ID: 912918023

View in Genome Browser
Species Human (GRCh38)
Location 1:113837149-113837171
Sequence AAGAAGAAAGAGAAGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4644
Summary {0: 1, 1: 2, 2: 62, 3: 550, 4: 4029}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912918020_912918023 8 Left 912918020 1:113837118-113837140 CCTGGAATGTATTTATTTGAGGA 0: 1
1: 0
2: 3
3: 26
4: 243
Right 912918023 1:113837149-113837171 AAGAAGAAAGAGAAGGAAGCAGG 0: 1
1: 2
2: 62
3: 550
4: 4029

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912918023 Original CRISPR AAGAAGAAAGAGAAGGAAGC AGG Intronic
Too many off-targets to display for this crispr