ID: 912917386

View in Genome Browser
Species Human (GRCh38)
Location 1:113829099-113829121
Sequence ACATGGGAGTAGGGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 449}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912917386_912917393 22 Left 912917386 1:113829099-113829121 CCTGCTTCCCCCTACTCCCATGT 0: 1
1: 0
2: 0
3: 27
4: 449
Right 912917393 1:113829144-113829166 AGTTCCAGAAATAAACAAGTTGG 0: 1
1: 0
2: 4
3: 32
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912917386 Original CRISPR ACATGGGAGTAGGGGGAAGC AGG (reversed) Intronic
902038297 1:13473513-13473535 AGGCGGGAGAAGGGGGAAGCAGG + Intergenic
902618489 1:17636952-17636974 AGATGGGGGTAGGGGGTGGCAGG - Intronic
902862628 1:19257189-19257211 ACATGGGAGTAGTGGGAGAGAGG - Intronic
902969647 1:20038017-20038039 CCAGGGAAGTAGGGGGAAGCTGG + Intronic
903190064 1:21651367-21651389 ATGTGGGAGTAGGGGCAGGCAGG - Intronic
903266078 1:22158928-22158950 GCATGGGAGTTGGGGCAGGCAGG - Intergenic
904971467 1:34422303-34422325 AAATGGGAGCATGGGGAAGGGGG + Intergenic
905031822 1:34889458-34889480 AAATGGATGTTGGGGGAAGCAGG - Intronic
905201416 1:36319551-36319573 ACATGGGAGAGTGGGGATGCTGG + Intronic
905228174 1:36493346-36493368 ACAAGGGAGTAGAGGGATGGTGG + Intergenic
905425191 1:37878173-37878195 ACATCGGGGTAGGTGGCAGCTGG - Exonic
905497396 1:38403494-38403516 ACAGGGAAGTGGGGGAAAGCTGG - Intergenic
905961918 1:42050143-42050165 GGATGGGAGTAGAGGGAAGCTGG + Intergenic
906240401 1:44239044-44239066 ACCAGGGAGTGGGAGGAAGCTGG - Intronic
906260010 1:44379909-44379931 ACATGGGGGTGGGGGGAGGGGGG - Intergenic
906479246 1:46189452-46189474 ACTCACGAGTAGGGGGAAGCCGG + Intronic
906509171 1:46401095-46401117 GGAGGGGAGGAGGGGGAAGCAGG + Intronic
907639350 1:56170604-56170626 ACCTGAGAGTTGGGGGTAGCTGG + Intergenic
907703257 1:56810381-56810403 ACAGGGGAGTGAGGGGAAGAGGG - Intronic
908036464 1:60059609-60059631 ACATGGGAGGTGGGGCCAGCGGG - Intronic
909101080 1:71349315-71349337 ACATGGGAGTGGGGGTTACCTGG - Intergenic
909605723 1:77506387-77506409 AGATGGGGGTAGGGTGAAGATGG + Intronic
909673562 1:78214432-78214454 TCAGGGAAGTAGGGGAAAGCCGG - Intergenic
909791186 1:79680233-79680255 GCATGGGAGTGGGGTGAGGCTGG - Intergenic
910708527 1:90155099-90155121 CCAGGGAAGTAGGGGAAAGCTGG + Intergenic
910993498 1:93079570-93079592 AGATGGGGGTTGGGGGAAGGAGG + Intronic
911187006 1:94914475-94914497 AGATGGGAGCATGGGGATGCGGG - Intronic
912005932 1:104901778-104901800 ACATGGGGGTAGGGGGCACATGG + Intergenic
912917386 1:113829099-113829121 ACATGGGAGTAGGGGGAAGCAGG - Intronic
913048126 1:115090206-115090228 AGATGGGAGAAAGGGGAAGGGGG + Intergenic
915895854 1:159810073-159810095 ACCTGGGAGCAGGGAGAAGAAGG - Exonic
916452309 1:164932764-164932786 TCAGGGGAGGAGGGGCAAGCTGG - Intergenic
916804508 1:168245096-168245118 AATTGGGAGTAGGGGGAAAGAGG + Exonic
917246284 1:173004722-173004744 CCATGGTAGTGGGGGGAAGGTGG + Intergenic
917696713 1:177533150-177533172 ACATGAGATTTGGGAGAAGCTGG - Intergenic
918204596 1:182297824-182297846 GCCTGGCAGTAGGGGGAAGGGGG - Intergenic
920263199 1:204703561-204703583 ACTTGGGAGTAGGGAGACACGGG - Intergenic
920291920 1:204929344-204929366 AGGAGGGAGGAGGGGGAAGCAGG + Intronic
920526687 1:206672210-206672232 AGATAGGAGTGGAGGGAAGCGGG - Intronic
920539504 1:206767476-206767498 TCCTGGGGGTAGGGGGTAGCTGG + Intergenic
920987290 1:210902453-210902475 ACATGGTGGTGGGAGGAAGCTGG + Intronic
920989742 1:210925600-210925622 CCAGGGAAGTAGGGGAAAGCTGG - Intronic
922201260 1:223403484-223403506 ATATGGTAGAAGGGGGCAGCTGG - Intergenic
922202586 1:223418709-223418731 TGATGGGGGTTGGGGGAAGCAGG - Intergenic
922583293 1:226714574-226714596 GCATGGCAGCAGGAGGAAGCAGG - Intronic
923173965 1:231445555-231445577 CCATGGAAGTGGGGGAAAGCTGG - Intergenic
924483246 1:244455250-244455272 TCATGGGAGCGGGGGGACGCGGG - Intronic
924587313 1:245371386-245371408 AAGTGGGAGTATGGGTAAGCAGG - Intronic
1063923804 10:10957684-10957706 ACATGTGAGCAAGGAGAAGCTGG - Intergenic
1065045809 10:21746896-21746918 AGATGGGAGAAGGGAGAAGGTGG + Intergenic
1065739520 10:28784556-28784578 CCATGGGATTGGGGGGAAGGAGG - Intergenic
1066302004 10:34105538-34105560 TCATGGGAGTAGAGGGCAGGAGG - Intergenic
1066465866 10:35649636-35649658 ACATGGCAGTAGGGGGTTGGGGG + Intergenic
