTGTTAAGTATCAAGACAAATGG + Intergenic
1053897774 9:42761295-42761317 GTGTTAAGTATCAAGACAAATGG - Intergenic
1054236840 9:62568405-62568427 GTGTTAAGTATCAAGACAAATGG - Intergenic
1054267491 9:62933460-62933482 GTGTTAAGTATCAAGACAAATGG - Intergenic
1054550978 9:66602912-66602934 GTGTTAAGTATCAAGACAAATGG - Intergenic
1056327159 9:85489494-85489516 GTGTTTAGCTTCAAGACGAAGGG + Intergenic
1056780675 9:89547900-89547922 TTGGTGAGCTTCAAGAGCAAGGG - Intergenic
1056987373 9:91375815-91375837 CAGTTGCATTTCAAGACAAAAGG + Intergenic
1058678748 9:107423481-107423503 CTACTGAGCTTCAAGATTAAGGG - Intergenic
1191219327 X:57970170-57970192 CTGGTGAGGTTTCAGACAAAAGG - Intergenic
1191973838 X:66848217-66848239 CTGTTGAGCTACAAAATAGAAGG - Intergenic
1192024972 X:67440237-67440259 CTGTTTATTTTAAAGACAAATGG + Intergenic
1194432225 X:93823350-93823372 TTCTTGAGCTTCAATGCAAAGGG + Intergenic
1194654256 X:96552719-96552741 CTATTGAGCTTCTAGAAAACAGG - Intergenic
1194670752 X:96729453-96729475 CTGATCAGCTTCAGGACTAAGGG - Intronic
1196189022 X:112775583-112775605 CTTTTGAGCTTCAAGGTAATAGG - Exonic
1196584520 X:117414523-117414545 CTGTTGAGATTGCAGAGAAAAGG + Intergenic
1198890596 X:141391384-141391406 CTGGTGAGGTTCAGGAGAAAAGG - Intergenic