ID: 912920590

View in Genome Browser
Species Human (GRCh38)
Location 1:113862809-113862831
Sequence CAGAAGAAGTACAAGTGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912920582_912920590 28 Left 912920582 1:113862758-113862780 CCTCAGTGCCTTGCAAATATAGG 0: 1
1: 0
2: 2
3: 29
4: 364
Right 912920590 1:113862809-113862831 CAGAAGAAGTACAAGTGGTAAGG No data
912920584_912920590 20 Left 912920584 1:113862766-113862788 CCTTGCAAATATAGGTCAGTATT No data
Right 912920590 1:113862809-113862831 CAGAAGAAGTACAAGTGGTAAGG No data
912920586_912920590 -6 Left 912920586 1:113862792-113862814 CCAAGCCTCCATCAGGACAGAAG 0: 1
1: 0
2: 1
3: 27
4: 188
Right 912920590 1:113862809-113862831 CAGAAGAAGTACAAGTGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912920590 Original CRISPR CAGAAGAAGTACAAGTGGTA AGG Intronic
No off target data available for this crispr