1066639898 10:37545448-37545470 ACTTGGGAGTAGTGGTAAGGAGG + Intergenic
1067048128 10:42997357-42997379 ACATGTGATCAGAGGGAAGCTGG - Intergenic
1067925141 10:50501089-50501111 ACATGGGATGAGAGGGAAGGAGG - Intronic
1068604596 10:58990971-58990993 ACATGAGATTTGGGAGAAGCTGG + Intergenic
1069077526 10:64053374-64053396 GCATGGGACAAGGGGGAAGAAGG + Intergenic
1069807508 10:71135097-71135119 ACCCCGCAGTAGGGGGAAGCTGG - Intergenic
1069893203 10:71664809-71664831 AGAAGGGAGGAGGGGGAAGGGGG - Intronic
1070195606 10:74153551-74153573 ACGTGGGATTAGGGGAAAGAAGG + Intronic
1071226841 10:83540224-83540246 ACATGGGTGAAGCAGGAAGCAGG - Intergenic
1071881089 10:89898677-89898699 ACATGGGAGTGGGGAGCAGCAGG + Intergenic
1072071817 10:91925138-91925160 CCATGGGAGTTGGGTGAAGGGGG + Intronic
1072289680 10:93952540-93952562 ACATGGGGGTGGGGTGAGGCGGG + Intronic
1072308669 10:94133222-94133244 AGATGGGAGTAGCTGGAAGATGG - Intronic
1072388194 10:94954412-94954434 ACATCGGAAAAGGGGGAAGGAGG - Intronic
1072528409 10:96295487-96295509 TGATGGGGGTAGGGGGAAGTAGG - Intergenic
1073067772 10:100773922-100773944 TCCTGGGAGCTGGGGGAAGCAGG - Intronic
1073467091 10:103700594-103700616 CCATGGGAGTGGGAGGAGGCAGG + Intronic
1075902911 10:126057580-126057602 ACATTGGAGTTTGGGGCAGCAGG - Intronic
1076035566 10:127196363-127196385 ACATCGGAGGAGCGCGAAGCCGG - Intronic
1076772720 10:132675436-132675458 TCAAGGCAGTTGGGGGAAGCGGG + Intronic
1076977190 11:182737-182759 ACATGGCAGAATGGGGAAACGGG - Intronic
1077026512 11:442227-442249 ACCTGGTCCTAGGGGGAAGCAGG + Intergenic
1077255074 11:1577658-1577680 ACATGGGAGTTGGGGGCAGGGGG - Intergenic
1077358275 11:2128528-2128550 GCATGGGAGGAGGGGTAGGCTGG - Intergenic
1079089064 11:17468108-17468130 GAATGGGAGCTGGGGGAAGCAGG - Intronic
1080002861 11:27370578-27370600 ACAGCTGAGTAGGGGGAGGCAGG + Intronic
1080388484 11:31824057-31824079 ACATGGAATTAGTTGGAAGCGGG + Intronic
1080389750 11:31834106-31834128 CCATGGGAGTGGGTGGTAGCTGG + Intronic
1083615410 11:64023702-64023724 ACAGGGGAGTCGGGGAAAGGAGG - Intronic
1085249399 11:75132332-75132354 AGACGGGAGTTGGGGGAAGAGGG + Intronic
1085317660 11:75555232-75555254 GCCTGGGAGAAGGGGGAAGGAGG - Intergenic
1086284850 11:85235561-85235583 ACAAGGGAGTTGGGGGAAGACGG + Intronic
1087170561 11:95045615-95045637 GAAAGGGAGGAGGGGGAAGCAGG - Intergenic
1088088412 11:106008527-106008549 ATTTGGGAGTAGGGGGTAGGTGG - Exonic
1088121873 11:106379518-106379540 AAGTGGGAGTGGGGGGAAGGGGG - Intergenic
1088363568 11:109016425-109016447 AGATGGGAGATGGGGGAAGGTGG + Intergenic
1088542911 11:110931696-110931718 AAATGGGAGGAGGGGAAAGAAGG - Intergenic
1088995075 11:114989114-114989136 ACCTGGGAGTGTAGGGAAGCGGG - Intergenic
1089292895 11:117449192-117449214 ACCTGGGAGGAGGGGCAGGCGGG + Intronic
1089308011 11:117538805-117538827 ACAGGGGAGGAGGGGGAAACTGG + Intronic
1089392099 11:118109099-118109121 AGATGGTAGAAGGGGGAAACTGG - Intronic
1089420539 11:118330097-118330119 ACATGGTAGAAGGGGCAAGGGGG + Intergenic
1089836932 11:121379047-121379069 CCAAGGAAGTAGGGGAAAGCTGG - Intergenic
1091125660 11:133093238-133093260 ACATTGGATTTGGGGGACGCAGG - Intronic
1092209734 12:6638515-6638537 ACAGGGCAGTAGAGGGAAGGAGG + Intronic
1092518922 12:9246247-9246269 ACATTGAAGAAGGGGGAAGCTGG - Intergenic
1093548148 12:20371113-20371135 ACGTGGGAGGAGGAGGAACCTGG + Intronic
1095115261 12:38344782-38344804 TCAGGGAAGTGGGGGGAAGCTGG - Intergenic
1096095489 12:48932772-48932794 AGGTGGAAGTGGGGGGAAGCAGG + Intronic
1096746781 12:53733896-53733918 CTATGGGAATCGGGGGAAGCGGG + Intergenic
1096820815 12:54232617-54232639 ACTTGGGAGCAGAGGGAAGTTGG + Exonic
1096956336 12:55529874-55529896 CCAGGGAAGTAGGGGAAAGCTGG - Intergenic
1097295468 12:57958106-57958128 TCAGGGAAGTAGGGGAAAGCCGG - Intergenic
1098246541 12:68524981-68525003 ACATGGTAGAAGGTGGAAGTGGG - Intergenic
1100490062 12:95070778-95070800 AAATGAGAATAGGGGGAAGTCGG - Intronic
1101465353 12:104943556-104943578 ACATCGGAGTATGGGCTAGCAGG - Intronic
1102454655 12:113064027-113064049 TCAAGGGAGAAGGGGGAAGGGGG - Intronic
1102699189 12:114824254-114824276 AAGTGGCGGTAGGGGGAAGCTGG + Intergenic
1102727077 12:115075072-115075094 ACATGGCAGTTGTGGGAGGCAGG + Intergenic
1105927272 13:25018981-25019003 ACATGTGAGGAGGGGCAATCGGG + Intergenic
