ID: 912920973

View in Genome Browser
Species Human (GRCh38)
Location 1:113866828-113866850
Sequence ACTTGACCCCAGGGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1943
Summary {0: 1, 1: 0, 2: 96, 3: 488, 4: 1358}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912920973_912920980 2 Left 912920973 1:113866828-113866850 CCCTCCACCCCCTGGGGTCAAGT 0: 1
1: 0
2: 96
3: 488
4: 1358
Right 912920980 1:113866853-113866875 TCCTCCCACTTCAGCCTCCCAGG 0: 88
1: 979
2: 2196
3: 3169
4: 8420
912920973_912920987 18 Left 912920973 1:113866828-113866850 CCCTCCACCCCCTGGGGTCAAGT 0: 1
1: 0
2: 96
3: 488
4: 1358
Right 912920987 1:113866869-113866891 TCCCAGGTAGCTGGGATTACAGG 0: 2001
1: 53931
2: 148281
3: 254269
4: 530010
912920973_912920985 10 Left 912920973 1:113866828-113866850 CCCTCCACCCCCTGGGGTCAAGT 0: 1
1: 0
2: 96
3: 488
4: 1358
Right 912920985 1:113866861-113866883 CTTCAGCCTCCCAGGTAGCTGGG 0: 220
1: 8844
2: 111606
3: 218720
4: 255191
912920973_912920984 9 Left 912920973 1:113866828-113866850 CCCTCCACCCCCTGGGGTCAAGT 0: 1
1: 0
2: 96
3: 488
4: 1358
Right 912920984 1:113866860-113866882 ACTTCAGCCTCCCAGGTAGCTGG 0: 75
1: 2376
2: 23578
3: 128488
4: 236628

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912920973 Original CRISPR ACTTGACCCCAGGGGGTGGA GGG (reversed) Intronic
900258822 1:1712045-1712067 ACTTGAACCCGGGGGGCAGAGGG + Intronic
900280174 1:1861981-1862003 ACTTGAGCCCCGGGGGTCGGAGG + Intronic
900293723 1:1937716-1937738 ACTGGACCCCAGGCGGTGGCTGG - Intronic
900624906 1:3603632-3603654 GCTTGCCCCCAGGAGGTGGGAGG - Intronic
900664935 1:3808798-3808820 AGTTGAGCCCAGGAGGTTGAAGG + Intergenic
901139129 1:7016750-7016772 ACTTGAACCCAGGAGGTTGGAGG + Intronic
901256597 1:7834003-7834025 GCTTGAACCTAGGAGGTGGAGGG - Intronic
901283624 1:8058857-8058879 GCTTGAACCCAGGAGGTGGAAGG + Intergenic
901284043 1:8062354-8062376 ACTTGAACCCAGGAGGTGGGAGG - Intergenic
901369298 1:8782821-8782843 ACTTGAACCCGGGAGGTGGAGGG + Intronic
901382746 1:8885600-8885622 GCTTGAACCCAAGAGGTGGAGGG + Intergenic
901509115 1:9706408-9706430 GCTTGAGCCCAGGAGTTGGAGGG + Intronic
901545590 1:9954290-9954312 ACTAAAGCCCAGGAGGTGGAGGG - Intronic
901558351 1:10049525-10049547 ACTTGAGCCCAGGAGTTTGAGGG + Intronic
901561039 1:10070996-10071018 ACTTGAACTCGGGAGGTGGAGGG - Intronic
901588245 1:10316581-10316603 ACTTGAGCCCGGGAGGCGGAGGG - Intronic
901597378 1:10396356-10396378 GCTTGAACCCGGGAGGTGGAGGG - Intergenic
901832687 1:11902831-11902853 GCTTGAACCCAGCGGGTTGAAGG + Intergenic
901879987 1:12188213-12188235 ACATACCCACAGGGGGTGGAAGG + Intronic
902204457 1:14857448-14857470 GCTTGAGCCCAGGAGGTTGAGGG + Intronic
902351124 1:15855778-15855800 GCTTGAACCCAGGAGGTGGAGGG + Intronic
902353484 1:15877825-15877847 ACTTGAACCCAGGAGGTGGAGGG - Intronic
902595390 1:17506185-17506207 GCTTGAACCCAGGAGGCGGAAGG - Intergenic
902648055 1:17817781-17817803 GCTTGAACCCAGGAGATGGAGGG - Intronic
902748715 1:18491309-18491331 ACTTAACCCCAGGGTGTGGGTGG - Intergenic
902759505 1:18571980-18572002 ACTTGACTCAAGGATGTGGATGG - Intergenic
902892979 1:19458435-19458457 ACTTGAACCCGGGAGGTGGAGGG - Intronic
902952696 1:19899026-19899048 ACTTGAGCCCAGGAGCTGGAGGG - Intronic
903000549 1:20262567-20262589 GCTTGAACCCAGGAGGCGGAGGG - Intergenic
903021653 1:20399400-20399422 ACTTGACACCCCGGAGTGGAGGG + Intergenic
903118268 1:21195963-21195985 GCTTGAACCCTGGAGGTGGAGGG + Intergenic
903176497 1:21584611-21584633 ACTTGAACCCAGAAGGAGGAGGG + Intergenic
903201642 1:21744692-21744714 GCTTGAACCCAGGAGATGGAGGG + Intronic
903203601 1:21763730-21763752 ACTTGAACCCAGGAGGCAGAGGG + Intronic
903207761 1:21795647-21795669 GCTTGAACCCAGGAGGTGGAGGG + Intergenic
903270724 1:22186618-22186640 ACTTGAACCCGGGAGGGGGAGGG - Intergenic
903524893 1:23986218-23986240 ACTTGAGCCCAGGAGCTTGAGGG - Intergenic
903608221 1:24590688-24590710 ACTTGAGCCCAGGAGTTTGATGG - Intronic
903612724 1:24628020-24628042 GCTTGACCCCAGGAGGTCGAGGG + Intergenic
903619272 1:24686099-24686121 ACTTGAGCCCAGGAGGCGGAGGG - Intergenic
903817434 1:26075092-26075114 GCTTGAACCCAGGAGGTGGAGGG - Intergenic
903947600 1:26973493-26973515 GCTTGAACCCAGGAGGTGGATGG + Intergenic
904074034 1:27826291-27826313 GCTTGAACCCAGGAGGTGGGGGG + Intergenic
904201594 1:28823277-28823299 ACTTGAACCCAGGAGGTGGAAGG - Intronic
904554963 1:31355090-31355112 GCTTGAACCCAGGAGGCGGAGGG + Intronic
904669530 1:32152931-32152953 ACATGAACCCAGGAGGCGGAGGG + Intronic
904689226 1:32281375-32281397 ATTTGAGCCCAGGAGGTTGAGGG + Intronic
904820850 1:33243237-33243259 ACTTGAACCCAGGAGGCGGAGGG - Intergenic
905030490 1:34880134-34880156 ACTTGAACCCATGGGTTTGAGGG - Intronic
905142248 1:35856747-35856769 GCTTGAACCCAGGAGGTGGACGG + Exonic
905178285 1:36151526-36151548 GCTTGAGCCCAGGAGGTGGAGGG + Intronic
905421892 1:37852711-37852733 ACTTGAACCCAGAGGGCGGAGGG - Intronic
905424483 1:37871979-37872001 ACTTGAGCCCAGGAGGTGGAGGG + Intronic
905477462 1:38239083-38239105 CCTGGATCCCAGGGGGAGGATGG - Intergenic
905577763 1:39059323-39059345 ACTTGAACCCGGGAGGCGGAGGG + Intergenic
905614554 1:39386341-39386363 ACTTGAGCCCAGGAGATTGAGGG - Intronic
905710629 1:40099087-40099109 ACTTGAACCCAGGAGGCAGAGGG + Intergenic
905865695 1:41375335-41375357 ACTTGAGCCCAGGAGGTCAAGGG + Intronic
905964718 1:42082024-42082046 ACTATACCCCAGGGAATGGATGG - Intergenic
906064528 1:42970757-42970779 GCTTGAACCCAGGAGGTGGAGGG + Intergenic
906122858 1:43406168-43406190 GCTTGAACCCAGGAGGTGGAGGG - Intronic
906134536 1:43487598-43487620 ACTTGAACCCAGAAGGAGGAGGG + Intergenic
906152408 1:43595295-43595317 ACCTGAACCCAGGAGGTGGACGG - Intronic
906227065 1:44130876-44130898 ACTTGAACCTGGGAGGTGGAAGG - Intronic
906304439 1:44707637-44707659 ACTTGAGCCCAGGAGTTTGAGGG - Intronic
906306960 1:44725495-44725517 ACTTGGCTCCAGGGGGGAGACGG + Exonic
906307385 1:44728295-44728317 GCTTGAGCCCAGGAGGTGGTGGG - Intergenic
906387338 1:45381951-45381973 GCTTGAGCCCAGGAGGTTGAAGG - Intronic
906464047 1:46060015-46060037 ACTTGAACCCAGGAGGCGGAGGG + Intronic
906710316 1:47924585-47924607 ACTTGACCCCCAGCTGTGGAGGG + Intronic
906765441 1:48427006-48427028 ACTTGAGCCCAGGAGTTTGAGGG - Intronic
906779136 1:48556870-48556892 GCTTGAGCCCAGGAGGTGGGAGG - Intronic
906783502 1:48593666-48593688 GCTTGAACCCAGGAGGTGGAGGG + Intronic
906969205 1:50493113-50493135 ACTTGAACCCAGGAGGCTGAAGG - Intronic
906989295 1:50721074-50721096 CCAAGACCCCAGAGGGTGGAGGG + Intronic
907173466 1:52494607-52494629 GCTTGAACCCAGGAGGTGGAGGG + Intronic
907209170 1:52804160-52804182 ACTTGACCCTAGGAGTTTGAGGG + Intronic
907406372 1:54255987-54256009 GCTTGAACCCAGGAGGCGGACGG + Intronic
907445554 1:54505472-54505494 GCTTGAACCCAGGAGGCGGAGGG + Intergenic
907479153 1:54732236-54732258 ACTTGAACCTGGGAGGTGGAGGG + Intronic
907670405 1:56469591-56469613 ACTTGAACTCAGGTGGTGGAGGG + Intergenic
907767858 1:57428083-57428105 ACCTGAACCCAGGAGGCGGAGGG + Intronic
907901851 1:58748296-58748318 ACTTGAACCCGGGAGGTGGAAGG + Intergenic
908141319 1:61188128-61188150 ACTTGAACCCGGGAGGCGGAGGG - Intronic
908243508 1:62208560-62208582 ACTTGAGCCTGGGAGGTGGAGGG - Intronic
908308213 1:62847092-62847114 ACTTGAACCCGGGAGGTGGAGGG + Intronic
908354227 1:63316009-63316031 ACTTGAGCCCAGGAGGTCGAGGG + Intergenic
908370767 1:63475055-63475077 ACTTGAGCCTAGGAGGTTGAGGG - Intronic
908457202 1:64315446-64315468 ACTTGAGCCTAGGTGGTCGAGGG - Intergenic
908540229 1:65115270-65115292 CCTTGAGCCCAGGAGTTGGAGGG - Intergenic
908553429 1:65232943-65232965 ACATGAACCCAGGAGGTTGAGGG - Intergenic
908651858 1:66342646-66342668 ACTTGAAACCAGGAGGTAGAGGG + Intronic
908751080 1:67423522-67423544 ATTTGAGCCCAGGAGGCGGAGGG + Intronic
909620725 1:77663830-77663852 GCTTGAACCCGGGAGGTGGAGGG - Intronic
909704251 1:78562499-78562521 ACTTGAACCCAGGAGGCAGAGGG + Intergenic
910155909 1:84219305-84219327 ACTTGAACCTGGGAGGTGGAGGG - Intronic
910299594 1:85690941-85690963 ACTTGAACCCAGGAGGTGGAGGG + Intronic
910886671 1:91970824-91970846 GCTTGAACCCAGTGGGTTGAAGG + Intronic
910965465 1:92803985-92804007 ACTTGAACCCAGGGGGCGGAGGG - Intergenic
911628312 1:100152807-100152829 ACTTGAACCCGGGAGGTGGAGGG - Intronic
912064703 1:105722660-105722682 ACTTGAACCTAGGAGGTGGAGGG + Intergenic
912140059 1:106713768-106713790 ACTTGAACCCAGGAAGTGGAGGG - Intergenic
912807040 1:112765244-112765266 ACTTGAATCCAGGAGATGGAGGG - Intergenic
912920973 1:113866828-113866850 ACTTGACCCCAGGGGGTGGAGGG - Intronic
912987839 1:114452817-114452839 ACTTGAGCCCAGGAGGTTCAAGG + Intronic
913027686 1:114862430-114862452 ACTTGAACCCTAGGGGTGGGAGG - Intronic
913301460 1:117374212-117374234 ACTTGAGCCCAGGAGTTCGAGGG + Intronic
914193890 1:145434231-145434253 GCTTGAACCCAGGAGGCGGAGGG - Intergenic
914475220 1:148017122-148017144 GCTTGAACCCAGGAGGCGGAGGG - Intergenic
914706481 1:150174263-150174285 GCTTGAACCCAGGAGGCGGAGGG - Intergenic
914813277 1:151045183-151045205 ACTTGAACCCGGGAGGTGGAGGG + Intronic
914868658 1:151455022-151455044 GCTTGAACCCAGGAGGCGGAGGG + Intronic
915105017 1:153528401-153528423 ACTTGAACCCAGGAGGTTGGAGG + Intergenic
915150443 1:153826546-153826568 ACTTGAACCCAGGAGGTGGAGGG + Intronic
915354138 1:155245634-155245656 GCTTGAACCCAGGAGGTGGAAGG + Intergenic
915380563 1:155435966-155435988 ACTTGAAACCACGAGGTGGAGGG + Intronic
915501964 1:156325443-156325465 ACTTGAGCCCAGGAGGTTGAGGG + Intronic
915770673 1:158419691-158419713 ACTTGAACCCAGGAGGCAGAAGG - Intergenic
915930509 1:160057891-160057913 GCTTGGACCTAGGGGGTGGAGGG + Intronic
916049768 1:161028056-161028078 GCTTGAACCCAGGAGGTGGAAGG - Intronic
916240851 1:162638101-162638123 ACTTGAACCCAGGAGGCAGAGGG - Intronic
916548781 1:165830086-165830108 ACTTGAGCCCAACAGGTGGAGGG - Intronic
916591442 1:166194761-166194783 ACTTGAGCCCGGAAGGTGGAGGG + Intergenic
916657096 1:166885932-166885954 ACTTGAGCCCAGGAGATCGAGGG - Intergenic
916669916 1:167006716-167006738 ACTTGAACCTGGGAGGTGGAGGG - Intronic
916697809 1:167257855-167257877 ACTTGACCTCAGGAGGTTGAGGG - Intronic
917108342 1:171518578-171518600 GCTTGAACCCAGGGGGCAGAGGG - Intronic
917288112 1:173442631-173442653 ACTTGAACCCAGGGAGGCGAAGG - Intergenic
917357466 1:174141746-174141768 GCTTGAACCCAGGAGGCGGAGGG + Intergenic
917538317 1:175890464-175890486 ACTTGAACCCGGGAGGTGGAGGG + Intergenic
917581845 1:176386754-176386776 ACTTGAGCCCAGGAGGCTGAGGG + Intergenic
917695543 1:177519537-177519559 TCTTGAACCCAGGAGGTAGAGGG + Intergenic