1106099044 13:26678993-26679015 ACACGGGAGGAGGAGGAAGAGGG - Intronic
1106742440 13:32660214-32660236 ACAGGAGAGAAGGGGGAAGCTGG + Intronic
1107001394 13:35549784-35549806 ACAAGGGAATTTGGGGAAGCAGG + Intronic
1108336169 13:49444215-49444237 ACATGGGAGGAGTCGGACGCCGG - Intergenic
1108346426 13:49551135-49551157 AGAAGGGGGAAGGGGGAAGCAGG + Intronic
1108624974 13:52218883-52218905 ACATGGGGGTTGGGGTAAGAAGG - Intergenic
1108661078 13:52587534-52587556 ACATGGGGGTTGGGGTAAGAAGG + Intergenic
1108687327 13:52832069-52832091 TCATGGCAGTAAGGGGAAGCAGG + Intergenic
1109281865 13:60366049-60366071 ACCTGAGAGTTGGGGGAAGGAGG + Intergenic
1109379773 13:61543995-61544017 AGAAAGGAGCAGGGGGAAGCTGG + Intergenic
1110047306 13:70846255-70846277 GGATGGGAACAGGGGGAAGCAGG - Intergenic
1111968584 13:94886351-94886373 ACATGGGGGTAGGGGGGAGGGGG - Intergenic
1112093250 13:96105266-96105288 ACATGGAAGTAGGAGGAGGGAGG + Intronic
1112401931 13:99085820-99085842 ACATGGAAGGAGAGGGAGGCCGG + Intronic
1112916744 13:104560505-104560527 ACCTAGGAGTACGGGTAAGCAGG - Intergenic
1113070901 13:106420215-106420237 AGATGGGAGATGGGGGAAGACGG - Intergenic
1114584529 14:23798269-23798291 ACATGGAAGAAGGTGGAAGGGGG - Intergenic
1115078241 14:29417026-29417048 GCATGGGAGGAGGGAGAAGATGG - Intergenic
1115414040 14:33110895-33110917 ACATAGCAGTTGTGGGAAGCAGG + Intronic
1115969791 14:38932501-38932523 TCAGGGAAGTAGGGGAAAGCCGG - Intergenic
1117119311 14:52551945-52551967 ATCTGTGAGCAGGGGGAAGCTGG - Intronic
1117340799 14:54789484-54789506 CCATGGCAGTAGGGGAAAGAAGG + Exonic
1118313479 14:64709278-64709300 CCATGGGATTAGGGAGAAGAAGG + Intronic
1118482517 14:66181244-66181266 ACATGGCAGGAGTGAGAAGCAGG + Intergenic
1119936133 14:78593993-78594015 ACATGGGGGAAGGAGAAAGCTGG - Intronic
1121172254 14:91864322-91864344 GTAGGGGAGTAGGGGGAAGGAGG + Intronic
1121537259 14:94699376-94699398 ATTTGGGAGCAGGAGGAAGCAGG + Intergenic
1122378400 14:101284838-101284860 GGATGGGAGTAAGAGGAAGCTGG - Intergenic
1122888674 14:104722908-104722930 ACATGGGTGCAGGGGGCAGGAGG + Intergenic
1124973846 15:34515179-34515201 TCAAGGGAGGAGGGGGCAGCCGG - Intergenic
1125114392 15:36072352-36072374 GCATGTGTGTAGGGGGAAGGTGG - Intergenic
1127425329 15:58850219-58850241 ACATGGGAGGAGGGAGGAGATGG + Intronic
1128065761 15:64763515-64763537 ACATGGGATTTGGGGCAAGAGGG - Intronic
1129321398 15:74777074-74777096 ACATGAAAGTAGGGGGAAAGGGG - Intergenic
1129390192 15:75216420-75216442 AGCTGGGGGCAGGGGGAAGCTGG - Intergenic
1129732279 15:77939270-77939292 AGCTGGGGGCAGGGGGAAGCTGG + Intergenic
1129886633 15:79042601-79042623 ACAAGGCAGCAGGGGGAAGCTGG + Intronic
1129888016 15:79052228-79052250 AGAGGGGAGTAGGGTGGAGCAGG - Intronic
1130399865 15:83540920-83540942 GCAGGGGAGTAGAGGGAATCGGG - Intronic
1130423882 15:83775863-83775885 ACATGTAAATAGGGAGAAGCTGG - Intronic
1131565856 15:93484746-93484768 ACATGGGTGCAGGTGGAAGATGG - Intergenic
1132071006 15:98776581-98776603 ACAGGGAGGTAGGGGGAAGGAGG - Intronic
1132768196 16:1545700-1545722 ACATGGAATTATGGGGAGGCTGG + Intronic
1134770596 16:16806027-16806049 GGAAGGGAGAAGGGGGAAGCAGG - Intergenic
1135159716 16:20083004-20083026 ACTTGGGAGGAGGTGGAGGCAGG - Intergenic
1135353337 16:21749025-21749047 TCATGGGAATAGTGGGAAGAAGG + Intronic
1135451824 16:22565148-22565170 TCATGGGAATAGTGGGAAGAAGG + Intergenic
1137731576 16:50694008-50694030 ACAAGGGAGAAGGAGGAGGCAGG - Intronic
1138532026 16:57639730-57639752 ACAGGGGAGAAGCGGGGAGCAGG - Intronic
1140760947 16:78108300-78108322 AGAAGGAAGTAGGGGGAAGAAGG - Intronic
1141769750 16:86082626-86082648 GGATGGGAGGAGAGGGAAGCAGG + Intergenic
1142443066 16:90113943-90113965 ACATGGCAGAATGGGGAAACGGG + Intergenic
1142464328 17:120906-120928 ACATGGCAGAATGGGGAAACGGG - Intergenic
1143386862 17:6536131-6536153 ACATGGGAGGAGTGAGAAGTGGG + Intronic
1143918441 17:10312095-10312117 ACATGGGAGAAGCAGAAAGCAGG + Intronic
1144563822 17:16343759-16343781 ACAGGGGAGGTGGGGGAGGCAGG - Intronic
1145179931 17:20738992-20739014 ATAAGGGAGGAGGGGGAAGAGGG - Intergenic
1145934159 17:28705350-28705372 AGAAGGGAGGAGGGGGAAGTGGG - Intronic
1146487399 17:33254517-33254539 ACCTGGGGGTAAGAGGAAGCTGG - Intronic
1146583372 17:34059716-34059738 TCAGGGAAGTAGGGGAAAGCCGG - Intronic
1146645523 17:34574569-34574591 AGAAGGGAGAAGGGGGAAGGGGG + Exonic
1147586528 17:41656459-41656481 ACCTGGGAGCAGGAGGCAGCAGG - Intergenic
1147760094 17:42792320-42792342 CCCTGGGGATAGGGGGAAGCTGG - Intronic
1147915046 17:43880942-43880964 ACAGGGGAGCAGGGGGGAGTCGG + Intronic
1148237705 17:45980390-45980412 ACATGGGAGGAGTAGGAGGCAGG + Intronic
1148570899 17:48668134-48668156 ACATTGGAGGAAGAGGAAGCAGG + Intergenic
1149427958 17:56573165-56573187 ACATTGGAGAAGAAGGAAGCTGG + Intergenic
1149839648 17:59948676-59948698 ATAAGGGAGGAGGGGGAAGAGGG - Exonic
1150319523 17:64200839-64200861 AGATGGGGGTAGGGAGAAGAAGG - Intronic
1151626274 17:75277802-75277824 AGATGGGGGCAGGGGGAGGCTGG - Intronic
1152040021 17:77897130-77897152 TCCTGGGAGCAGGGGGGAGCTGG - Intergenic
1152482257 17:80562371-80562393 GCAGGGGAGTGAGGGGAAGCAGG - Intronic
1152788991 17:82268116-82268138 ACAGGGGAGTAGCTGGATGCAGG + Intronic
1153079923 18:1210520-1210542 TCAGGGAAGTAGGGGAAAGCGGG + Intergenic
1153532364 18:6060492-6060514 ACATGGGATTAGGGGTAAAGGGG - Intronic
1155108725 18:22692856-22692878 ACATGTGAGTAGGGAGTAGGGGG + Intergenic
1155386362 18:25282300-25282322 AGAGAGGAGTAGGGAGAAGCAGG + Intronic
1156864039 18:41868891-41868913 ACATGGGAGTAGTTTGAAACTGG + Intergenic
1157480334 18:48049954-48049976 GCATGGGAGGAGGTGGAGGCTGG - Intronic
1157600771 18:48891933-48891955 GCATGGGAGGAGGGGGCAGGAGG + Intergenic
1158657524 18:59352640-59352662 TCCTGGGAGTTGGGGGAAGAGGG - Intronic
1158915616 18:62124521-62124543 ACCTGTGAGTTGTGGGAAGCAGG - Intronic
1159560441 18:69987053-69987075 ACATGGCAGAAGGGGGAAAAGGG + Intergenic
1159889457 18:73940249-73940271 AGATGTGAGTGAGGGGAAGCAGG + Intergenic
1160176066 18:76595349-76595371 GGATGGGGGTAGGGGGAAGTAGG + Intergenic
1160238412 18:77104226-77104248 ACATGGGAGCAGGAGGAACGTGG + Intronic
1160726721 19:620819-620841 GCAGGGGAGAAGGGAGAAGCAGG + Intronic
1160925353 19:1542239-1542261 AGAAGGGAGTAGGGAGAAGAAGG - Intergenic
1161035072 19:2079935-2079957 TCAGGGGAGTAGGAGGACGCCGG - Intronic
1161268183 19:3374866-3374888 ACAAGGGAGGATGGGGCAGCAGG + Intronic
1161861105 19:6798912-6798934 AGGTGGGAGGAGGGGGAGGCAGG - Intronic
1162453639 19:10769429-10769451 ACCTGGGAGTAGGAGGAGGTAGG + Intronic
1163024756 19:14504297-14504319 ACTTGGGAGGAGGCTGAAGCAGG - Intergenic
1163701606 19:18789262-18789284 ACAGCGGACTCGGGGGAAGCAGG + Exonic
1164999467 19:32749164-32749186 ACCTGGGAGCAGTGGGAGGCTGG + Intronic
1165098239 19:33422065-33422087 ACAGGGGAGTAAGGGGGAGGTGG - Intronic
1165912346 19:39237078-39237100 AGGTGGGAGTAGAGGGAAGGGGG + Intergenic
1166360460 19:42250937-42250959 GAATGGGAGTGGGGGTAAGCTGG - Intronic
1166533157 19:43554516-43554538 CCATGGGATTATGGGGAGGCTGG - Intronic
926117695 2:10223804-10223826 CCATGGGGGTCGGGGGATGCAGG - Intergenic
926989448 2:18661804-18661826 ACACGACAGTTGGGGGAAGCAGG + Intergenic
928329731 2:30348452-30348474 ACATGGCAGTGGGTGGAACCGGG - Intergenic
928337738 2:30412569-30412591 AGAAGGGAGGAGGGAGAAGCAGG - Intergenic
928467607 2:31537371-31537393 CCATGGGAGGAGGGGGAAGGAGG - Intronic
928470310 2:31568792-31568814 GCATGGGAGGAGGGGCAAGTGGG - Intronic
928772556 2:34719739-34719761 TCAGGGAAGTAGGGGAAAGCTGG + Intergenic
928790506 2:34946161-34946183 AGCTGGGAGTAGGAGCAAGCTGG - Intergenic
929018924 2:37530955-37530977 ACATGACAGAAGGGGCAAGCAGG - Intergenic
929646278 2:43631940-43631962 ACATCGAAGTATTGGGAAGCAGG - Intergenic
929961332 2:46498430-46498452 AAATGGGAGAAAGGGGAGGCAGG - Intronic
930104384 2:47628562-47628584 ACATAGGAGTAGGGGCAATGAGG - Intergenic
931525240 2:63145524-63145546 TCAGGGAAGTAGGGGAAAGCCGG + Intronic
932875311 2:75444972-75444994 ACAAGGAAGCAGGGTGAAGCAGG + Intergenic
933240258 2:79913178-79913200 ACATGGGAGTTAGAGGACGCTGG + Intronic
933740303 2:85528471-85528493 AAATGGGAGAAGGGAGAAGATGG - Intergenic
934779565 2:96960929-96960951 GCATGGGCGTGGGCGGAAGCAGG + Intronic
934997167 2:98974450-98974472 TCATGGGGGTAGGGGAGAGCAGG + Intergenic
936503026 2:113081505-113081527 AGGTGGGAGTAGTGGGAAGAGGG + Intergenic
936614311 2:114033042-114033064 CCATGGGGGTTGGGGGCAGCAGG - Intergenic
937653305 2:124344949-124344971 ACTTGGAAGTGGGGAGAAGCAGG + Intronic
937997470 2:127706097-127706119 ACATGGGAGTTGGGGCAATGAGG + Exonic