917818114 1:178731363-178731385 ACTTGAACCCAGGAGGTGGAGGG - Intronic
917825418 1:178815161-178815183 ACATGAACCCAGGAGGTGGAGGG - Intronic
917853407 1:179083473-179083495 GCTTGAACCCAGGAGGCGGAGGG - Intronic
917855599 1:179096740-179096762 ACTTGAACCCAGGAGGTGGTGGG + Intronic
917902362 1:179555380-179555402 ACTTCAATCAAGGGGGTGGATGG - Intronic
918031724 1:180819935-180819957 ACTTGGACCCAGGAGGGGGAGGG + Intronic
918068234 1:181116306-181116328 GCTTGAACCCGGGAGGTGGAAGG + Intergenic
918233032 1:182552985-182553007 GCTTGAACCCAGGAGGCGGAGGG - Intronic
918470835 1:184871262-184871284 ACTTGAACCTGGGAGGTGGAGGG + Intronic
918636920 1:186787652-186787674 ACTTGAACCCAGGAGGTGGAGGG - Intergenic
919105154 1:193140393-193140415 ACATATCCCCAGAGGGTGGATGG - Intronic
919340606 1:196301820-196301842 GCTTGAATCCAGGAGGTGGAAGG - Intronic
919573342 1:199276199-199276221 GCTTGAGCCCAGGAGGTGGAGGG - Intergenic
919613823 1:199779746-199779768 ACTTGAACCCAGGAGGCAGAGGG + Intergenic
919661974 1:200256302-200256324 GCTTGAATCCAGGAGGTGGAGGG - Intergenic
919900268 1:202039100-202039122 ACTTGAGCCCAGGAGATTGAGGG - Intergenic
919905871 1:202078019-202078041 GCTTGAACCCAGGAGGTGGAGGG - Intergenic
920109177 1:203575069-203575091 GCTTGAACCCAGGAGGTGGAGGG + Intergenic
920157678 1:203968504-203968526 ACTTGAACCCAGGAGGCAGAGGG - Intergenic
920162766 1:204012009-204012031 ACTTGAGCCCGGGAGGTGGAGGG + Intergenic
920321683 1:205128620-205128642 GCTTGAACCCAGGAGGTGGGAGG - Intergenic
920458983 1:206123843-206123865 GCTTGAACCCAGGAGGTGGAGGG - Intergenic
920562390 1:206948065-206948087 ACTGGACCCCAGGGGAGAGAAGG - Intergenic
920697558 1:208192802-208192824 GCTTGAACCCAGGAGGTGGAGGG + Intronic
920854750 1:209653233-209653255 ACCTGACCACAAGTGGTGGAAGG + Intergenic
920948374 1:210550750-210550772 ACTTGAACCCAGGAGGCAGAGGG - Intronic
921114012 1:212069626-212069648 GCTTGAACCCAGGAGGCGGAGGG - Intronic
921119827 1:212126807-212126829 GCGTGAACCCAGGAGGTGGAGGG - Intergenic
921710820 1:218371216-218371238 ACTTGATCCCGGGAGTTGGAAGG + Intronic
922768701 1:228170413-228170435 ACTTGAGCCCAGGAGTTTGAAGG - Intronic
922777346 1:228221446-228221468 GCTTGAACCCAGGAGGCGGAGGG - Intronic
922897185 1:229109401-229109423 ACAGGACCCCAGGGGGTGGGAGG - Intergenic
922962773 1:229662606-229662628 GCTTGAGCCCAGGAGTTGGAGGG - Intergenic
923376716 1:233371441-233371463 ACTTGAACCTGGGAGGTGGAGGG - Intronic
923423394 1:233843463-233843485 ACTTGAGCCCAGGAGTTTGAGGG - Intergenic
923582368 1:235230329-235230351 GCTTGAACCCGGGAGGTGGAGGG + Intronic
923658435 1:235938352-235938374 GCTTGAGCCCAGGAGGTTGAAGG - Intergenic
923790275 1:237105749-237105771 GCTTGAACCCAGGAGGTGGGAGG + Intronic
923868617 1:237966487-237966509 ACTTGACCCCAGGAGGGTCAGGG + Intergenic
924023787 1:239812120-239812142 ACTTGAGCCCGGGAGGAGGAGGG - Intronic
924072047 1:240290894-240290916 ACTTGAACCCGGGAGGTAGAGGG - Intronic
924085898 1:240451274-240451296 ACTTGAACCTGGGAGGTGGAGGG + Intronic
924327504 1:242910468-242910490 ACTTGAACCCGGGAGGCGGAGGG + Intergenic
924394972 1:243608833-243608855 GCTTGAACCCAGGAGGCGGAGGG - Intronic
924550983 1:245076807-245076829 TCTTGAACCCAGGAGATGGAGGG - Intronic
924635114 1:245779075-245779097 ACTTGAACCCAGAAGGAGGAGGG + Intronic
924677476 1:246194349-246194371 GCTTGAACCCAGGAGGTGGGAGG - Intronic
924758819 1:246965652-246965674 GCTTGAACCCGGGAGGTGGAGGG + Intronic
924789862 1:247236175-247236197 ATTTGAGCCCAGGAGGTCGAGGG + Intergenic
924805269 1:247356876-247356898 GCTTGAACCCGGGAGGTGGAGGG - Intergenic
1062871015 10:904469-904491 ACTTGAGCCTGGGGGGCGGAGGG + Intronic
1063072400 10:2679877-2679899 CCATGAGCCCAGGGGGTGCAAGG + Intergenic
1063562650 10:7143812-7143834 GCTTGAACCCAGGAGGTGGAGGG - Intergenic
1063563410 10:7150196-7150218 ACTTGAGTCCAGGAGTTGGAAGG - Intergenic
1063806720 10:9653329-9653351 TCTTGAACCCAGGAGGTGGAAGG - Intergenic
1063813064 10:9736741-9736763 ACTTGAACCCGGGAGGTGGAGGG - Intergenic
1063888803 10:10607871-10607893 ACTTGAACCCAGGAGGTGGGAGG + Intergenic
1064020839 10:11807362-11807384 GCTTGAACCCAGGAGGTGGAAGG - Intergenic
1064037235 10:11924493-11924515 ACTTGAACCCAGGAGGTGGAGGG + Intronic
1064153176 10:12882145-12882167 ACTTGCCCCCAGGGCCTTGAGGG - Intergenic
1064192407 10:13219064-13219086 GCTTGAGCCCAGGAGGTTGAGGG - Intergenic
1064234725 10:13563591-13563613 ACTTGAACCCAGGGGGGCGGAGG - Intergenic
1064577150 10:16758010-16758032 TCTTGCCACCAGGAGGTGGAGGG - Intronic
1064821939 10:19346731-19346753 GCTTGAACCCAGGAGGTAGAGGG - Intronic
1064897332 10:20252903-20252925 GCTTGAGCTCAGGAGGTGGAGGG + Intronic
1064968145 10:21036078-21036100 ACTTGAACCCAGGGGGCAGAAGG + Intronic
1064990018 10:21248151-21248173 ACTTGAGCCCGGGAGGTCGAGGG - Intergenic
1065044746 10:21737143-21737165 ACTGGAGCCCAGGAGGTTGAGGG + Intronic
1065059418 10:21883165-21883187 ACTTGAGCCCAGGAGGTGGAGGG + Intronic
1065095403 10:22275745-22275767 ATTTGAACCCAGGAGGTGGAGGG + Intergenic
1065305359 10:24363652-24363674 GCTTGAGCCCAGGAGGTGGAGGG - Intronic
1065305510 10:24364879-24364901 GCTTGACCTCAGGAGGTCGAGGG - Intronic
1065525324 10:26614141-26614163 GCTTGAACCCAGAAGGTGGATGG + Intergenic
1065605236 10:27412230-27412252 ACTTGAGCCCAGGAGGTTGAGGG - Intronic
1065630504 10:27676189-27676211 GCTTGAGCCCAGGGGGGTGAAGG + Intronic
1065676020 10:28175205-28175227 ACTTGAACCCAGGGGGCAGAGGG + Intronic
1065676095 10:28176169-28176191 ACTTGAACCCAGGGGGCAGAGGG + Intronic
1065947729 10:30622464-30622486 ACTTGAACCCAGGAGGCAGAGGG + Intronic
1066258172 10:33702370-33702392 ACTTGAACCTGGGAGGTGGAGGG + Intergenic
1066329781 10:34407748-34407770 ACTTGAGCCCAGGGAGTTCAAGG + Intronic
1066346996 10:34597509-34597531 ACTTGAGCCCAGGAGTTGGAGGG - Intronic
1066374146 10:34842346-34842368 CCTTGAGCCCAGGAGGTTGAAGG + Intergenic
1066382819 10:34916012-34916034 ACTTGAGCCCAGGAGGTCGAGGG - Intergenic
1066418601 10:35243668-35243690 GCTTGAGCCCAGGAGTTGGAGGG - Intergenic
1066423258 10:35281380-35281402 ACTTGAACCCAGGGGGAAGGAGG - Intronic
1066469896 10:35688210-35688232 GCTTGACCCCAGGAGGTTGAGGG - Intergenic
1066588307 10:36963170-36963192 ACTTGAACCCAGGAGGCGGAAGG - Intergenic
1066690498 10:38022572-38022594 GCTTGAACCCAGGGAGTGGGAGG + Intronic
1066698239 10:38097493-38097515 GCTTGAACCCAGGAGGCGGAGGG + Intronic
1066973011 10:42333295-42333317 GCTTGAACCCAGCAGGTGGAGGG + Intergenic
1067002233 10:42627084-42627106 GCTTGAACCCAGGGAGTGGGAGG - Intronic
1067108473 10:43381752-43381774 TCTTGAACCCAGGAGGCGGAGGG - Intergenic
1067320967 10:45220485-45220507 GCTTGAACCCAAGAGGTGGATGG + Intergenic
1067385151 10:45812021-45812043 GCTTGAGCCCAGGCGGTGGAGGG + Intergenic
1067419899 10:46136135-46136157 GCTTGAGCCCAGGAGGCGGAGGG - Intergenic
1067426121 10:46213384-46213406 GCTTGAGCCCAGGAGGTGGAGGG + Intergenic
1067429315 10:46232676-46232698 ACTGGAGCCCTGGGGGTGGATGG - Intergenic
1067505247 10:46842618-46842640 GCTTGAGCCCAGGAGGCGGAGGG - Intergenic
1067515486 10:46938031-46938053 ACTTGAACCCAGGAGGCAGAAGG - Intronic
1067646764 10:48113784-48113806 ACTTGAACCCAGGAGGCAGAAGG + Intergenic
1067920235 10:50448163-50448185 ACTTGGGCCCAAGAGGTGGATGG + Intronic
1067933673 10:50589342-50589364 GCTTGAGCCCAGGAGTTGGAGGG - Intronic
1068629942 10:59288408-59288430 GCTTGAACCCAGGAGGTGGAGGG + Intronic
1068660399 10:59617203-59617225 ACTTGAGCCCAGGAGTTCGAGGG + Intergenic
1068730450 10:60352210-60352232 GCTTGAGCCCAGGAGGCGGAGGG + Intronic
1068951282 10:62780077-62780099 GCTTGAGCCCAGGAGGTTGAGGG + Intergenic
1068976093 10:63011319-63011341 ACTTGAGCCCAGGAGTTTGAGGG - Intergenic
1069018025 10:63453190-63453212 GCTTGAACCCAGGAGGCGGAGGG + Intronic
1069021366 10:63492114-63492136 CCTTGAGCCCAGGAGGTCGAGGG - Intergenic
1069405257 10:68091997-68092019 ACTTGAGCCCAGGAGTTCGAGGG + Intergenic
1069579253 10:69553994-69554016 ACTTGAACCCAGGAGGCAGAGGG + Intergenic
1069667600 10:70173882-70173904 GCTTGAGCCCAGGAGGTTGAGGG + Intergenic
1069725841 10:70577803-70577825 ACTTGAGCCTAGGAGGTCGAGGG - Intergenic
1069752646 10:70754011-70754033 ACTTGTCCTCAGGAGGTGGGAGG + Intronic
1069994342 10:72333329-72333351 ACTTGCCGCCAGTGGGAGGAGGG - Exonic
1070000504 10:72372828-72372850 GCTTGACCCCAGGAGGCAGAGGG + Intronic
1070002140 10:72386640-72386662 TCTTGAGCCCAGGAGGTTGAGGG - Intronic
1070108680 10:73461362-73461384 ACTTTAACCCAGGAGGCGGAGGG + Intronic
1070130425 10:73651990-73652012 GCTTGAACCCAGGAGGTGGAGGG + Intronic
1070141244 10:73739934-73739956 ACTTGAGCCCAAGAGGTGGAGGG + Intergenic
1070167185 10:73907611-73907633 GCTTGAACCCAGAAGGTGGAGGG + Intergenic
1070226970 10:74517604-74517626 ACCTGAGCCCAGGAGGTCGAGGG + Intronic
1070243921 10:74711979-74712001 ACTTGATCCCCGGAGGTTGAGGG + Intergenic
1070891943 10:79947605-79947627 TCTTGAACCCGGGAGGTGGAGGG + Intronic
1070930496 10:80257380-80257402 GCTTGAACCCAGGAGGCGGAGGG - Intergenic
1070951521 10:80435129-80435151 GCTTGAACCCAGGAGGCGGAGGG + Exonic
1071355711 10:84791865-84791887 AATGGACTCCAGGGGCTGGAGGG - Intergenic
1071610613 10:87028061-87028083 ACTTGGGCCCAAGAGGTGGAGGG - Intergenic
1071613071 10:87049113-87049135 GCTTGAACCCAGGGGGCGGGGGG + Intergenic
1071966087 10:90854269-90854291 ACCTGAACCCAGGAGGCGGAGGG + Intronic
1072112813 10:92339285-92339307 ACTTGAGCCCAGGAGGCGGAGGG + Intronic
1072183276 10:93009129-93009151 GCTTGAGCCCAGGAGGTTGAGGG + Intronic
1072278165 10:93842720-93842742 ACTTGCCCCCAGGAGGTGCCTGG - Intergenic
1072342611 10:94469530-94469552 ACTTGAACCCAGGAGGCAGAGGG - Intronic
1072346775 10:94515428-94515450 GCTTGAACCCAGAAGGTGGAGGG - Intronic
1072574638 10:96688713-96688735 ACTTAAACCCAGGAGGCGGAGGG + Intronic
1072598696 10:96901850-96901872 ACTTGAACCCAGGAGGTGTAAGG - Intronic
1072665827 10:97391486-97391508 ACTTGAACCCGGGAGGTGGAGGG + Intronic
1072777877 10:98218992-98219014 GCTTGAACCCAGAAGGTGGAGGG - Intronic
1072877195 10:99185219-99185241 ACTTGAACCCAGGAGGCAGAGGG + Intronic
1072948203 10:99829707-99829729 ACTTGAACACAGGAGGTTGAAGG - Intronic
1072957712 10:99901983-99902005 ACTTGAGCCCAGGAGGTGGCGGG - Intronic
1072991379 10:100197803-100197825 ACTTGAACCCAGGGAGTCCAAGG + Intronic
1073003631 10:100304575-100304597 ACTTGACCCCAGGAGGTTTGAGG - Intronic
1073274674 10:102299697-102299719 GCTTGAACCCGGGAGGTGGAGGG + Intronic
1073276730 10:102318267-102318289 ACTTGAGCCCAGGAGGTTGAGGG - Intronic
1073373248 10:103009606-103009628 GCTTGAGCCCAGGAGGTGGGAGG + Intronic
1073768300 10:106707580-106707602 ACTTGAGCCCAGGAGTTGAAGGG - Intronic