938591188 2:132737614-132737636 AGCTGGGAGTAGGGAGCAGCAGG - Intronic
938614529 2:132983697-132983719 ACATGGGAGTCGGGAGGAGGGGG + Intronic
939731709 2:145792921-145792943 CCAGGGAAGTAGGGGGAAGATGG + Intergenic
941272456 2:163447873-163447895 AGTTGGGAGAAGGGGGGAGCAGG + Intergenic
941579078 2:167272733-167272755 GCATGGGAGTAGGTGGTTGCAGG - Intergenic
941631643 2:167891219-167891241 TCAGGGCAGTAGGGGAAAGCCGG + Intergenic
941733681 2:168948357-168948379 ACATTCTAGTAGGGAGAAGCTGG - Intronic
942925085 2:181421972-181421994 ACCAGAGAGTAGGAGGAAGCAGG + Intergenic
944508273 2:200438114-200438136 CCATGGGAGTAGAGAGAAGCAGG + Intronic
945070222 2:205981919-205981941 ACATGTGAGTAGGGGAAATAAGG - Intergenic
945315064 2:208361586-208361608 GCTTGGGAGTAGGGGGAAAGAGG - Intronic
946338880 2:219056044-219056066 ACATTGGAGTAAGGGGATGGGGG - Intronic
947125899 2:226868152-226868174 ACATGGGAGTAAGGTGAAAGGGG - Intronic
947374357 2:229480975-229480997 ACTGGGGTGTAGGAGGAAGCAGG + Intronic
948577655 2:238965014-238965036 AGGAGGGAGGAGGGGGAAGCAGG - Intergenic
948713958 2:239847007-239847029 TCAGGGAAGTGGGGGGAAGCCGG - Intergenic
1168846547 20:949036-949058 TCATGGCAGAAGGGGGAAGCAGG + Intergenic
1169722949 20:8699010-8699032 CCATTGGAGTAGGGGAAATCTGG + Intronic
1170851638 20:20009926-20009948 AAATGGGAGGAGGTGAAAGCTGG - Intergenic
1171459558 20:25291094-25291116 GCAGTGGAGTTGGGGGAAGCTGG - Intronic
1171971560 20:31568250-31568272 CCGGGGCAGTAGGGGGAAGCGGG - Intronic
1172004117 20:31805891-31805913 ACGTGGGAGTAGGGGAAGGAAGG - Intergenic
1172010706 20:31844358-31844380 ACTTGGGGGTGAGGGGAAGCAGG - Exonic
1172094107 20:32452343-32452365 TCCTGGGAGTAGGAGGAGGCTGG + Exonic
1172166677 20:32903811-32903833 CCATGGGAGTGGAGGGAAGTAGG + Intronic
1172223749 20:33290715-33290737 ACATCGGAGTAGGGGGCTGGGGG + Intronic
1172310562 20:33915191-33915213 ACTGGGGGGTGGGGGGAAGCTGG - Intergenic
1173733248 20:45342653-45342675 AGGTGGGGGTTGGGGGAAGCAGG + Intronic
1174107813 20:48175405-48175427 ACAAGGGAGTCTGGGGAAGCTGG - Intergenic
1174194316 20:48762231-48762253 CCAAAGGAGTAGGGAGAAGCTGG - Intronic
1174210403 20:48873822-48873844 TCTAGGGAGTAGGGGGAAGATGG - Intergenic
1179437017 21:41369178-41369200 CCATGGGAGGAGGGGGGTGCAGG + Intronic
1180851316 22:19023217-19023239 ACATGGGACCAGGGGGAGGGAGG - Intergenic
1180980819 22:19877239-19877261 ACATGGGGGATGGGGGAGGCAGG + Intronic
1181347624 22:22231577-22231599 ACATGGCAGAAGGGGTAAGAGGG - Intergenic
1182440812 22:30362783-30362805 ACATGGGGGTAGAGGAAAGAGGG + Intronic
1183858643 22:40653253-40653275 GCAGGGGAGAAGGGGGAAGGGGG + Intergenic
1184362518 22:44026822-44026844 CTAAGGGAGGAGGGGGAAGCTGG + Intronic
1185183597 22:49378829-49378851 ACCTGGGGGTAGGTGCAAGCGGG - Intergenic
949635589 3:5978436-5978458 ACATGGAGGGATGGGGAAGCTGG + Intergenic
950289304 3:11770864-11770886 ACCTGGGACTAGGGGGAGACAGG - Intergenic
951183775 3:19688678-19688700 ACAGGGAAGTGGGGGAAAGCCGG - Intergenic
953024124 3:39135023-39135045 GCATGGGTGTAGGGGGAGGCGGG - Intronic
954153909 3:48674260-48674282 ACATGGGTGTGGGGTGAAGAGGG + Exonic
954680706 3:52344457-52344479 AGATGGGAGATGGGGGAATCAGG - Intronic
955677306 3:61462416-61462438 ACACTGGAGTAGGGGGCAGGAGG + Intergenic
957581957 3:82085466-82085488 AGATGTGAGAAGGGGGAGGCAGG + Intergenic
959766485 3:110036321-110036343 ACATGGGATGGTGGGGAAGCTGG + Intergenic
959810475 3:110613389-110613411 AAATGGGAGTTGGGGGACTCAGG - Intergenic
959867925 3:111292401-111292423 CCAGGGAAGTAGGGGAAAGCCGG + Intergenic
959933919 3:112010732-112010754 ACATGGGAGGTGGGGGTAGAGGG + Intronic
960064335 3:113354518-113354540 ACAGGGAAGTTGGGGAAAGCTGG - Intronic
960582954 3:119295748-119295770 AGATGGGGGTAGGGGGGAGTTGG + Intronic
961173559 3:124816099-124816121 AGATGGGAGCAGTGGGAAGGGGG + Intronic
961554591 3:127689355-127689377 ACCTGGAAGTGGAGGGAAGCTGG + Exonic
961620511 3:128220512-128220534 ACCAGGGAATGGGGGGAAGCAGG - Intronic
961647288 3:128399441-128399463 AAAAGGAATTAGGGGGAAGCAGG - Intronic
965250235 3:166333163-166333185 ACTTGGGAATAGGGAGAAGAGGG + Intergenic
965874401 3:173299555-173299577 TCAGGGAAGTAGGGGAAAGCTGG + Intergenic
966299658 3:178463633-178463655 ACATGGAAGTAGAAGGAAGCTGG - Intronic
966310836 3:178591858-178591880 CCAGGGGAGTAGGGAAAAGCTGG - Intronic
966638973 3:182168266-182168288 GCATGGGAAAAGGGGGAAGGAGG - Intergenic
966908170 3:184542686-184542708 AGATGGGAGAAGGGGGGAGGGGG + Intronic
967014924 3:185473254-185473276 ACATGGCAGGAGGGGGCTGCTGG - Exonic
968363381 3:198165321-198165343 ACATGGCAGAATGGGGAAACGGG + Intergenic
969206618 4:5652034-5652056 ACCAGGGAACAGGGGGAAGCTGG + Intronic
970282927 4:14478395-14478417 CCAGGGAAGTGGGGGGAAGCTGG - Intergenic
970334194 4:15016538-15016560 GCAGGGGAGTTGGGGGAGGCCGG + Intronic
970588418 4:17536870-17536892 TCAAGGGAGTAGGAGGAAGGAGG + Intergenic
971176003 4:24283339-24283361 AAATGTGAGAAAGGGGAAGCAGG - Intergenic
973764284 4:54149422-54149444 CCATGGGAGTCGGGGGAGCCGGG + Intronic
973811235 4:54572216-54572238 ACATGGGTGTATGGGGGAGGAGG + Intergenic
974456414 4:62134168-62134190 ACATGTGACTAGAGGGAAGGAGG + Intergenic
975243812 4:72094591-72094613 CCAGGGAAGTAGGGGAAAGCCGG + Intronic
977635525 4:99293687-99293709 TCAGGGGAGTGGGGGAAAGCTGG - Intergenic
978006647 4:103625568-103625590 ATATGGGAGTAGGGGGTGGGGGG + Intronic
979080258 4:116329830-116329852 ACATGGCAGAAGGGGTAAACTGG - Intergenic
981912528 4:149998201-149998223 GCATGGAAGTAGAGGGAAGCAGG - Intergenic
982208762 4:153018308-153018330 ACATGGCAGTAGGAGGTAGGGGG + Intergenic
984528863 4:180890681-180890703 AAATGGGGGTAGTGGGAGGCAGG - Intergenic
984590367 4:181610664-181610686 ACTTCAGAGAAGGGGGAAGCAGG + Intergenic
984930950 4:184846690-184846712 ACGTGGGATTAGTGGGAACCAGG + Intergenic
986377570 5:7148162-7148184 ACATGGGGGTAGGAGGGAGGAGG + Intergenic
986788789 5:11140616-11140638 ACATGGGAAGAGAGGGAAGAAGG + Intronic
987370288 5:17186761-17186783 AAATGTGAAAAGGGGGAAGCCGG - Intronic
987752032 5:22052427-22052449 ACAGGGGATTAGAGGGAGGCAGG - Intronic
990950048 5:61289673-61289695 ACCTGGAAGTAGGGGGCACCAGG + Intergenic
993334069 5:86635032-86635054 ACATGGCAGAAGGGGCAAACAGG + Intergenic
993755810 5:91728247-91728269 ACATGGCAGAAGTGGGAAGAGGG + Intergenic
994491727 5:100454782-100454804 ATAAGGGATTTGGGGGAAGCTGG + Intergenic
994588186 5:101738315-101738337 CCATGGGAATAGTGGGAATCCGG + Intergenic
994770282 5:103973213-103973235 ACAGGGCAGTATGGGGAAGAGGG + Intergenic
994875287 5:105413871-105413893 TCAGGGAAGTAGGGGAAAGCCGG - Intergenic
994910538 5:105899783-105899805 AGATGGGAGTAGAGTGAAGAAGG - Intergenic
995493983 5:112722557-112722579 ACTTGGGACTGGGGGGAAGGAGG - Intronic
995742873 5:115373587-115373609 AGTTGGGAGTCGGGGGAAGAAGG - Intergenic
996967190 5:129320506-129320528 ACATGGGATTTGAGAGAAGCCGG - Intergenic
997758249 5:136420581-136420603 GCATAGGAGCAGGGGGCAGCTGG + Intergenic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
998280919 5:140807013-140807035 ACATGAGAGAAGGAGGAAGAAGG + Intronic
999449091 5:151665163-151665185 GGATGGGAGGAGGAGGAAGCGGG + Intronic
999691266 5:154147871-154147893 ACATGGGAGTTGGGGGTAAGTGG - Intronic
999780643 5:154847383-154847405 ACATGGGAATAAGGTGAGGCTGG + Intronic
1000130004 5:158287962-158287984 ACAAGGGAGAACTGGGAAGCAGG + Intergenic
1000298277 5:159931782-159931804 ACATGGCAGAAGGGGCAAACAGG + Intronic
1000931994 5:167262973-167262995 ACATGGTTGAAGGGGCAAGCAGG + Intergenic
1001031775 5:168268578-168268600 ACAAGGCAGGAGGGGGTAGCAGG + Intergenic
1001276646 5:170356052-170356074 ACATGGGAGCAGGGCCAGGCTGG + Intronic
1001370383 5:171194072-171194094 ACTGGGGAGTTGGGGGAAGTGGG - Intronic
1001905577 5:175470042-175470064 CCAGGGGAGCAGGAGGAAGCTGG + Intergenic
1002451448 5:179321352-179321374 GCAAGGGAGTGGAGGGAAGCTGG - Intronic
1002489118 5:179561354-179561376 TCAGGGGAGTAGGGAGAGGCTGG + Intronic
1002927403 6:1612449-1612471 AGACGGGAGGAGGGGAAAGCAGG - Exonic
1002934445 6:1659660-1659682 ATATGGGAGTATGGGGCAGGGGG - Intronic
1003450860 6:6230315-6230337 TCAGGGAAGTTGGGGGAAGCTGG - Intronic
1003516297 6:6821600-6821622 ACGGGGGAGGAGGGGGAAGAGGG + Intergenic
1003899910 6:10644824-10644846 ACAAGGGAGGAGGTGCAAGCTGG - Intergenic
1004348104 6:14866890-14866912 ACATGGGAGTGGGGGGAGGTGGG - Intergenic
1004609125 6:17222431-17222453 ACCAGGGTGGAGGGGGAAGCAGG - Intergenic
1005132045 6:22520503-22520525 AGAAGGGAGAAGGGGGAAGGGGG + Intergenic
1005947188 6:30603144-30603166 GCAGTGGAGTTGGGGGAAGCAGG - Intronic
1006303770 6:33207416-33207438 ACAGGGAAGTAGGGGGGAACTGG + Intergenic