1074435132 10:113427252-113427274 GCTTGAACCCAGGAGGAGGAGGG + Intergenic
1074487471 10:113899833-113899855 GCTTGAACCCAGGAGGCGGAAGG + Intronic
1074561500 10:114539273-114539295 ACTTGAACCCAGGAGGTGGGGGG + Intronic
1074767373 10:116709363-116709385 ATTTGAACCCAGGAGGCGGAGGG + Intronic
1074999688 10:118786437-118786459 GCTTGAACCCAGGGGGCAGAGGG + Intergenic
1075035841 10:119066424-119066446 AGTTGAACCCAGGAGGCGGAGGG + Intronic
1075045522 10:119143284-119143306 ACTTGAGCCCAGGAGGGAGAGGG - Intronic
1075235813 10:120727813-120727835 ACTTGAACCCAGGAGGTGGAGGG - Intergenic
1075306541 10:121373078-121373100 ACTTGAGCCCAGGAGGTGGAGGG - Intergenic
1075569295 10:123527877-123527899 TCTTGAACCCAGGAGGTGGATGG - Intergenic
1075695734 10:124433886-124433908 ACTTGAACCCGGGAGGCGGAGGG - Intergenic
1075888589 10:125924724-125924746 ACTTGAGCACAGGAGGTGGAGGG + Intronic
1076400201 10:130178335-130178357 GCTTGAACCCAGAAGGTGGAGGG - Intronic
1076438931 10:130466119-130466141 ACTTGAACCCAGGAGGTGTGAGG - Intergenic
1076984974 11:229360-229382 GCTTGAACCCAGGAGGCGGATGG + Intronic
1077057629 11:602843-602865 ACTTGAACCCGGGAGGTGGAGGG - Intronic
1077237865 11:1490820-1490842 ACTTGAGCCCAGGAGGTTGGTGG + Intronic
1077395609 11:2319448-2319470 ACTTGAAGTCAGGAGGTGGAGGG + Intergenic
1078146899 11:8728084-8728106 GCTTGAGCCCAGGAGGTTGAGGG - Intronic
1078182993 11:9028132-9028154 GCTTGAGCCCAGGAGGTGAAGGG - Intronic
1078187133 11:9061474-9061496 ACTTGAGCCCAGGAGGTCAAGGG + Intronic
1078236519 11:9490099-9490121 ACTTGAGCCCAGGAGTTGGAGGG + Intronic
1078388529 11:10914688-10914710 TCTTGAGCCCAGGAGGTCGAGGG - Intergenic
1078422313 11:11222794-11222816 ACTTGAAACCAGAAGGTGGAGGG - Intergenic
1078431770 11:11293622-11293644 ACTTGAGCCTGGGAGGTGGAAGG - Intronic
1078471034 11:11586903-11586925 ACTTGAACCCAGGAGGCGGAGGG + Intronic
1079206609 11:18421134-18421156 ACTTGAACCTGGGAGGTGGAGGG - Intronic
1079227643 11:18621210-18621232 GCTTGAACCCAGGAGGTGAAGGG + Intronic
1079506786 11:21162031-21162053 ACTTGAACCTGGGAGGTGGAGGG - Intronic
1079628396 11:22644702-22644724 ATTTGAACCCGGGAGGTGGAGGG - Intronic
1079647061 11:22878313-22878335 GCTTGAGCCCAGGAGTTGGAGGG - Intergenic
1079650484 11:22922350-22922372 CCTTGAGCCCAGGGGCTTGAGGG - Intergenic
1080241842 11:30135809-30135831 CCTTGAGCCCAGGAGGTCGAAGG - Intergenic
1080535051 11:33213197-33213219 ACTTGAACCCGGGAGGCGGAGGG + Intergenic
1081240756 11:40703494-40703516 ACTTGAGCCCTGGAGGTTGATGG + Intronic
1081517537 11:43847622-43847644 ACTTGAGCCCAGGAGGTTGAAGG + Intronic
1081893568 11:46565853-46565875 ACTTGAGCCTGGGAGGTGGAGGG - Intronic
1081961414 11:47140511-47140533 ACTTGAACCCAGGGAGAGGCGGG - Intronic
1082051886 11:47777144-47777166 ACTTGAACCCGGGAGGCGGAAGG + Intergenic
1082059052 11:47845221-47845243 GCTTGAACCCAGGAGGTGGAGGG - Intronic
1082074927 11:47968814-47968836 ACTTGAACCCAGGAGGTGGAAGG + Intergenic
1082931074 11:58606142-58606164 ACTTGAACCCAGGAGGTGGAGGG - Intronic
1082973945 11:59053954-59053976 GCTTGAACCCAGGAGGTGGAGGG - Intergenic
1083101632 11:60313184-60313206 ACTTGAACCCAGGAGGTGTAGGG - Intergenic
1083222276 11:61260354-61260376 GCTTGAGCCCAGGAGGTTGAGGG - Intronic
1083371927 11:62189305-62189327 ACTTGAGCCCAGAGGTTAGAGGG + Intergenic
1083552670 11:63601892-63601914 GCTTGAACCCAGGAGGTGGTGGG + Intronic
1083560507 11:63669863-63669885 ATTTGAACCCAGGAGGCGGAGGG + Intronic
1083561610 11:63677446-63677468 ACTTGAACCCAGGAGGTGGAGGG + Intergenic
1083794678 11:65008564-65008586 ACTTGAACCCTGGGGGTGGTGGG - Intergenic
1083967921 11:66054097-66054119 ACTTGAACCCTGGAGGTGGACGG + Intronic
1084059044 11:66657598-66657620 ACTTGAACCCGGGAGGTGGAGGG + Intronic
1084074509 11:66762551-66762573 GCTTGAACCCAGGAGGCGGAAGG - Intronic
1084081405 11:66827880-66827902 ACTTGAATCTAGGGGGCGGAGGG + Intronic
1084132126 11:67144333-67144355 AGTTGAACCCAGGAGGTGGAGGG - Intronic
1084135374 11:67175344-67175366 ACTTGAGCCCAGGAGGTCAAGGG + Intronic
1084138544 11:67206651-67206673 GCTTGAACCCAGGAGGTGGGAGG + Intronic
1084152197 11:67293582-67293604 ACTTGAGCCTGGGAGGTGGAGGG - Intronic
1084188372 11:67487369-67487391 GCTTGAACCCAGGAGGTGGAGGG - Intronic
1084216655 11:67650585-67650607 ACGTGGCCCCAGAGGGTTGAGGG + Exonic
1084293761 11:68196072-68196094 ACTTGAGCCCAGGAGATGGAGGG + Intronic
1084382385 11:68821233-68821255 ACTTGAACCCAGGAGGCAGAGGG - Intronic
1084584134 11:70046339-70046361 ACTTCACGCCTGGGGGTGGGAGG + Intergenic
1084730984 11:71073548-71073570 ACTTGAGCCCTGGGGGTTTAAGG - Intronic
1084751488 11:71207001-71207023 GCTTGAGCCCAGGAGGTTGAGGG + Intronic
1085095415 11:73756269-73756291 ACTTGAGCCTGGGAGGTGGAGGG + Intronic
1085115831 11:73930662-73930684 GCTTGAACCCAGGAGGTGGAGGG + Intergenic
1085362836 11:75907594-75907616 ACTTGAGCCCAGGAGTTTGAGGG - Intronic
1085396587 11:76209790-76209812 ACTTCAGCCCCGGGGGTGGGAGG + Intronic
1085673073 11:78487271-78487293 GCTTAAACCCAGGAGGTGGAGGG + Intronic
1085874113 11:80385523-80385545 GCTTGAACCCAGGAGGTAGAAGG + Intergenic
1085899766 11:80684774-80684796 GCTTGAACCCAGGAGGCGGAGGG + Intergenic
1085932118 11:81096310-81096332 GCTTGAACCCAGGAGGTGGAGGG - Intergenic
1085966169 11:81529617-81529639 ACTTGAACCCAGGAGGTGGAGGG + Intergenic
1086101929 11:83109866-83109888 TCTTGACCCCAGGAGGTTTAAGG - Intergenic
1086479853 11:87222719-87222741 GCGTGAACCCAGGAGGTGGAAGG + Intronic
1086574964 11:88329397-88329419 TCTTAAACCCAGGAGGTGGAAGG + Intronic
1087169824 11:95038945-95038967 ACTTGAGCCCAGGAGTTTGAGGG - Intergenic
1087393295 11:97566962-97566984 TCATGACCCCAGGATGTGGAGGG + Intergenic
1087468162 11:98537033-98537055 ACTGGACTAGAGGGGGTGGATGG - Intergenic
1087605308 11:100370382-100370404 GCTTGAACCCAGGAGGCGGAGGG - Intergenic
1087838122 11:102895064-102895086 ACTTGAGCCCAGGAGGTGGAGGG + Intergenic
1088061170 11:105652992-105653014 GCATGAACCCAGGAGGTGGATGG - Intronic
1088235195 11:107715931-107715953 ACTTGAGCCCAGGCAGTGAATGG + Intronic
1088247439 11:107832721-107832743 ACCTGACCCCAGGGAGTTCAAGG + Intronic
1088319082 11:108536346-108536368 ACTTGAGCCTGGGAGGTGGAGGG - Intronic
1088364486 11:109025166-109025188 ACTTGAACCTGGGAGGTGGAGGG - Intergenic
1088389578 11:109299383-109299405 ACTTGAACCCGGGAGGTAGAGGG - Intergenic
1088768916 11:113013341-113013363 CCTTGAACCCAGGAGGCGGAGGG + Intronic
1088855910 11:113753486-113753508 GCTTGGACCCAGGAGGTGGAGGG - Intronic
1089188083 11:116634581-116634603 GCTTGAACCCAGGAGGTGGAGGG + Intergenic
1089203155 11:116737502-116737524 GCTTGAACCCAGGAGGTGGAGGG + Intergenic
1089224666 11:116907561-116907583 GCTTGAACCCAGGAGGCGGAGGG + Intronic
1089244243 11:117106808-117106830 ACTTGAACTCCGGAGGTGGAGGG - Intergenic
1089663157 11:119998864-119998886 ACTTGAACCCAGGAGGTGGAGGG - Intergenic
1090067605 11:123517000-123517022 GCTTGAGCCCAGAAGGTGGAGGG - Intergenic
1090070476 11:123540146-123540168 ACTTGAGCCCAGGAGGTCAAGGG - Intronic
1090112449 11:123928431-123928453 ACTTGAACCCAGGAGGTGGATGG - Intergenic
1090252264 11:125259957-125259979 GCTTGAGCCCAGGAGCTGGAGGG - Intronic
1090264779 11:125347046-125347068 ACTTGACCAGAGGGAGTGGGCGG + Intronic
1090296724 11:125594495-125594517 GCTTGAACCCAGGAGGTGGATGG + Intronic
1090618526 11:128540228-128540250 ACTTCAACCCAGGAGGCGGACGG + Intronic
1091086929 11:132730094-132730116 CCTTGAACCCAGGAGGTGGAGGG - Intronic
1091425001 12:380183-380205 GCTTGAACCCAGGAGGTGGGAGG + Intronic
1091867982 12:3859012-3859034 ATTTGAACCCAGGAGGTGGGGGG + Intronic
1092068237 12:5611051-5611073 GCTTGAACCCTGGAGGTGGAGGG - Intronic
1092404990 12:8214865-8214887 ACTTGAACCCAGGAGGCAGAAGG + Intergenic
1092410678 12:8250664-8250686 GTTTGAGCCCAGGAGGTGGAGGG + Intergenic
1092529644 12:9333894-9333916 ACTTGACACCCAGGGGTGGCTGG - Intergenic
1092873309 12:12826523-12826545 GCTTGAGCCCAGGGGGTGGAAGG - Intronic
1093005904 12:14050341-14050363 GCTTGAGCCCAGAAGGTGGAGGG + Intergenic
1093018255 12:14176528-14176550 ACTTGAGCCCAGGAGTTCGAGGG + Intergenic
1093033126 12:14307572-14307594 ACGTGAACCCAGGAGGCGGAGGG - Intergenic
1093091229 12:14922984-14923006 ACTTGAACCCAGAAGGTGGAGGG + Intronic
1093317480 12:17668699-17668721 GCTTGAACCCGGGAGGTGGAGGG - Intergenic
1093665567 12:21808683-21808705 ACTTGACCCCAGGGATTAGAGGG + Intronic
1093894055 12:24557303-24557325 CCTTGAACCCAGGAGGCGGAGGG + Intergenic
1093944559 12:25092480-25092502 GCTTGAACTCAGGAGGTGGAGGG + Intronic
1093953665 12:25192928-25192950 ACTTGAGCCCAGGAGTTTGAGGG + Intronic
1094030123 12:26002348-26002370 GCTTGAACCCAGAGGGTGGAGGG + Intronic
1094055709 12:26267722-26267744 GCTTGAATCCAGGAGGTGGAGGG - Intronic
1094127593 12:27039731-27039753 ACTTGAATCCGGGAGGTGGAGGG - Intronic
1094138131 12:27151104-27151126 ACTTGAACCCAGGGTGGGGAGGG + Intergenic
1094160674 12:27386710-27386732 GCTTGAGCCCGGGAGGTGGAGGG - Intronic
1094619076 12:32062844-32062866 GCTTGAACCCAGGAGGTGGATGG - Intergenic
1094623857 12:32105171-32105193 GCTTGAATCCAGGAGGTGGAGGG - Intergenic
1094627806 12:32141554-32141576 GCTTGAACCCAGGAGGTGGAGGG - Intronic
1094640265 12:32267884-32267906 ACTTGAGCCCAGGAGTTAGAGGG - Intronic
1094683683 12:32688977-32688999 GCTTGAGCCCAGGAGGTTGAGGG + Intronic
1094787467 12:33865126-33865148 ACTTGAACCCAGAAGGTAGATGG + Intergenic
1095093998 12:38135109-38135131 ACTTGAACCCAGGAGGCAGAGGG + Intergenic
1095275374 12:40276376-40276398 GCTTGAACCCAGGAGGCGGAGGG - Intronic
1095324290 12:40869348-40869370 ACTTGATCCCAGGGAGGGCAAGG - Intronic
1095443482 12:42260998-42261020 ACTTGAACCCGGGAGGTGGAAGG + Intronic
1095449996 12:42320529-42320551 ACTTGAACCCAGGAGGCGGATGG - Intronic
1095766564 12:45901742-45901764 ACTTGAGCCCAGGAGGTTGGAGG - Intronic
1095854586 12:46845776-46845798 GCTTGAATCCAGGAGGTGGAGGG + Intergenic
1096043174 12:48538428-48538450 ACTTGAGCCCAGGAGGTTGAGGG + Intergenic
1096088005 12:48879192-48879214 GCTTGAGCCCAGGAGGTTGAGGG + Intergenic
1096131276 12:49160885-49160907 TCTTGAACCCAGGAGGCGGAGGG - Intergenic
1096201550 12:49687174-49687196 ACTTGAACCCAGGAGGCGGAGGG - Intronic
1096316497 12:50571633-50571655 ACTTGAACCCAGGAGGCGGAGGG - Intronic
1096405618 12:51342120-51342142 ACTTGAACCCAGGAGGAAGAGGG - Intronic
1096493364 12:52025140-52025162 ACTTGAACCCGGGGGACGGAGGG - Intronic
1096564545 12:52467705-52467727 ACTTGAACCCAGGAGCAGGAGGG - Intergenic
1096631630 12:52930641-52930663 ACTTGAACCCAGGAGGTCTAGGG - Intronic
1096632753 12:52939419-52939441 ACTTGAACCTGGGAGGTGGAAGG + Intronic
1096702462 12:53394487-53394509 ACTTGATCCCAGGAGGTCAAGGG - Intronic
1096726128 12:53564291-53564313 ACCTGAACCCAGGAAGTGGAGGG + Intronic
1096820111 12:54227255-54227277 ACTTGAACCCAGGAGGCAGAAGG + Intergenic
1096821401 12:54238105-54238127 GCTTGAACCCAGGAGGTGGAGGG + Exonic
1096822763 12:54250138-54250160 ACTTGAACCCAGGAGATGGAGGG + Intronic
1096837668 12:54361451-54361473 GCTTGAACCCGGGAGGTGGAGGG - Intergenic
1096987880 12:55773792-55773814 ACTTGAACCTGGGAGGTGGAGGG - Intronic
1097123630 12:56755242-56755264 ACCTGAGCCCAGGAGGCGGAGGG + Intronic
1097172119 12:57121725-57121747 GCTTGAACCCAGGAGGTGGAGGG - Intronic
1097217181 12:57423339-57423361 GCTTGAACCCAGGAGGCGGAGGG + Intronic
1097218601 12:57433376-57433398 ATTTGAGCCCAGGAGGTTGAAGG - Intergenic
1098142740 12:67468075-67468097 ACTTGAGCCCAGGAGTTTGAAGG - Intergenic
1098247593 12:68536174-68536196 CCTTGAACCCAGGAAGTGGAGGG + Intergenic
1098347983 12:69525940-69525962 GCTTGAACCCAGGGGGCGGAAGG - Intronic
1098363163 12:69675200-69675222 ACTTGAGCCCAGGAGGCCGAGGG - Intronic
1098420616 12:70293241-70293263 TCTTGAACCCAGGAGGTAGAGGG - Intronic
1098427229 12:70378617-70378639 ACTTGAACCCAGGAGGCAGAGGG - Intronic
1098554317 12:71801642-71801664 GCTTGAACCCAGGAGGTGGATGG - Intergenic
1098916117 12:76258555-76258577 ACTTGAACCCAGGGGGGCGGAGG - Intergenic
1098992804 12:77083522-77083544 ACTTGAGCCCAGAGAGTTGAGGG + Intergenic
1099120661 12:78685784-78685806 ACTTGAGCCCAGGAGTTCGAGGG + Intergenic
1099427673 12:82544706-82544728 ACTTGAGTCCAGGAGGTTGAGGG - Intergenic
1099454895 12:82851345-82851367 GCTTGAACCCAGAAGGTGGAGGG + Intronic
1100261035 12:92932206-92932228 ACTTGAAGGCAGGAGGTGGATGG + Intergenic
1100321059 12:93493340-93493362 ACTTGAGCCCAGGAGCTTGAGGG - Intronic
1100321615 12:93498658-93498680 ACTTGAGCCCAGGAGCTTGAGGG + Intronic
1100352344 12:93796520-93796542 ACTTGAACCCAGGAGGCAGAGGG + Intronic
1100459338 12:94783400-94783422 GCTTGAACCCAAGAGGTGGAGGG + Intergenic
1100507751 12:95236651-95236673 ACCTGAACCCAGGAGGTGGAGGG - Intronic
1100824644 12:98463136-98463158 ACTTGAGCCCAGGGGTTCTAGGG + Intergenic
1100953388 12:99877975-99877997 ATTTGAGCCCAGGAAGTGGAGGG + Intronic
1100986654 12:100208356-100208378 GCTTGAACCCAGGAGGTGGAGGG - Intronic
1101463889 12:104926999-104927021 ACTTGAGCCCAGGAGGTTGAGGG + Intronic
1101470705 12:104994262-104994284 GCTTGAGCCCAGGAGGCGGAGGG + Intronic
1101476301 12:105051865-105051887 GCTTGAACCTAGGAGGTGGAGGG - Intronic
1101868927 12:108546280-108546302 GCTTGAACCCAGGAGGTAGAGGG - Intronic
1101917121 12:108904355-108904377 TCTTGAACCCAGGAGGTGGAGGG - Intergenic
1101929682 12:109003688-109003710 GCTTGAGCCCAGGAGTTGGAGGG - Intronic
1102012084 12:109624995-109625017 AGTTGACCCTGGCGGGTGGATGG + Intergenic
1102014787 12:109640840-109640862 ACTTGAACCCAGGAGTTGGAGGG + Intergenic
1102020801 12:109681022-109681044 ACTTGAGCCCAGGAGGTTGAGGG - Intergenic
1102048415 12:109844754-109844776 ACTTGAACCCAGGAGGCAGAGGG + Intergenic
1102054554 12:109886789-109886811 GCTTGAACCCGGGAGGTGGAGGG - Intergenic
1102095550 12:110237692-110237714 ACTTGAACCCAGGAGGCAGAGGG + Intergenic
1102108060 12:110342836-110342858 GCTTGAACCCAGGAGGTGGAGGG - Intronic
1102168018 12:110821512-110821534 ACTTGAGCCCAGGAGGTGGAGGG - Intergenic
1102442489 12:112974503-112974525 ACTTGAACCCAGGAAGTGGAGGG - Intergenic
1102901220 12:116638938-116638960 GCTTGAACCCAGGAGGTGGAGGG - Intergenic
1102908844 12:116697204-116697226 ACTTGAACCCGGGAGGTGGAGGG + Intergenic
1103215407 12:119198026-119198048 ACTTGAACCTGGGAGGTGGAGGG - Intronic
1103303175 12:119943579-119943601 ACTTGAACCGGGGAGGTGGAGGG + Intergenic
1103502420 12:121413492-121413514 GCTTGAACCCAGGAGGCGGAGGG - Intronic
1103645799 12:122391501-122391523 GCTTGAACCCAGGAGGCGGAGGG + Intronic
1103664100 12:122548290-122548312 GTTTGAACCCAGGGGGTGGGGGG - Intronic
1103680357 12:122689022-122689044 ATTTGAACCCAGGAGGCGGAAGG + Intergenic
1104145142 12:126026205-126026227 ACTTGAACCCAGGCAGTGGAGGG - Intergenic
1104305818 12:127610293-127610315 ACTTGAACCCAGGAGGTGTAAGG - Intergenic
1104436600 12:128761950-128761972 CCTTGAGCCCAGGAGGCGGAGGG - Intergenic
1104441400 12:128796343-128796365 ACTTGAACCCGGGAGGTGAAAGG + Intronic
1105300452 13:19129391-19129413 ACTTGAGCTCAGGAGGTCGAGGG + Intergenic
1105328189 13:19389390-19389412 ACTTGAACCCAGGAGGTGGAAGG - Intergenic
1105517978 13:21107444-21107466 ACTTGAACCCAGGGGGACAAAGG + Intergenic
1105519667 13:21120883-21120905 ACTTGACCCCAGGAGTTCAAGGG - Intergenic
1105527937 13:21192943-21192965 ACTTGAACCCGGGAGGCGGAAGG - Intergenic
1105763977 13:23540147-23540169 CATTGAACCCAGGAGGTGGACGG + Intergenic
1105808996 13:23977985-23978007 GCTTGAACCCAGGAGGTGAAGGG - Intergenic
1105984488 13:25552067-25552089 GCTTGAACCCAGGAGGTGGAGGG - Intronic
1106245384 13:27945102-27945124 GCTTGAACCCGGGAGGTGGAGGG + Intergenic
1106411751 13:29515609-29515631 ATCTCACCCCAGGGGCTGGAGGG - Intronic
1106678232 13:31984274-31984296 GCTTGAACCCAGGAGGTGGGAGG + Intergenic
1106680664 13:32003869-32003891 ACTTGACGGCAGAGGGTGGGAGG + Intergenic
1107188882 13:37556324-37556346 GCTTGAACCCAGGAGGTGGAGGG - Intergenic
1107474904 13:40726732-40726754 GCTTGAACCCAGGAGGTGAAGGG - Intergenic
1107514765 13:41118473-41118495 GCTTGAACGCAGGAGGTGGAAGG - Intergenic
1107531747 13:41289318-41289340 ACTTGAACCCAGGAGGCAGAGGG - Intergenic
1107642097 13:42454002-42454024 CCTTGAATCCAGGAGGTGGAGGG - Intergenic
1107702565 13:43062799-43062821 ACTTGAACCCAGGAGGCGGAGGG - Intronic
1107908713 13:45085352-45085374 GCTTGAACCTGGGGGGTGGAGGG + Intergenic
1107911333 13:45108336-45108358 ACTTGAGCCCAGGAAGTTGAAGG - Intergenic
1108244649 13:48502408-48502430 GCTTGAACCCAGGGGCTGAAGGG + Intronic
1108325392 13:49325704-49325726 ACTTGAACCTGGGAGGTGGAGGG + Intronic
1109120600 13:58451544-58451566 GCTTGAACCCGGGAGGTGGAGGG - Intergenic
1109164694 13:59019606-59019628 GCTTGAACCCAGGAGGCGGAGGG - Intergenic
1110268985 13:73571981-73572003 GCTTGAACCCGGGAGGTGGAGGG - Intergenic
1110301543 13:73935060-73935082 ACTTGAGCCCGGGAGGTGGAGGG - Intronic
1110598331 13:77342754-77342776 ACTTGAGCCCAGGAGTTTGAGGG - Intergenic
1110637095 13:77778771-77778793 GCTTGAACCCAGGAGGTGGAGGG + Intergenic
1111664134 13:91245795-91245817 ACTTGAGCCCAGGAGTTGGAGGG - Intergenic
1112551076 13:100421122-100421144 GCTTGAACCCGGGAGGTGGACGG + Intronic
1112891281 13:104235181-104235203 ACTTGAGCCCAGGAGGTTGAGGG + Intergenic
1112906339 13:104427146-104427168 GCTTGAACCCAGGAGGTGGAGGG - Intergenic
1113827191 13:113265468-113265490 GCTTGAACCCAGGAGGCGGAGGG - Intronic
1113837379 13:113337209-113337231 ACTTGAACCCAGGAGGTCAAAGG + Intronic
1114040403 14:18673065-18673087 ACTTGAACCCTGGAGGTGGAGGG + Intergenic
1114045440 14:18871581-18871603 ACTTGAACCCTGGAGGTGGAGGG + Intergenic
1114118772 14:19647887-19647909 ACTTGAACCCTGGAGGTGGAGGG - Intergenic
1114307796 14:21439042-21439064 GCTTGAACCCAGCAGGTGGAGGG + Intronic
1114467179 14:22931271-22931293 ACTTGAACCTAGGAGGTGGGAGG + Intergenic
1114596273 14:23914920-23914942 ACTTGAGCTCGGGAGGTGGAGGG - Intergenic
1115190708 14:30744749-30744771 ACTTGAACCCGGGAGGCGGAGGG - Intergenic
1115233619 14:31187273-31187295 GCTTGAACCCTGGAGGTGGAAGG + Intronic
1115309020 14:31960996-31961018 GCTTGAACCCAAGAGGTGGAGGG - Intergenic
1115554058 14:34530115-34530137 ACTTGAACCCAGGCGGTGGAGGG + Intronic
1115602398 14:34968009-34968031 GCTTGAACCCAGGAGGTGGAGGG - Intergenic
1116465477 14:45227460-45227482 ACTTGAACCCAGGAGGCAGAGGG + Intronic
1116895207 14:50309763-50309785 GCTTGAGCCCAGGAGGTTGAAGG - Intronic
1117382537 14:55178962-55178984 ACTTGAACCCGGGGAGCGGAAGG + Intronic
1117385034 14:55202924-55202946 GCTTGAGCCCAGGAGGTTGAGGG + Intergenic
1117895436 14:60480337-60480359 ACTTGAACCCAGGAGGTGGAGGG + Intronic
1118198782 14:63652975-63652997 ACTTGAACCTGGGAGGTGGAGGG - Intergenic
1118232807 14:63969423-63969445 ACTTGAATCCAGGAGGTGGAGGG - Intronic
1118271631 14:64348578-64348600 ACTTGAGCCCAGGAGATTGAGGG - Intergenic
1118395355 14:65331423-65331445 GCTTGAACCCAAGAGGTGGAGGG + Intergenic
1118398705 14:65359913-65359935 ACTTGAACCCAGGAGGCGGGAGG - Intergenic
1118537039 14:66778816-66778838 ACTTGAACCCAGGAGGTTGGAGG - Intronic
1118577575 14:67258923-67258945 ACTTGAACCCGGGAGGTGGGAGG - Intronic
1118752798 14:68818817-68818839 ACATGACCTCATGGAGTGGATGG - Intergenic
1118814640 14:69301434-69301456 ACTTGAACCCAGGAGGTGGAGGG - Intronic
1118831513 14:69437670-69437692 GCTTGAACCCGGGAGGTGGAGGG - Intronic
1118881761 14:69833538-69833560 ACTTGAACCCAGGAGGTGGAGGG - Intergenic
1119017018 14:71068246-71068268 GCTTGAACCCAGGAGGTGGAGGG + Intronic
1119147331 14:72329347-72329369 ACTTGGCACCAGGGAGTGGTTGG - Intronic
1119193334 14:72699437-72699459 ACTTGAGCCCAGGAGGTCGAGGG + Intronic
1119228199 14:72960230-72960252 ACTAGAACCCAGGAGGTGGAGGG - Intergenic
1119340071 14:73869437-73869459 ACTTGAGCCCGGGAGGTGGGAGG + Intronic
1119354226 14:73991914-73991936 ACTTGAACCCGGGAGGTGAAGGG + Intronic
1119453469 14:74733404-74733426 ACTTCACCCCATGGGGCGGGTGG + Intronic
1119656147 14:76418696-76418718 ACTTGAACCCAGGAGGTGGGAGG - Intronic
1119663373 14:76466804-76466826 GCTTGAACCCGGGAGGTGGAGGG - Intronic
1119749280 14:77066132-77066154 GCTTGAGCCCAGGAGGTTGAGGG - Intergenic
1119919050 14:78429157-78429179 GCTTGAACCCAAGAGGTGGAGGG - Intronic
1120330139 14:83082021-83082043 GCTTGAACCCGGGAGGTGGAGGG + Intergenic
1120424288 14:84327955-84327977 GCTTGAACCCAGGAGGTGGGAGG + Intergenic
1120990737 14:90374744-90374766 ACTTGAACCCGGGAGGCGGAGGG + Intergenic
1121082290 14:91118161-91118183 GCTTGAACCCAGGAGGTGGAGGG - Intronic
1121297544 14:92841675-92841697 GCTTGAACCCAGGAGGTGGAAGG - Intergenic
1121770053 14:96526413-96526435 AATTGAGCCCAGGAGGTGGAAGG - Intronic
1122211574 14:100177522-100177544 ACTTGAACCCAGGGCTTAGAAGG - Intergenic
1122335151 14:100970410-100970432 ACTTGAACCCAGGAAGCGGAGGG - Intergenic
1122439571 14:101720828-101720850 ACTTGAGACCAGGAGGTGGAGGG + Intergenic
1122520946 14:102343381-102343403 ACTTGAACCCAGGAAGCGGAGGG - Intronic
1122650470 14:103223486-103223508 GCTTGAACCCGGGAGGTGGAGGG + Intergenic
1122722786 14:103731524-103731546 ACTTGAACCCGGGAGGCGGAGGG + Intronic
1122929831 14:104928140-104928162 ACATTACCCCCAGGGGTGGAAGG - Intronic
1123693908 15:22863159-22863181 ACTTGAACCCAGGAGGCAGAGGG - Intronic