1007177135 6:39904641-39904663 GGATGGGAGTAGGGAGAGGCTGG - Exonic
1007417767 6:41702135-41702157 ACATGGGATGAGGGGGGCGCAGG - Intronic
1007530359 6:42536493-42536515 ACATGGTAATTGGGGGAATCAGG - Intergenic
1007706004 6:43791814-43791836 ACATGGGACTAGGGGAGGGCAGG + Intergenic
1008121478 6:47622112-47622134 TCAGGGAAGTAGGGGAAAGCTGG + Intronic
1008186751 6:48402096-48402118 ACAAAGGTGAAGGGGGAAGCAGG + Intergenic
1008949434 6:57139301-57139323 ACTTGGGAGGAGGGGTAAGTTGG + Intronic
1011965886 6:93156872-93156894 CCATGGGAGTGGGGGAAAACTGG + Intergenic
1012097093 6:94976775-94976797 ACATGAGATTTGGGAGAAGCTGG - Intergenic
1012869806 6:104659395-104659417 CCAGGGAAGTAGGGGAAAGCTGG - Intergenic
1014165191 6:118216442-118216464 AAGTGGGGGTAGGGGGAAGAAGG - Intronic
1014304842 6:119727588-119727610 TCAGGGGAGTAGGGGAAAGCTGG + Intergenic
1014741079 6:125148035-125148057 TCATGGGAGTAAGGAGAAGAAGG + Intronic
1014981477 6:127950905-127950927 ACATGCCAGTTGAGGGAAGCAGG - Intergenic
1015891036 6:137969916-137969938 ACAGTGGAGTAGGGGGTAGAAGG + Intergenic
1016008719 6:139116080-139116102 ACATGGGAGTAGGTGGAGACTGG + Intergenic
1016400745 6:143677871-143677893 GGAGGGGAGGAGGGGGAAGCGGG - Intronic
1016782207 6:147971682-147971704 ACATGGCAGAAGGGGCAAGGAGG - Intergenic
1016911730 6:149205919-149205941 ACATGAGAGAAGGAGAAAGCAGG - Intergenic
1017127809 6:151081918-151081940 AGATGGGAAGAGGAGGAAGCAGG - Intronic
1018527570 6:164729623-164729645 ACATGAGATTTGGGAGAAGCTGG + Intergenic
1018678303 6:166242034-166242056 AGATGTGAGGAGGGGGCAGCAGG - Intergenic
1019024605 6:168948606-168948628 ATGTGGGAGAAGGGTGAAGCTGG + Intergenic
1019252319 7:23352-23374 ACATGGCAGAATGGGGAAACGGG - Intergenic
1020080008 7:5282160-5282182 AGAGGGGAGGAGGGGGAAGATGG + Intronic
1022112263 7:27239100-27239122 CCAAGGCAGAAGGGGGAAGCGGG + Intergenic
1022179024 7:27899972-27899994 ACATGGGGGCAGTGGGCAGCTGG + Intronic
1022439808 7:30424242-30424264 ACTTGTGAGTAGGGGGTGGCTGG - Intergenic
1023457144 7:40352457-40352479 ACTTGAGAGTAGAGGGAAGGAGG - Intronic
1023567519 7:41538359-41538381 ACATGAGGCTAGAGGGAAGCAGG + Intergenic
1024270174 7:47635914-47635936 AGAAGGGAGTAGGGAGAAGAGGG + Intergenic
1024616772 7:51122010-51122032 ACATGGAGGAAGTGGGAAGCTGG - Intronic
1025198906 7:56950056-56950078 AGAGGGGAGGAGGGGGAAGATGG - Intergenic
1025673040 7:63626877-63626899 AGAGGGGAGGAGGGGGAAGATGG + Intergenic
1026238453 7:68550150-68550172 ACATGGTAGAAGCTGGAAGCTGG + Intergenic
1026776012 7:73231557-73231579 ACCTGGGTGTAGGGGGCAGAGGG + Intergenic
1026896955 7:74014828-74014850 ACAGGGGTGTAGTGGGAAGGGGG + Intergenic
1027016869 7:74784928-74784950 ACCTGGGTGTAGGGGGCAGAGGG + Intronic
1027071158 7:75161008-75161030 ACCTGGGTGTAGGGGGCAGAGGG - Intergenic
1027137044 7:75631892-75631914 AGATTGGAGTAGGGGAAAGACGG + Intronic
1027161169 7:75803487-75803509 ACTTGGGAGTGTGGGGAAGCTGG - Intergenic
1028629068 7:92913838-92913860 ACATGGCAGTATGGGCAAGGCGG - Intergenic
1028831218 7:95328335-95328357 ACATGCTAGTAGGGGAAGGCAGG - Intergenic
1029221771 7:98995773-98995795 ACATGGGAGTGATGGGATGCAGG - Intronic
1029449306 7:100632063-100632085 ACATGTGAGTCTGGGGAGGCTGG - Exonic
1029550515 7:101234847-101234869 GCATGGGAGGAGTGGGGAGCAGG - Intronic
1029668001 7:102008249-102008271 ACATGGGAGAGGGGGCCAGCGGG - Intronic
1030124420 7:106141023-106141045 ACATGGCAGAAGGGGCCAGCAGG + Intergenic
1030205138 7:106945102-106945124 AAGTGGGAGTTGGGGGAAGGAGG - Intergenic
1030210825 7:106994111-106994133 ATATGGAAGTAGAAGGAAGCAGG - Intergenic
1030985568 7:116238049-116238071 ACTTGGGGGTATGTGGAAGCAGG - Intronic
1031834523 7:126667305-126667327 ACGTGGAAGTAGCAGGAAGCAGG + Intronic
1032229738 7:130064346-130064368 ACATGGGAGGAGGAGGTAGGAGG - Intergenic
1033233499 7:139620114-139620136 ATGTGGGAATAGGGGGAAGGGGG - Intronic
1033531626 7:142269721-142269743 ACATGGGGGTTGAGTGAAGCAGG + Intergenic
1033573769 7:142659660-142659682 AGATGGGAGAAGGAGGGAGCAGG - Intergenic
1034137935 7:148788821-148788843 ACACGGGAGTCGGGGGAGGAGGG - Intronic
1034331614 7:150288029-150288051 CCATGGCAGTAAGGGGAAGCGGG + Intronic
1034427221 7:151020357-151020379 ACAGGGGAGGAGGGGAAAGAAGG + Intronic
1034666425 7:152821838-152821860 CCATGGCAGTAAGGGGAAGCGGG - Intronic