1123711775 15:22993478-22993500 ATTTGAGCCCAGGAGGTCGAGGG - Intronic
1123878148 15:24645602-24645624 ACTTGAACCCAGGAGGCAGAGGG + Intergenic
1123903674 15:24901011-24901033 ACTTGAGCCCTGGAGGTTGAGGG + Intronic
1123907128 15:24932315-24932337 ACTTGAACCCAGGAGGCGGAGGG - Intronic
1124030202 15:26003568-26003590 GCTTGAACCCTGGAGGTGGAGGG + Intergenic
1124107080 15:26748941-26748963 ACTTGAACCCAAATGGTGGAGGG + Intronic
1124357238 15:29004760-29004782 GCTTGAACCCAGGAGGCGGAGGG - Intronic
1124433672 15:29630031-29630053 GCTTGAACCCAGGAGGCGGAGGG + Intergenic
1124615011 15:31235292-31235314 ACTTGAGCCCAGGAGGTCAAGGG - Intergenic
1124984120 15:34589251-34589273 ACTTGAACCCAGGAGAAGGAAGG - Intergenic
1125348590 15:38744100-38744122 GCTTGAACCCAGGAGGCGGAGGG - Intergenic
1125564760 15:40668120-40668142 ACTTGAGCCCAGGAGGCAGAGGG + Intergenic
1125608832 15:40957520-40957542 ACTTGTACCCAGGGGGCTGAAGG - Intergenic
1125664843 15:41422115-41422137 GCTTGAACCCAGGAGGTGGAAGG - Intronic
1125703029 15:41705442-41705464 GCTTGAGCCCAGGAGGTTGAGGG - Intronic
1125912972 15:43458347-43458369 ACTTGAACCCAGGAGGCAGAAGG + Intronic
1126047383 15:44654751-44654773 GCTTGAACCCAGGAGGCGGAGGG + Intronic
1126283403 15:46983866-46983888 ACTTGAGGGCAGAGGGTGGAAGG - Intergenic
1126827132 15:52562956-52562978 ACTTGAACCCAGCGTGGGGAGGG - Intronic
1126932426 15:53669368-53669390 ACTTAGCCCTAGGGGGTGGAGGG + Intronic
1127213799 15:56802850-56802872 ACTTGAGCCCAGGAGTTCGAGGG + Intronic
1127412388 15:58722257-58722279 ACTTGAACCCGGAAGGTGGAGGG + Intronic
1127457417 15:59167757-59167779 GCTTGAGCCCAGGAGGCGGAGGG - Intronic
1127722409 15:61716015-61716037 ACTTGAACCCAGGAGGCAGAGGG + Intergenic
1127796049 15:62439393-62439415 ACTTGAACCCAGGAGGCGGAGGG - Intronic
1127846032 15:62871993-62872015 ACTTGAGCCCAGGAGGTCCAGGG - Intergenic
1127988243 15:64091975-64091997 GCTTGAGCCCTGGAGGTGGATGG + Intronic
1128050193 15:64657174-64657196 ACTTGAACCCAGGAGGTGAAGGG + Intronic
1128201750 15:65814940-65814962 CCTTGAACCCAGGAGGTGGAGGG - Intronic
1128221470 15:65971711-65971733 ATTGGACACCTGGGGGTGGAGGG - Intronic
1128399053 15:67258147-67258169 ACTTGAACCTGGGAGGTGGAGGG + Intronic
1128493861 15:68179656-68179678 ACTTGAACCCAGGAGGCGGAGGG - Intronic
1128993308 15:72278433-72278455 ACCTGAACCCAGGAGGCGGAGGG - Intronic
1129032049 15:72626340-72626362 GCCTGAACCCAGGAGGTGGAGGG - Intergenic
1129088502 15:73123072-73123094 ACTTGAACCCGGGAGGTGGAGGG + Intronic
1129285148 15:74518596-74518618 GCTTGAACCCAGGAGGTGGAGGG - Intergenic
1129349615 15:74947717-74947739 GCTTGAACCCAGGAGGTGGAGGG - Intergenic
1129420318 15:75419740-75419762 ACTTGAACCCAGGCAGGGGAGGG + Intronic
1129421022 15:75426847-75426869 GCTTGAGCCCAGGAGGTGAAGGG + Intronic
1129422275 15:75438280-75438302 GCTTGAACCCAGGGTGCGGAGGG + Intronic
1129754265 15:78087120-78087142 GCTTGAGCCCAGGAGGTTGAGGG + Intronic
1129803151 15:78431838-78431860 GCTTGAACCCGGGAGGTGGATGG + Intergenic
1129980457 15:79864460-79864482 GCTTGAACCCGGGAGGTGGAGGG + Intronic
1130200283 15:81819741-81819763 ACTTGAGCCCAGGAGTTAGAAGG - Intergenic
1130301521 15:82682631-82682653 ACTTGAGCCCAGGGAGTTGGAGG + Intronic
1130538651 15:84804686-84804708 ACTTGACCTTAGGGCATGGAGGG + Exonic
1130544707 15:84846601-84846623 ACTTGAACCCAGGATGTTGAGGG + Intronic
1130641803 15:85683550-85683572 GCTTGAACCCGGGAGGTGGAGGG - Intronic
1131145786 15:90011011-90011033 ACTTGAACCCAGGAGGCAGAGGG - Intronic
1131192852 15:90331102-90331124 ACTTGACCCCAGGAGGCGGAGGG + Intergenic
1131216499 15:90540688-90540710 GCTTGAACCCAGGAGGCGGAGGG + Intronic
1131232311 15:90668160-90668182 ACTTAAACCCAGGAGGCGGATGG + Intergenic
1131301619 15:91204638-91204660 ACTTGAGCCCAGGAGGTTCAAGG - Intronic
1131402310 15:92134990-92135012 ACTTGAGCCCAGGAGTTGGAGGG + Intronic
1131729891 15:95268459-95268481 ACTTGAGCCTGGGAGGTGGAAGG - Intergenic
1132360007 15:101204349-101204371 ACTTGAACCCGGGAGATGGAGGG + Intronic
1132487282 16:200797-200819 GCTTGAGCCCAGGAGGTTGAAGG + Intronic
1132525836 16:414218-414240 ACTTGAACCCAGGAGGCAGAGGG - Intergenic
1132924025 16:2418032-2418054 ACTTGAACCCAGGAGGTGGAGGG - Intergenic
1133017012 16:2948478-2948500 ACTTGAACCCAGGAGGCGGGGGG + Intronic
1133136311 16:3714574-3714596 ACTCGAACCCAGGAGGCGGAGGG + Intronic
1133328086 16:4954498-4954520 ACTTGAACCTGGGAGGTGGAGGG - Intronic
1133583079 16:7165510-7165532 GCTTGATTCCAGGAGGTGGAGGG - Intronic
1133678359 16:8097184-8097206 GCTTGAACCCAGGAGGTGGATGG - Intergenic
1133682892 16:8137127-8137149 ACTTGAGTCCAGGAGGTGGAGGG + Intergenic
1133709423 16:8386992-8387014 ACTTGAATCTGGGGGGTGGATGG - Intergenic
1133764248 16:8825406-8825428 GCTTGAACCCAGGAGGCGGAGGG - Intronic
1133772625 16:8876381-8876403 ACTTGAACCAGGGAGGTGGAGGG - Intergenic
1133784845 16:8965460-8965482 ACTTGAACCCGGGAGGTGGAGGG + Intergenic
1133857730 16:9565202-9565224 ACTTGAACCTGGGAGGTGGAGGG + Intergenic
1134162594 16:11903602-11903624 ACTTGAACCCGGGAGGTGGAGGG + Intronic
1134254231 16:12598574-12598596 ACTTGAAACCAGGAGGTAGAGGG - Intergenic
1134423711 16:14118217-14118239 ACTTGAGCCTGGGAGGTGGAGGG - Intronic
1134507080 16:14816797-14816819 GCTTGAACCCAGGAGGCGGAGGG - Intronic
1134533616 16:15005780-15005802 GCTTGAACCCAGGAGGTGGAGGG - Intronic
1134640626 16:15826908-15826930 ACTTGAACCTGGGAGGTGGAGGG + Intronic
1134643790 16:15850300-15850322 GCTTGAACCCAGGAGGTGGAGGG + Intronic
1134647906 16:15885223-15885245 ACTTGAACCTGGGAGGTGGAGGG + Intronic
1134666754 16:16024432-16024454 GCTTGAGCCCCGGAGGTGGAGGG - Intronic
1134694780 16:16215554-16215576 GCTTGAACCCAGGAGGCGGAGGG - Intronic
1134893591 16:17863644-17863666 GCTTGAACCCAGGAGGCGGAGGG + Intergenic
1134977051 16:18579098-18579120 GCTTGAACCCAGGAGGCGGAGGG + Intergenic
1135167181 16:20149361-20149383 ACTTGAACCTGGGAGGTGGAGGG + Intergenic
1135731268 16:24897033-24897055 ACTTGAACCCGGGAGGTGGAGGG - Intronic
1135779331 16:25286095-25286117 GCTTGAGCCCGGGAGGTGGAGGG - Intergenic
1135790252 16:25387773-25387795 GCTTGAGCCCGGGAGGTGGAAGG - Intergenic
1136159465 16:28409292-28409314 GTTTGAACCCAGGAGGTGGAGGG - Intergenic
1136203622 16:28706002-28706024 GTTTGAACCCAGGAGGTGGAGGG + Intronic
1136333997 16:29600021-29600043 GCTTGAACCCAGGAGGCGGAGGG - Intergenic
1136489422 16:30596720-30596742 ACTTGAGCCTGGGAGGTGGAGGG + Intergenic
1136519929 16:30788686-30788708 ACTTGAGCCCAGGAGTTTGAAGG + Intergenic
1136552342 16:30988413-30988435 GCTTGAACCCAGGAGGTTGAGGG - Exonic
1136588712 16:31204018-31204040 ACTTGAGCCCAGGAGGTTGAGGG + Intergenic
1136623224 16:31443569-31443591 ACTTGAGCCCAGGAGGTTGAAGG + Intergenic
1136668324 16:31834172-31834194 ACTTGAGTCCAGGAGGTTGAAGG + Intergenic
1136852218 16:33621192-33621214 GCTTGAGCCCAGGAGGTTGAGGG - Intergenic
1136986045 16:35106153-35106175 ACTTGAACCTGGGAGGTGGAGGG + Intergenic
1137258015 16:46793600-46793622 ACTTGAACCCAAGAGGCGGAGGG + Intergenic
1137281407 16:46979906-46979928 ACTTGAGCCCAGGAAGTGGAGGG - Intergenic
1137418470 16:48308542-48308564 ACTTGAACCCAGGAGGCGGATGG + Intronic
1137434233 16:48442591-48442613 ACTTGAGCCCAGGAGTTTGAGGG - Intronic
1137459401 16:48646352-48646374 ACTTGAACCCAGGAGGGAGAGGG - Intergenic
1137620564 16:49873951-49873973 GCTTGAACCCAGGAGGTGGAGGG - Intergenic
1137992947 16:53178513-53178535 ACTTGAACCCAGGAGGTCAAGGG - Intronic
1138188678 16:54996819-54996841 ACTTGAGCACACGGGGTAGATGG - Intergenic
1138247507 16:55478815-55478837 TCCTGACCCCAGGGAGTGCAGGG + Intronic
1138313649 16:56049747-56049769 GCTTGAACCCAGGAGGTGGAGGG + Intergenic
1138445865 16:57063193-57063215 GCTTGAACCCAAGAGGTGGAGGG - Intronic
1138666008 16:58569203-58569225 GCTTGAACCCAGGAGATGGAAGG - Intronic
1138666330 16:58572198-58572220 ACTTGAACCCAGGAGGCGGAGGG + Intronic
1138697560 16:58829666-58829688 GCTTGAACCCAGGAGGCGGAGGG - Intergenic
1139093249 16:63674858-63674880 ACTTGAGCCCAGGAGGTGGAAGG - Intergenic
1139668037 16:68471944-68471966 GCTTGAGCCCAGGAGGTAGAGGG + Intergenic
1139726811 16:68906874-68906896 GCTTGAACCCAGGAGGCGGAGGG - Intronic
1139727489 16:68913146-68913168 GCTTGAACCCATTGGGTGGAAGG - Intronic
1139763814 16:69210104-69210126 GCTTGAACCCAGGAGGCGGATGG - Intronic
1139829554 16:69786225-69786247 GCTTGAACCCGGGAGGTGGAGGG - Intronic
1139837631 16:69852357-69852379 ACTTGAACCTAGGAGGTGGAGGG - Intronic
1139862417 16:70034954-70034976 ACTTGAACCCAGGAGGTGGAGGG + Intergenic
1139900339 16:70323187-70323209 TCTTGAGCCCAGGAGGTGGAGGG - Intronic
1139930232 16:70520358-70520380 ACATGAACCCGGGGGGTGGGGGG + Intronic
1140078435 16:71723303-71723325 ACATCACCCCAGCGGGAGGATGG - Intronic
1140164459 16:72535252-72535274 ACTTGAGCCCAGGAGGTTGAGGG - Intergenic
1140219840 16:73035819-73035841 ACTTGAACCCAGGAGGAGGAAGG + Intronic
1140231463 16:73120735-73120757 ACTTGAACCCGGGAGGTGGAGGG - Intergenic
1140279010 16:73537397-73537419 ACTTGAACCCAGGAGGCAGAGGG - Intergenic
1140355657 16:74303802-74303824 ACTTGAACCTGGGAGGTGGAGGG - Intronic
1140421645 16:74824106-74824128 GCTTGAACCCAGGAGGCGGAGGG + Intergenic
1140460752 16:75137818-75137840 ACTTGAGCCCAGGAGTTGCAGGG + Intergenic
1140466523 16:75187493-75187515 GCCTGAACCCAGGAGGTGGAGGG + Intergenic
1140615514 16:76657952-76657974 GCTTGACACCAGGAGGTTGAGGG + Intergenic
1140867397 16:79075633-79075655 ACTTGATCCCAGAAGGCGGAGGG - Intronic
1141059725 16:80854573-80854595 ACTTGAACCCAAGAGGTGGAAGG + Intergenic
1141077620 16:81021835-81021857 GCTTGAACCTTGGGGGTGGAGGG - Intronic
1141110828 16:81269548-81269570 GCTTGAACCCAGGAGGTGGAGGG - Intronic
1141155087 16:81591905-81591927 ACTTGAGCCTGGGAGGTGGAGGG - Intronic
1141177810 16:81732331-81732353 ACTTGAGCCCAGGAGGTGGAGGG - Intergenic
1141192310 16:81833610-81833632 TCTTGATCCTAGGAGGTGGAAGG - Intronic
1141275275 16:82581942-82581964 GCTTGAACCCGGGAGGTGGAGGG + Intergenic
1141469570 16:84229213-84229235 ACTTGAACCCAGGAGGTTGGAGG + Intronic
1141523110 16:84594559-84594581 CCTTGACCTGAGGGGGAGGAGGG + Intronic
1141532378 16:84655492-84655514 ACTTGAGCCCAGGAGGTCAAGGG + Intronic
1141532398 16:84655619-84655641 ACTTGAGCCCAGGAGGTCAAGGG + Intronic
1141722959 16:85767028-85767050 ACTTGACCCCGGGAGGTTGAGGG - Intergenic
1141751821 16:85963311-85963333 ACTTGAGCCCAGGAGGTCAAGGG + Intergenic
1142387881 16:89778077-89778099 CCTTGAACCCAGGAGGTGGAGGG + Intronic
1142544207 17:687653-687675 ACTTGAGCCCACGAGGTTGAGGG + Intronic
1142571182 17:875673-875695 ACTTGAGCCCAGGGAGTTGGAGG - Intronic
1142663942 17:1450801-1450823 GCTTGAACCCAGGAGGTGGAGGG + Intronic
1142739609 17:1923778-1923800 ACTTGAGCCCAGGGGTTCAAGGG - Intergenic
1142790189 17:2257924-2257946 ACTTGAACCCAGAAGGCGGAGGG + Intronic
1142790271 17:2258713-2258735 GCTTGAGCCCAGGAGGTGAAGGG + Intronic
1142824809 17:2502603-2502625 GCTTGAACCCAGGAGGTGGAGGG + Intronic
1143079984 17:4374419-4374441 ACTTGAACCTGGGAGGTGGAGGG + Intergenic
1143132504 17:4688250-4688272 GCTTGAACCCAGGAGGCGGAGGG + Intronic
1143259182 17:5585424-5585446 GCTGGAACCCAGGAGGTGGAGGG - Intronic
1143292632 17:5843270-5843292 ACTTGAACCCAGGAAGTAGAGGG - Intronic
1143555764 17:7658919-7658941 GTTTGAACCCAGGAGGTGGAGGG + Intergenic
1143578895 17:7812533-7812555 ACTTGAGCCCAGAAGGTTGAGGG + Intronic
1143889960 17:10095390-10095412 ACTTGAGCCCAGGAGTTCGAGGG - Intronic
1143895430 17:10132683-10132705 GCTTGAACCCAGGAGGCGGAGGG + Intronic
1144283742 17:13752187-13752209 GCTTGAACCCTGGAGGTGGAGGG + Intergenic
1144304604 17:13956616-13956638 ACCAGAACCCAGGAGGTGGAAGG + Intergenic
1144330732 17:14221663-14221685 ACTTGAACCTGGGAGGTGGAGGG + Intergenic
1144545210 17:16188526-16188548 ACGTGAACCCAGGAGGGGGAGGG + Intronic
1144561170 17:16321321-16321343 ACTTGAACCCAGGAGGTGGAGGG - Intronic
1144580167 17:16454307-16454329 GCTTGAACCCAGGAGGTGGAGGG + Intronic
1144681072 17:17195041-17195063 ACTTGAACCCGGGGGGTGGGTGG - Intronic
1145099969 17:20066819-20066841 GCTTGAGCCCAGGAGGTTGAAGG - Intronic
1145186436 17:20798756-20798778 ACTTGAATCCAGGAGGTGGAGGG - Intergenic
1145851165 17:28098763-28098785 ACTTGAACCCGGGAGGCGGAGGG - Intronic
1146009665 17:29183463-29183485 ACTTGAACCCAGGAGGCAGAGGG + Intergenic
1146038493 17:29429356-29429378 ACCTGAACCCAGGAGATGGAGGG - Intronic
1146201254 17:30860824-30860846 ACCTGAACCCAGGAGGTGGAGGG - Intronic
1146322968 17:31860744-31860766 ACTTGAGCCCGGGAGGTGGAGGG + Intergenic
1146357674 17:32147735-32147757 ACTTGAACCCAGGAGGCGGAGGG + Intronic
1146410905 17:32584019-32584041 ACTTGAGCCCAGGAGTTCGAGGG - Intronic
1146411406 17:32588858-32588880 ACTTGAACTCAGGAGGTGGAGGG + Intronic
1146463716 17:33068135-33068157 ACTGGACCTGGGGGGGTGGAAGG + Intronic
1146494562 17:33309942-33309964 GCTTGACTCCATGGGGTGGAGGG - Intronic
1146767401 17:35535736-35535758 ACTTGAACCCAGGAGGTGGAGGG - Intronic
1146899125 17:36570293-36570315 ACTTGAGCCCAGGAGGTTGAAGG + Intronic
1147110731 17:38259112-38259134 ACTTGAGCCCAGGAGGTGGATGG + Intergenic
1147127852 17:38384673-38384695 ACTTGAACCCGGGATGTGGATGG - Intronic
1147289600 17:39430934-39430956 ACTTGAGCCCAGGAGGTGGAAGG + Intronic
1147368551 17:39975364-39975386 GCTTGAACCCAGGAGGGGGAGGG + Intronic
1147377064 17:40028787-40028809 CCCTGACCCCAGGGCGTGCAGGG - Intronic
1147706107 17:42425852-42425874 GCTTGAACCCAGGAAGTGGAGGG - Intergenic
1147706259 17:42427043-42427065 GCTTGAACCCAGGAGGCGGAAGG - Intergenic
1147724009 17:42555231-42555253 CCTTGAGCCCAGGAGTTGGAGGG + Intergenic
1147899054 17:43771925-43771947 ACTTGAACCTGGGAGGTGGAGGG + Intronic
1147947763 17:44089846-44089868 GCTTGAACCCAGGAGGTGGAGGG + Intronic
1147985547 17:44305471-44305493 ACTTGAGCCTAGGAGGTTGAAGG + Intergenic
1148023808 17:44571206-44571228 ACTTGAGCCCAGGGAGATGAAGG + Intergenic
1148027092 17:44595864-44595886 GCTTGAACCCAGGAGGCGGAGGG - Intergenic
1148124776 17:45231053-45231075 ACCTGACCCCATGGGAGGGAGGG + Intronic
1148182334 17:45615227-45615249 GCTTGAGCCCAGGAGGTTGAGGG - Intergenic
1148266523 17:46230485-46230507 GCTTGAGCCCAGGAGGTTGAGGG + Intergenic
1148369654 17:47088165-47088187 GCTTGAACCCAGGAGGTGGAGGG + Intergenic
1148410679 17:47464089-47464111 ACTTGAATCCAGGAGGTAGAGGG + Intergenic
1148418781 17:47529318-47529340 ACTTGAGCCCAGGAGGTGGATGG - Intronic
1148451601 17:47781561-47781583 ACCTCACCCTAGGGGTTGGAAGG - Intergenic
1148475437 17:47925563-47925585 ATTTGACCTCTGTGGGTGGAGGG - Intronic
1148488173 17:48004746-48004768 ACTTGAGCCCAGCAGGTCGAGGG + Intergenic
1148561386 17:48608754-48608776 CCTTGACCCCAGAGAGTGAAAGG - Intronic
1148610873 17:48963749-48963771 GCTTGAATCCAGGAGGTGGAGGG + Intronic
1148666404 17:49378152-49378174 ACTTGAGCCCAGGAGGTCAAGGG - Intronic
1148898999 17:50860812-50860834 ACTTGAACCTGGGAGGTGGAAGG + Intergenic
1149326038 17:55530698-55530720 ACTTGAACCCAGGAGGCAGAGGG + Intergenic
1149473593 17:56940181-56940203 GCTTGAGCCCAGGAGGTGGAAGG - Intronic
1149561951 17:57614131-57614153 GCTTGAACCCGGGAGGTGGAGGG - Intronic
1149588345 17:57808783-57808805 TCTTGAGCCCAGGAGGTTGAGGG + Intergenic
1149668769 17:58386341-58386363 GCTTGACCCCAAGAAGTGGAGGG + Intronic
1149703783 17:58677034-58677056 GCTTGAACTCAGGAGGTGGAGGG + Intronic
1149716793 17:58798774-58798796 ACTTGAACCCAGGAGGCAGAGGG - Intronic
1149744148 17:59078040-59078062 GCTTGAACCCAGGAGGCGGAGGG + Intronic
1149815967 17:59724127-59724149 ACTTGAACCCAGGAGGTCGAGGG + Intronic
1149924437 17:60688731-60688753 ACTTGAACCCGGGAGGTGGAGGG + Intronic
1150021062 17:61613633-61613655 GCTTGAACCCAGGAGGTCGAGGG + Intergenic
1150037722 17:61821806-61821828 ACTTGAGCCGAGGAGGTTGAGGG - Intronic
1150068462 17:62131743-62131765 ACTTGAACTCAGGGGGTTGGAGG + Intergenic
1150271062 17:63865401-63865423 ACTTGAGCACAGGAGATGGAGGG + Intergenic
1150274645 17:63888602-63888624 ACTTGAGCACGGGAGGTGGAGGG + Intergenic
1150280014 17:63924356-63924378 GCTTGAACCCAGGAGGTGGAGGG + Intergenic
1150379308 17:64708181-64708203 GCTTGAACCCAGGAGGTGAAGGG - Intergenic
1150495191 17:65602658-65602680 ACTTGAACCCAGGAGGTGGAGGG - Intronic
1150532943 17:66004406-66004428 ACTTGAACCCAAGAGGCGGAGGG + Intronic
1150571407 17:66390137-66390159 GCTTGAACCCAGTAGGTGGAGGG + Intronic
1150681198 17:67285877-67285899 ACTTGAACCCGGGAGGTGGAGGG + Intergenic
1151237072 17:72728357-72728379 GCTTGAGCCCAGGGGGTCGAGGG + Intronic
1151272545 17:73008018-73008040 ACTTGAACCTAGGAGGTAGAAGG + Intronic
1151283725 17:73095015-73095037 ACTTGAACCTGGGAGGTGGAGGG - Intergenic
1151636135 17:75349600-75349622 ACTTGAACCCAGGAGGCAGAGGG - Intronic
1151750016 17:76031702-76031724 GCATGAACCCAGGAGGTGGAGGG + Intergenic
1151848713 17:76676678-76676700 ACTTGAACCCAGAAGGTGAAGGG + Exonic
1151874393 17:76858566-76858588 GCTTGAACCCAGGAGGTGGAGGG - Intergenic
1151911650 17:77087500-77087522 GCTTGAACCCAGGAGGCGGAGGG - Intronic
1151917905 17:77132303-77132325 GCTTGAACCCAGGAGTTGGAGGG - Intronic
1151918358 17:77135617-77135639 ACTTGAACCCAGGAGGTTGAGGG - Intronic
1152071397 17:78135499-78135521 GCTTGAGCCCAGGAGGTCGAGGG - Intronic
1152181924 17:78827683-78827705 ACTTGAGCCCAGGAGTTCGAGGG + Intronic
1152457875 17:80426429-80426451 ACTTGAGCCCAGGAGTTTGAGGG + Intronic
1152489927 17:80623989-80624011 ACTTGAGCCCAGGAGTTTGAGGG - Intronic
1152707929 17:81854757-81854779 ACTTGAACCCAGGAGGCGGAGGG + Intronic
1152860652 17:82695272-82695294 GCTGGAACCCAGGAGGTGGAGGG - Intronic
1153064207 18:1026531-1026553 ACTTGAACCTGGGAGGTGGAGGG + Intergenic
1153211594 18:2772711-2772733 ACTTGAGCCCAGCAGGTGGAGGG - Intronic
1153612126 18:6896993-6897015 ACTTGAACCCAGGAGGCGGAGGG - Intronic
1153776814 18:8461777-8461799 ACTTGATTCCAGACGGTGGAGGG - Intergenic
1153839007 18:8989738-8989760 ACTTGAACCTAGGAGGTGGAGGG - Intergenic
1153840432 18:9002628-9002650 ACTTGAGCCCAGGAGGTTGAGGG + Intergenic
1153842461 18:9019119-9019141 ACTTGAAGGCAGAGGGTGGAAGG - Intergenic
1154158892 18:11965513-11965535 ACCTGAACCCAGGAGGCGGAGGG - Intergenic
1154413616 18:14159069-14159091 GCTTGAACCCAGGAGGTGGAGGG + Intergenic
1154474646 18:14744557-14744579 ACTTGAACACAGGAGGTGGAGGG + Intronic
1155094635 18:22543975-22543997 CCTTGACCCCAGGGGATGTGAGG - Intergenic
1155183761 18:23370094-23370116 GCTTGAACCCGGGGGGTGGAGGG + Intronic
1155699355 18:28724158-28724180 ACTTGAGCCCTGGAGGTCGAGGG - Intergenic
1156093016 18:33494275-33494297 ACTTGAACCCAGGAGGCAGAGGG - Intergenic
1156179031 18:34581701-34581723 GCTTGAAGCCAGGAGGTGGAGGG - Intronic
1156216251 18:35001007-35001029 ACTGGATCCCAGGAGGTTGAGGG + Intronic
1156262030 18:35453418-35453440 ACTTGAGCCCAGGAGGTCGAGGG + Intronic
1156534398 18:37848834-37848856 TCTTGAACCCGGGAGGTGGAGGG - Intergenic
1156726685 18:40136934-40136956 ACTTGAACCTGGGAGGTGGAGGG + Intergenic
1157062983 18:44314947-44314969 GCTTGAACCCGGGAGGTGGAGGG - Intergenic
1157135824 18:45054268-45054290 ACTTGAACCCTGGAGGCGGAGGG - Intronic
1157249607 18:46082965-46082987 GCTTGAACCCAGGAGGTGAAAGG + Exonic
1157250684 18:46093454-46093476 ACTCAAACCCAGGAGGTGGAGGG + Intronic
1157321367 18:46637061-46637083 ACTTGAACCCGGGAGGTGGAGGG + Intronic
1157345863 18:46832330-46832352 GCTTGAACCCAGGAGGTGGAAGG + Intronic
1157353122 18:46908924-46908946 TCTTGAACCTTGGGGGTGGAGGG + Intronic
1157375147 18:47156878-47156900 GCTTGAACCCGGGAGGTGGAGGG - Intronic
1157475073 18:48018790-48018812 GCTTGAGCCCAGGAGGTGGAAGG - Intergenic
1157611282 18:48957635-48957657 ACTTGAACCCAGGAGGCCGAGGG + Intergenic
1157753645 18:50199181-50199203 TCTTGAACCCAGGGGGCGGAGGG + Intergenic
1157894489 18:51452121-51452143 ACCTGAGACCTGGGGGTGGAGGG + Intergenic
1158457702 18:57622342-57622364 GCTTGAACCCGGGAGGTGGAGGG - Intergenic
1158483243 18:57841279-57841301 CCTTGAGCCCAGGAGGTAGAGGG + Intergenic
1158529448 18:58245761-58245783 ACTTGAACCCAGGAGGCGGAGGG - Intronic
1158590526 18:58775012-58775034 ACTTGAACCCGGGAGGTGGAGGG + Intergenic
1158615204 18:58980723-58980745 GGTTGAACCCAGGAGGTGGAGGG - Intronic
1158632764 18:59130804-59130826 ACTGCATCCCTGGGGGTGGAGGG - Intergenic
1158772575 18:60538004-60538026 ACTTGAGTCCAGGAGATGGAGGG + Intergenic
1158935310 18:62359460-62359482 GCTTGAGCCCAGGAGGTTGAAGG - Intronic
1159167445 18:64721457-64721479 GCTTGAACCCGGGAGGTGGAGGG - Intergenic
1159249070 18:65850079-65850101 TCTTGAACCCAGGAGGTGGAGGG + Intronic
1159363589 18:67436804-67436826 ACTTGAACCAGGGTGGTGGAAGG + Intergenic
1159924737 18:74257832-74257854 GCTTGACCCCGGGAGGTGGATGG + Intronic
1160496115 18:79376775-79376797 GCTTGAACCCGGGAGGTGGAGGG - Intronic
1160561431 18:79759926-79759948 ACTTGAACCCAGAAGGTGGAGGG - Intergenic
1160769561 19:824293-824315 ACTTGAACCCAGGAGGTGGGAGG - Intergenic
1160772217 19:837644-837666 ACTTGAACCCGGGAGGTGGAGGG - Intergenic
1161063025 19:2224547-2224569 ACTTGAACCCAGGAGGCGGAGGG - Intronic
1161081222 19:2311166-2311188 ACTTGAGCCCAGGGGGTTCAAGG - Intronic
1161194823 19:2980651-2980673 TCTTGAACCCAGGAGGCGGAGGG + Intronic
1161206595 19:3044500-3044522 ACTTGAACCCGGGAGGTGGAGGG - Intronic
1161289226 19:3483959-3483981 GCTTGAGCCCAGGAGGTTGAGGG - Intergenic