1034828549 7:154289122-154289144 CCATGAGAGAAGGGGGATGCTGG + Intronic
1035351012 7:158246472-158246494 ACACGGGAGAAGGAGGATGCTGG + Intronic
1036664187 8:10728449-10728471 ACCTGTTAGTAGGGGGCAGCAGG - Intronic
1037615701 8:20517218-20517240 TCATGGGAGCAGGGGGAGGGAGG + Intergenic
1037832884 8:22199447-22199469 ACCTGGGAGCTGGGGGGAGCAGG - Intronic
1037923815 8:22829197-22829219 ACATGGAAGTAAAGGAAAGCTGG - Intronic
1038631769 8:29252043-29252065 GGATGGGAGAAGGGGGAAGCGGG + Intronic
1038882071 8:31625886-31625908 ACATGGTAGGAGGGGCAAACAGG - Intergenic
1039571809 8:38592927-38592949 TCATGGAAGTGGGGGAAAGCTGG - Intergenic
1041212159 8:55563486-55563508 ATGGGGGAGTAGGGGTAAGCGGG - Intergenic
1041232293 8:55766117-55766139 GCACGGGAGTAGGGGAAAGGAGG + Intronic
1042312933 8:67396603-67396625 CCATGGGACTAGGGGGATGGGGG - Intergenic
1044052045 8:87516869-87516891 TCATGGCAGAAGGGGGAAGCAGG - Intronic
1044907233 8:97017631-97017653 TCAGGGAAGTAGGGGAAAGCCGG - Intronic
1045089926 8:98731334-98731356 ACATGGGAGCAGGGGCAGACTGG - Intronic
1045192917 8:99900912-99900934 ACAAGGGAGAATGGGGAAGAGGG - Intergenic
1045518257 8:102880235-102880257 GGATGGGTGTAGGGGGAAGGAGG - Intronic
1047921967 8:129644556-129644578 AGCTGGGAGTTGGGGGAGGCGGG - Intergenic
1048697932 8:137049475-137049497 AGTTGGGAGTAGGGGAAAGAAGG + Intergenic
1049141233 8:140956314-140956336 ACACGGGAGGGTGGGGAAGCGGG + Intronic
1049575845 8:143389241-143389263 CCCTGTGAGGAGGGGGAAGCCGG - Intergenic
1050162350 9:2731764-2731786 ACTTGGGAGTAAGGGGGAGTGGG - Intronic
1050292131 9:4165950-4165972 ACAGGGGAGTAGGAGGGAGCTGG + Intronic
1050845327 9:10209503-10209525 ACATGGGAGCAAGGGGCAGTGGG - Intronic
1052218318 9:25992580-25992602 CCAGGGAAGTAGGGGAAAGCTGG - Intergenic
1053197221 9:36128455-36128477 GGAGGGGAGTAGGGGGAAGGTGG + Intergenic
1053357245 9:37456336-37456358 AAGTGGGAGTAGGGGAAGGCTGG + Intronic
1053389955 9:37727559-37727581 ACATGGGAGAATGGAGAAGAAGG + Intronic
1057158379 9:92865798-92865820 ACTTGGGAGGCAGGGGAAGCAGG + Intronic
1057585431 9:96324433-96324455 ACATGGGAGTAAGGAGAACAAGG + Intronic
1058528000 9:105879232-105879254 CCCTGGGGGTAAGGGGAAGCTGG - Intergenic
1058745136 9:107983116-107983138 ACATAGGAGTATGGGGGGGCGGG - Intergenic
1059008939 9:110435467-110435489 AGATGGGGGTGGAGGGAAGCAGG + Intronic
1059286575 9:113177764-113177786 ACATGGGACTAGTGGGCAGGGGG - Intronic
1060190666 9:121590281-121590303 ACAGGGGAGGAGTGGGAAGGAGG - Intronic
1061009531 9:127946749-127946771 AAAAGGGAGTGGAGGGAAGCTGG + Intronic
1061201848 9:129142641-129142663 ACAGTGGGGTAGGAGGAAGCAGG - Intronic
1061792016 9:133063898-133063920 AGATGGGAGGAGGGAAAAGCAGG + Intronic
1061873694 9:133533821-133533843 AAAGGGGAGGAGGAGGAAGCTGG - Intronic
1062255739 9:135619891-135619913 ACAGGGGAGAAGGGGGAGACGGG - Intergenic
1062287023 9:135777874-135777896 AACTGGGAGTGGGGAGAAGCTGG - Intronic
1062287065 9:135778035-135778057 ACAAGGGAGGAGGGGGAAAGGGG - Intronic
1062521343 9:136959239-136959261 GCATGGGGGTAGGGGCCAGCAGG - Intergenic
1062748023 9:138228563-138228585 ACATGGCAGAATGGGGAAACGGG + Intergenic
1185451991 X:286856-286878 AGGTGGGGGTAGGGGGCAGCAGG + Intronic
1186812412 X:13203519-13203541 ACGTGGGAGGAGGGGGAGCCAGG - Intergenic
1189185760 X:39053320-39053342 ACATGGGAGCAGTGGAAAGATGG - Intergenic
1190221628 X:48515790-48515812 ACATGTGAGCAGGGTGGAGCAGG + Exonic
1192524218 X:71828033-71828055 ACATGGGAGGATCTGGAAGCTGG + Intergenic
1193032715 X:76916703-76916725 ACATGGGGGTGGGGGGAGGAGGG + Intergenic
1194299105 X:92163102-92163124 TCAGGGAAGTAGGGGAAAGCCGG + Intronic
1194563014 X:95446669-95446691 ACATGAGATTTGGGGGGAGCTGG - Intergenic
1196745471 X:119067992-119068014 ACATGAGAGTAGGGGGTAAGGGG + Intergenic
1197206862 X:123798326-123798348 CCATGGGAGCAGGGGACAGCGGG - Intergenic
1197209277 X:123815885-123815907 CCATGGGAGCAGGGGACAGCGGG + Intergenic
1197822462 X:130555040-130555062 GCATGGGGGTAGGGCGAGGCTGG - Intergenic
1198211467 X:134520329-134520351 ATATGGGAGTTGGGGGATGTGGG + Intronic
1198850567 X:140961684-140961706 ACATGGGCATTGGGGGAAGTGGG + Intergenic
1199586812 X:149423549-149423571 CCAAGGAAGTAGGGGAAAGCTGG - Intergenic
1200332659 X:155313911-155313933 CCAAGGAAGTAGGGGAAAGCTGG - Intronic
1200616708 Y:5387936-5387958 TCAGGGAAGTAGGGGAAAGCCGG + Intronic