1161341387 19:3744843-3744865 GCTTGATCCCAGGAGGCGGAGGG + Intronic
1161631930 19:5361476-5361498 ACTTGAGCCCAGGAGTTGGAGGG + Intergenic
1161847837 19:6722169-6722191 GTTTGAACCCAGGAGGTGGAGGG - Intronic
1161857653 19:6774835-6774857 ACTTGAACCCAGGAAGTGGAGGG - Intronic
1161902963 19:7133177-7133199 ACTTGAGCCCAGGAGGTCAAGGG + Intronic
1162139255 19:8576077-8576099 ACTTGAACCCAGGAGGCGGAGGG - Intronic
1162256635 19:9495622-9495644 ACTTGAACCCAGGAGGCGGAGGG + Intronic
1162387792 19:10370429-10370451 GCTTGAACCCGGGAGGTGGAGGG + Intronic
1162406464 19:10477341-10477363 GCTTGAACCCATGAGGTGGAGGG + Intergenic
1162434174 19:10646971-10646993 ACTTTAGCTCAGGGGGTGGAGGG + Intergenic
1162669223 19:12240360-12240382 ACTTGAACCCAGGAGATGGAGGG + Intronic
1162719284 19:12652612-12652634 ACTTGAACCCGGGAGGTGGGGGG - Intronic
1162723957 19:12678684-12678706 ACTTGAACCTGGGAGGTGGAGGG + Intronic
1162939302 19:13998399-13998421 ACTTGAACCCAGGAGGCAGAGGG + Intronic
1162986124 19:14271306-14271328 GCTGGAACCCAGGAGGTGGATGG - Intergenic
1163002576 19:14377234-14377256 ACTTGAACCCAGGAGGTGGAGGG + Intergenic
1163051520 19:14688334-14688356 GCTTGAACCCAGGAGGTGGAGGG - Intronic
1163096133 19:15058524-15058546 GCTTGAGCCCAGGAGGTCGAGGG - Intergenic
1163101882 19:15102420-15102442 ACTTGAGCCTAGGAGGTTGAGGG + Intergenic
1163321819 19:16579016-16579038 ACTTGAACCCGGGAGGCGGAGGG + Intronic
1163379120 19:16952592-16952614 ACTTGAGCCCAGGTGGTCGAGGG + Intronic
1163492860 19:17627081-17627103 ACTTGAACCCAGGAAGTGGAGGG + Intronic
1163544216 19:17931576-17931598 ACTTGAGCCCAGAAGTTGGAGGG - Intergenic
1163734101 19:18968227-18968249 ACTTGAACTCAGGAGGTGGAGGG - Intergenic
1163753674 19:19093758-19093780 ACTTGAACCCAGGAGGTGGAGGG - Intronic
1163903180 19:20125955-20125977 GCTTGAACCCAGGAGGTGGAGGG - Intronic
1163996653 19:21055529-21055551 ACTTGAACCCAGGTGGCGGAGGG - Intronic
1164030134 19:21396448-21396470 GCTTGAACCCGGGAGGTGGAGGG - Intergenic
1164615147 19:29663265-29663287 GCTTGTCACCAGCGGGTGGAGGG - Intergenic
1164662223 19:29985035-29985057 GCTTGAACCCGGGAGGTGGAGGG + Intronic
1165042210 19:33076834-33076856 ACTTGAACCCAGGAGGCAGAAGG - Intergenic
1165126998 19:33605202-33605224 ACTTGAGCCCAGGAGTTAGAGGG + Intergenic
1165312415 19:35036835-35036857 GCTTGAACCCGGGAGGTGGATGG - Intronic
1165371167 19:35407137-35407159 ACTTGAGCCCAGGGGCTTCAAGG - Intergenic
1165374344 19:35431276-35431298 ACGTGACAGCTGGGGGTGGAGGG - Intergenic
1165497822 19:36164171-36164193 TCTTGAACCCAGAAGGTGGAGGG - Intergenic
1165709043 19:37996776-37996798 GCTTGAACCCAGAAGGTGGAGGG - Intronic
1165715827 19:38045292-38045314 ACTTGAACCCGGGAGGCGGAAGG + Intronic
1165740977 19:38205150-38205172 ACTTGTCTCCATGGGGCGGAAGG + Intronic
1165864042 19:38925228-38925250 ACTTGAACCCAGGGGGCAGAGGG + Intronic
1165901152 19:39169922-39169944 ACTTGGAGCCAGTGGGTGGAGGG - Intronic
1165954439 19:39493330-39493352 ACTTGAACCCAGGAGGTGCAGGG - Intronic
1165958783 19:39517879-39517901 GCTAGAACCCAGGAGGTGGAAGG + Intronic
1166021679 19:40036989-40037011 ACTTGAACCCAGGAGGTAGAGGG - Intronic
1166039898 19:40195574-40195596 ACTTGAACCCGGGAGGCGGAAGG - Intronic
1166096058 19:40540007-40540029 ACTTGAACCCAGGAGGCAGAGGG - Intronic
1166225879 19:41394949-41394971 GCTTGAACCCGGGAGGTGGAGGG + Intronic
1166287771 19:41842676-41842698 GCTTGAACCCAGGAGGTGGAGGG + Intronic
1166414821 19:42587918-42587940 GCTTGAACCCAGGAGGCGGAGGG + Intronic
1166519677 19:43471975-43471997 GCTTGAACCCAGGAGGCGGAGGG + Intergenic
1166845569 19:45725952-45725974 ACTTGGGCCCAGGAGGTGGAAGG - Intronic
1166874999 19:45891517-45891539 GCTTGAACCCAGGAGGTGGAAGG - Intronic
1166945740 19:46395105-46395127 GCTTGAACCCAGGAGGGGGAGGG - Intergenic
1166980798 19:46630991-46631013 ACTTCACCCCTGGGGGTGGCAGG + Intergenic
1166989901 19:46685864-46685886 ACCTGAACCCAGGGGGCAGAGGG + Intronic
1167043084 19:47034229-47034251 ACTTGAACCCAGGAAGTGGAGGG + Intronic
1167056782 19:47116100-47116122 ACTGGAGCCCAGGAGGTTGAAGG + Intronic
1167122271 19:47524792-47524814 ACTTGAGCCCAGGAGGTCAAAGG + Intronic
1167140906 19:47650213-47650235 ACTTGACCCTGGGTGGTGGAGGG - Intronic
1167156899 19:47744098-47744120 GCTTGAGCCCAGGAGTTGGAGGG - Intergenic
1167177457 19:47875077-47875099 GCTTGAACCCAGGAGGTGGAGGG + Intronic
1167340689 19:48914056-48914078 ACTTGAACCCGGGAGGCGGAGGG - Intronic
1167417580 19:49384620-49384642 GCTTGAACCCAGGAGGTGGAGGG - Intergenic
1167703853 19:51066576-51066598 AGTTAATCCTAGGGGGTGGAGGG + Intergenic
1167749815 19:51372782-51372804 ACTGGACCCCAGGGAGGGGAGGG - Intergenic
1167761566 19:51453169-51453191 CCTTGAGCCCAGGAAGTGGAGGG - Intronic
1167876432 19:52417697-52417719 GCTTGAGCCCAGGAGGCGGAGGG - Exonic
1167880319 19:52452416-52452438 GCTTGAACCCAGGAGTTGGAAGG - Intergenic
1167886867 19:52507303-52507325 ACTTGAACCTGGGAGGTGGATGG + Intronic
1167892433 19:52551267-52551289 ACTTGAACCTGGGAGGTGGATGG + Intronic
1167911697 19:52708752-52708774 ATTTGAACTCAGGAGGTGGAGGG + Intronic
1167926681 19:52826791-52826813 GCTTGAACCCAGGAGGTGGAGGG + Intronic
1167953044 19:53043248-53043270 GCTTGAGCCCAGGAGGTGGAGGG - Intergenic
1168038965 19:53742838-53742860 ACTTGAACCCAGGAGGTGGAGGG - Intergenic
1168157630 19:54485052-54485074 GCTTGAACCCGGGAGGTGGAGGG + Intergenic
1168242636 19:55095188-55095210 ACCAGACCCCAGGGGGTACATGG + Intronic
1168259071 19:55182875-55182897 ACTTGAGCCCAGGAGGTCAAGGG - Intronic
1168376372 19:55883291-55883313 GCTTGAACCCGGGAGGTGGAGGG - Intergenic
924969468 2:112165-112187 ACTTGAACCCAGGAGGCGGAGGG - Intergenic
925918720 2:8625033-8625055 ACTTCTCCCCAGAGGCTGGAGGG + Intergenic
926267454 2:11337714-11337736 ACCTGAACCCAGGAGGTGGGAGG - Intronic
926713966 2:15909114-15909136 GCTTGAACCCAGGAGGCGGAGGG + Intergenic
927166979 2:20333449-20333471 GCTTGAGCCCAGGAGGTTGAGGG + Intronic
927228812 2:20799142-20799164 TCTTGAACCCAGGAGGTGGAGGG + Intronic
927256173 2:21043106-21043128 ACCTGACCCCTGGGGGTTAAAGG - Intronic
927609497 2:24523841-24523863 GCTTGAACCCAGGAGGTGGAGGG + Intronic
927635038 2:24808289-24808311 TCTTGAACCCAGGAGGTGGAGGG - Intronic
927722676 2:25396426-25396448 CCTTGAACCCAGGAGGCGGAGGG + Intronic
927764729 2:25795872-25795894 AGTGGACCCCAGGGAATGGAGGG + Intronic
927781802 2:25945482-25945504 GCTTGAACCCAGGAGGCGGAGGG + Intronic
927850483 2:26495506-26495528 ACTTGAACCCAGGAGGCAGAGGG - Intronic
927933496 2:27061144-27061166 GCTTGAACCCAGGGGGTGGAAGG - Intronic
927956990 2:27214026-27214048 GCTTGAACCCAGGAGGTGGAGGG - Intronic
928484588 2:31717438-31717460 GCTTGACCCCAAGGGGGTGAAGG + Intergenic
928508079 2:31974660-31974682 ACTTGAACCCAGGGGGGCCAGGG + Intronic
928509828 2:31992699-31992721 ACTCGAACCCAGGAGATGGAGGG + Intronic
928517268 2:32055278-32055300 ACTTGAGCCCTGGAGGTTGAGGG + Intergenic
928520796 2:32086381-32086403 ACTTGAGCCCAGGAGTTGGAGGG + Intronic
928521244 2:32091361-32091383 GTTTGAACCCAGGAGGTGGAGGG - Intronic
928554083 2:32404742-32404764 ACTTGAGCCCAGGAGGTAAAGGG - Intronic
928565455 2:32542880-32542902 ACTTGAACCCAGGAGGTGGAAGG - Intronic
928986290 2:37185633-37185655 GCTTGAACCCAGGAGGTGAAGGG + Intronic
929153956 2:38772992-38773014 ACTTGAACCCAGGAGGGGTAGGG - Intronic
929193424 2:39161813-39161835 ATTTGAGCCCAGGAGGCGGAGGG - Intergenic
929194804 2:39173898-39173920 GCTTGAGCCCAGGAGGTCGAGGG + Intergenic
929203207 2:39260194-39260216 ACTTGAGCCCAGGAGGTCGAGGG - Intronic
929210846 2:39355276-39355298 ACTTGAACCCGGGAGGTGGAAGG + Intronic
929516491 2:42607460-42607482 GCTTGAGCCCAGGAGGTGGAAGG - Intronic
929648114 2:43650213-43650235 ACTTGAACCCAGGGGGCAGAAGG - Intronic
929703464 2:44186449-44186471 GCTTGAGCCCAGGAGGTGGAGGG - Intronic
929751178 2:44715108-44715130 ACTTGAACCCAGGAGGTAGAGGG + Intronic
929952460 2:46424953-46424975 GCTTGAACCCAGGAGGTGGAGGG + Intergenic
930042626 2:47139856-47139878 GCTTGAACCCAGGAGGCGGAGGG - Intronic
930083322 2:47472772-47472794 ACTTGAACCCAGGAGGTCGAGGG + Intronic
930120650 2:47757941-47757963 ACTTGAACCCAGGAGGCAGAGGG - Intronic
930188984 2:48438958-48438980 GCTTGAACCCAGGAGGTGGATGG - Intergenic
930523298 2:52495261-52495283 ACTTGAACCCAGGAGTTAGAGGG + Intergenic
930646588 2:53915355-53915377 ACTTGAGCCCAGGAGATGAAGGG + Intronic
930661186 2:54055117-54055139 GCTTGAACCCGGGAGGTGGAGGG - Intronic
930782931 2:55241333-55241355 TCTTGAACCCAGGAGGTGGTGGG + Intronic
930787610 2:55285886-55285908 ACTTGAACCCAGGAGGCAGAGGG + Intergenic
930807636 2:55507313-55507335 ACTTGAACCCAGGTGGTGGAGGG - Intergenic
931039260 2:58278827-58278849 GCTTGAACCCATGAGGTGGATGG - Intergenic
931318852 2:61157121-61157143 GCTTGAACCCAGGAGGCGGAGGG - Intronic
931328607 2:61255049-61255071 ACTTGAGCCCAGGAGTTTGAGGG - Intronic
931340246 2:61394036-61394058 GCTTGAACCCAGGAGGCGGAGGG + Intronic
931354014 2:61518045-61518067 ACTTGAGCCCAGGAGGCAGAGGG + Intronic
931365367 2:61614506-61614528 GCTTGAACCCAGGAGGTGAAGGG - Intergenic
931373983 2:61691568-61691590 ACTTGAACCCGGGAGGTGGAGGG - Intergenic
931471543 2:62543042-62543064 GCTTGAACCCAGGAGGTGGAAGG + Intergenic
931526358 2:63159306-63159328 ACTTGAGCCCAGGAGTTGGAGGG - Intronic
932037718 2:68264131-68264153 ACTTGAACCCGGGAGGTGGAGGG - Intergenic
932166814 2:69515406-69515428 ACTTGAGCCCAGGAGGTCAAGGG - Intronic
932224479 2:70028857-70028879 ATTTGAACCCAGGAGGCGGAGGG + Intergenic
932246168 2:70198320-70198342 GCTTGAACCCAGGAGGCGGACGG + Intronic
932513578 2:72321450-72321472 GCTTGAACCCAGGAGGTGGAGGG + Intronic
932535204 2:72585512-72585534 ACTTGAACCCAGGAGGCAGAGGG + Intronic
932581459 2:72995009-72995031 AGGTGACCCCAGGGTGTGGTGGG - Intronic
932765741 2:74468500-74468522 GCTTGAGCCCAGGAGATGGAGGG + Intergenic
932980636 2:76661865-76661887 GCTTGAGCCCAGGAGGTCGAAGG - Intergenic
933101859 2:78270317-78270339 ACTTGAACCTGGGAGGTGGAGGG - Intergenic
933380464 2:81536834-81536856 ACTTGAACCCAGGAGGCGGAGGG - Intergenic
933495946 2:83050633-83050655 TCTTGAACCCAGGAGGTGGAGGG + Intergenic
933669527 2:84993656-84993678 GCTTGAACCCAGGAGGTGGAGGG - Intronic
933682905 2:85118748-85118770 GCTTGAGCCCAGGAGGTTGAGGG - Intergenic
934030351 2:88039603-88039625 TCTTGAACCCAGGAGGTGGAAGG + Intronic
934088672 2:88531856-88531878 ACTTGAACCCAGGAGGCAGAGGG - Intergenic
934186358 2:89680645-89680667 ACTTGAACCTGGGAGGTGGAGGG - Intergenic
934669159 2:96197320-96197342 ACTTGAACCCAGGAGGCTGAGGG + Intronic
934927975 2:98395250-98395272 ACTTGAACCCAGGAGGTGGAGGG - Intronic
935240406 2:101173051-101173073 ACTTGAACCCGAGAGGTGGAGGG + Intronic
935317402 2:101849203-101849225 ACTTGAGCCCAGGTGGCAGAGGG - Intronic
935364674 2:102276739-102276761 GCTTGAGCCCAGGAGGTTGAAGG + Intergenic
935650438 2:105377544-105377566 TCTTGAACCCGGGAGGTGGAGGG + Intronic
935694185 2:105756886-105756908 ACTTGAACCCAGGAGGGGGGAGG - Intronic
935820956 2:106892431-106892453 ACTTGAACCCAGGAGGTGGGAGG - Intergenic
935964602 2:108461586-108461608 ACTTGAACCCGGGAGGTGGAGGG - Intronic
936280792 2:111138089-111138111 ACTTGAACCTGGGAGGTGGAGGG - Intronic
936594391 2:113833958-113833980 ACTTGAACCCAGGAGGCGGAGGG + Intergenic
937610381 2:123854337-123854359 GCTTGAACCTAGGAGGTGGAGGG + Intergenic
937776943 2:125789024-125789046 ACTTGAGCCCAGGAGTTGCAGGG + Intergenic
937943838 2:127312877-127312899 ACTTGAACCCAGGGTGGGGGCGG + Intronic
937944835 2:127323271-127323293 GCTTGAACCCAGGAGGTGGAGGG + Intronic
938008861 2:127812172-127812194 ACTTGAGCCCAGGAGTTGGAGGG + Intergenic
938021600 2:127910246-127910268 ACTTGAGCCCAGGAAGTTGAGGG - Intergenic
938033836 2:128019013-128019035 ACTTGAACCCAGGAGATGGGAGG + Intronic
938050495 2:128165842-128165864 ACTTGAGCCCAGAAGGCGGAAGG - Intronic
938269783 2:129959423-129959445 GCTTGAACCCTGGAGGTGGAGGG - Intergenic
938419686 2:131135152-131135174 GCTTGAACCCAGGAGGCGGAGGG - Intronic
938907581 2:135853359-135853381 ACTTGAGCCCAGGAGGTTGAAGG + Intronic
939034400 2:137113517-137113539 ACTTGAACCCAGGAGGCGGAGGG - Intronic
939872491 2:147540822-147540844 GCTGGAACCCAGGAGGTGGAGGG + Intergenic
940303860 2:152204403-152204425 GCTTGAGCCCAGGAGGTGGAGGG + Intergenic
940704086 2:157082007-157082029 ACTTGAACCCAGGAGGTGGAAGG + Intergenic
940804044 2:158165839-158165861 ACTTGAACCCAGGAGGCAGAGGG - Intergenic
940901793 2:159132569-159132591 ACTTGAACCCAGGAGATGGAGGG - Intronic
941017790 2:160376716-160376738 ACTTGAGCCCAGGAGTTTGAGGG - Intronic
941042758 2:160641819-160641841 GCTTGAACCCAGGAGGTGGAGGG - Intergenic
941103114 2:161320806-161320828 ACTTGAACCCAGGAGGCAGAGGG - Intronic
941571006 2:167170980-167171002 ACTTGAACCCTGGAGGCGGAGGG - Intronic
941574256 2:167211178-167211200 ACTTGAACCCAGGAGGTGGAGGG - Intronic
941658943 2:168174777-168174799 ACTTGAGCCCAGGAGTTCGAGGG + Intronic
941661316 2:168197953-168197975 ACTTGAACCCAGGAGGTAGAGGG + Intronic
941888705 2:170555787-170555809 ACTTGAGCCCAGGAGGTCGAGGG + Intronic
941943824 2:171072683-171072705 ACTTGAGCTCAGGAGGCGGAGGG + Intronic
941947409 2:171114750-171114772 ACCTGACCCCAGGAGGCAGAAGG + Intronic
942164923 2:173232584-173232606 ACTTGAACCCAGGAGGCGGAGGG - Intronic
942199736 2:173559138-173559160 AATTTACCACAGGGGGAGGATGG - Intergenic
942239432 2:173946042-173946064 ACTTGAACCCAGGAGGTGGAGGG + Intronic
942280331 2:174356383-174356405 ACTTGAACACAGGAGGTTGAGGG + Intronic
942495786 2:176538711-176538733 ACTTGAACCTGGGAGGTGGAGGG + Intergenic
942655523 2:178210727-178210749 ACTTGAACCCAGGAGGCAGAGGG + Intronic
943161173 2:184253233-184253255 ACTTGAACCCAGGAGGCAGAGGG - Intergenic
943224894 2:185159706-185159728 CCTTGAACCCAGGAGGTGGAGGG + Intergenic
943258965 2:185632911-185632933 GCTTGAACCCGGGAGGTGGAGGG + Intergenic
943328626 2:186532270-186532292 ACCTGAGCCCAGGAGGTTGAGGG - Intergenic
943576033 2:189632310-189632332 ACTTGGGCCTAGGAGGTGGAGGG - Intergenic
943686554 2:190824529-190824551 ACTTGAACCCATGAGGTGGAGGG - Intergenic
943846234 2:192652590-192652612 ACTTGAGTCCAGGAGGTTGAGGG + Intergenic
944121198 2:196242773-196242795 ACTTGAACCCAGGAGGCGGAGGG - Intronic
944173777 2:196806771-196806793 CTTTGAACCCAGGAGGTGGAGGG + Intronic
944322661 2:198366340-198366362 ACTTGAACACAGGGGTTTGAGGG - Intronic
944402681 2:199346230-199346252 ACTTGAACCCAGGAGGTGGAGGG - Intronic
944539924 2:200745238-200745260 CTTTGAACCCAGGAGGTGGAGGG - Intergenic
944566962 2:201001053-201001075 ACTTGAACCCAGGAGGCAGAGGG + Intronic
944703174 2:202263783-202263805 GCTTGAACCCAGGAGGCGGAGGG - Intergenic
944806626 2:203288146-203288168 GTTTGAACCCAGGAGGTGGAGGG - Intronic
945066922 2:205955335-205955357 ACTTGAGCCCAGGGGGTTGAGGG + Intergenic
945293039 2:208144484-208144506 ACTTGAGCCCAGAAGGTTGAGGG - Intronic
945296386 2:208175201-208175223 ACTTGAACCCCGGGGGGGGGGGG + Intronic
945676049 2:212856857-212856879 ACTTGAAGCCAGGAGGTGGAGGG - Intergenic
945692402 2:213054159-213054181 GCTTGAACCCAGGAGGTGGAGGG + Intronic
945848830 2:214981000-214981022 TCTTGAACCCGGGAGGTGGAGGG + Intronic
945965849 2:216185756-216185778 ACTTGAACCCAGGAGGTGGAGGG - Intronic
945981709 2:216317495-216317517 ACTTGAACCCAGGAGGTGGAAGG - Intronic
945988933 2:216377353-216377375 ACTTGAATCCAGGAGGTGGAGGG + Intergenic
946116861 2:217470567-217470589 ACTTTAACCCAGGAGGTGAAGGG - Intronic
946271643 2:218599225-218599247 GCTTGAGCCCAGGAGTTGGAGGG + Intergenic
946671977 2:222114855-222114877 ACTTGAACTCGGGAGGTGGAGGG - Intergenic
946982431 2:225231966-225231988 GCTTGAACCCGGGAGGTGGAGGG + Intergenic
947429471 2:230013497-230013519 ACTTGAACCCAGGAGGTGGAGGG - Intergenic
947582640 2:231331057-231331079 ACTTGAGCCCAGGAGGTCAAGGG + Intronic
947611745 2:231528958-231528980 ACCTGTACCCAGGGGGTGCAAGG - Exonic
947652790 2:231801522-231801544 GCTTGAGCCCAGGAGGTTGAGGG - Intronic
947654342 2:231813487-231813509 ACTTGAGCCCAGGAGGTTGAGGG - Intergenic
947695562 2:232184565-232184587 ACTTGAGCCCAGGAGGTTGAGGG + Intronic
947709340 2:232302641-232302663 ACTTGAACCCAGGAGGCGGAGGG - Intronic
948018158 2:234706996-234707018 GCTTGAGCCCAGGAGGTTGAAGG + Intergenic
948031357 2:234820130-234820152 ACTTGAACCCAGGAGGTAGAGGG + Intergenic
948217471 2:236242535-236242557 ACTTGAACCCAGGAGGTGGAGGG - Intronic
948417618 2:237825303-237825325 ACTTGAACCCGGGAGGTGAAGGG - Intronic
948593535 2:239065722-239065744 ACTTGACCACAGGAAGCGGAGGG - Intronic
948959209 2:241318781-241318803 ACTTGAACCCGGGAGGTGGAGGG - Intronic
948974006 2:241451835-241451857 GCTTGAACCCGGGAGGTGGAGGG - Intronic
949012433 2:241688704-241688726 GCTTGAACCCGGGAGGTGGAGGG - Intergenic
949079015 2:242081916-242081938 GCTTGAGCCCATGAGGTGGAGGG - Intergenic
1168788514 20:559973-559995 TCTTGAACCCGGGAGGTGGAGGG + Intergenic
1168819955 20:766017-766039 ACTTGAGCCCAGGAGGCAGAGGG - Intronic
1169212298 20:3773475-3773497 ACTTGAACCCAGGAGGTGGAGGG + Intergenic
1169233878 20:3912865-3912887 ACTTGAACCCTGGAGGTGGAGGG + Intronic
1169432559 20:5551657-5551679 ACTTGAACCCAGGAGCTGGAGGG + Intronic
1169496979 20:6124368-6124390 ACTTGAACCCGGGAGGCGGAGGG - Intergenic
1169531294 20:6487928-6487950 ACTTGAACCCAGGAGGTGGAGGG + Intergenic
1169614165 20:7420650-7420672 ACTTGAGCCCAGGAGTTTGAGGG - Intergenic
1169829697 20:9810460-9810482 CCTTGAGCCCAGGAAGTGGAAGG + Intronic
1170019601 20:11821636-11821658 ACTTGAGCCCAGGAGTTTGAAGG + Intergenic
1170175786 20:13467931-13467953 GCTTGAACCCAGGAGGCGGAGGG + Intronic
1170191360 20:13648227-13648249 ACTCGAACCCAGGAGGCGGAGGG + Intergenic
1170209472 20:13834376-13834398 ACTTGAGCCCAGGAGCTTGAGGG - Intergenic
1170217167 20:13903726-13903748 ACTTGAACCCGGGGGGGAGACGG + Intronic
1170835911 20:19884340-19884362 ACTTGAGCCCAGGAGGTTGAGGG + Intergenic
1171016631 20:21547975-21547997 GCTTGAACCCGGGAGGTGGAGGG + Intergenic
1171219129 20:23378239-23378261 ACCTGAACCCAGGAGGTTGAGGG + Intronic
1171967629 20:31542414-31542436 CCTTCTCCCCTGGGGGTGGAAGG - Intronic
1171980231 20:31622746-31622768 ACTTGAACCCAGGAGGCAGAGGG + Intergenic
1172077324 20:32309097-32309119 GCTTGAGCCCAGGAGGTTGAGGG - Intronic
1172148129 20:32771549-32771571 ACTTGAACCCAGGAGGTGGAGGG + Intronic
1172210068 20:33191188-33191210 ACATGACTCCAGGCTGTGGAGGG + Intergenic
1172253828 20:33498958-33498980 GCTTGAACCCAGGGGGCGGAAGG + Intronic
1172394223 20:34588167-34588189 ACTTGAAACCAGGAGGTGGAGGG + Intronic
1172653229 20:36520426-36520448 ACTTGAACCTGGGAGGTGGAGGG - Intronic
1172706843 20:36888312-36888334 ACTTGAACCCAGGAGTCGGAGGG - Intronic
1172712267 20:36934739-36934761 ACTTGAACCCAGGAGGTTGGTGG - Intronic
1172803428 20:37594435-37594457 ACTTGAACCCGGGAGGTGGAGGG - Intergenic
1173494840 20:43511133-43511155 GCTTGAACCCGGGAGGTGGAGGG - Intronic
1173498002 20:43532942-43532964 ACTTGGCCTCAGGGGGTGAGGGG + Intronic
1173501188 20:43554995-43555017 ACTTGAACCCGGGAGGGGGAGGG + Intronic
1173530976 20:43769329-43769351 ACTTGAGCCCAGGAGGTTGAAGG + Intergenic
1173605667 20:44329565-44329587 GCTTGAGCCCAGGAGGTTGAGGG - Intergenic
1173791248 20:45829061-45829083 ACTTGAACCTAGGAGGCGGAGGG - Intronic
1173887583 20:46474288-46474310 ACTTGAACCCGGGAGGTGGGAGG + Intergenic
1173974519 20:47177193-47177215 ACTTGAGCCTAGGAGGTCGAGGG - Intronic
1174018491 20:47509309-47509331 ACTTGAGCCCAGGAGGTTGAGGG + Intronic
1174024981 20:47566592-47566614 GCTTGAGCCCAGGAGGTTGAGGG - Intronic
1174249935 20:49211588-49211610 ACTTGAACCCAAGAGGTGGAGGG - Intergenic
1174294071 20:49531707-49531729 ACTTGAGCCCAGGAGGTTGAGGG - Intronic
1174350804 20:49966309-49966331 GCTTGAACCCAGGAGGTGGAGGG + Intergenic
1174351771 20:49973761-49973783 ACTTGAGCCCAGGAGGTCAAGGG - Intergenic
1174355188 20:49993070-49993092 ACTTGAACCCGGGAGGTGGAGGG - Intergenic
1175100028 20:56572637-56572659 ACTTGAACCTGGGAGGTGGAGGG + Intergenic
1175152134 20:56943263-56943285 GCTTGAACCCAGGAGGCGGAAGG + Intergenic
1175438552 20:58973295-58973317 AAGTGACCCCAGGGGCAGGAGGG - Intergenic
1176009480 20:62885119-62885141 CCTTCACCCCAGGGCGTGGTGGG - Intronic
1176628734 21:9117779-9117801 GCTTGAACCCAGGAGGTGGAGGG + Intergenic
1176859406 21:13999180-13999202 GCTTGAACCCAGGAGGTGGAGGG - Intergenic
1176997637 21:15575769-15575791 ACTTGAACCCAGGAAGTGGAGGG - Intergenic
1177161343 21:17551315-17551337 GCTTGAACCCGGGAGGTGGAGGG + Intronic
1177652430 21:23975009-23975031 ACTTGAACCAGGGAGGTGGAGGG + Intergenic
1177703021 21:24663058-24663080 GCTTGAACCCGGGAGGTGGAGGG + Intergenic
1177980724 21:27911564-27911586 ACTTGATCCTGGGAGGTGGAGGG + Intergenic
1178069819 21:28951885-28951907 ACTTGACCACAGGAGGTTGAGGG + Intronic
1178337389 21:31755684-31755706 TCTTGAACCCAGGAGGTGGGAGG - Intergenic
1178415811 21:32404149-32404171 ACTTGAACCCAGGAGGTGGAGGG + Intergenic
1178557455 21:33605602-33605624 GCTTGAACCCAGGAGGGGGAGGG - Intronic
1178618971 21:34158049-34158071 ACTTGAACTCAGGAGGTGGAAGG - Intergenic
1178696104 21:34793784-34793806 GCTTGAGCCCAGGAGGTGGTGGG - Intronic
1178794768 21:35733545-35733567 GCTTGAACCCTGGAGGTGGAGGG + Intronic
1178856075 21:36251500-36251522 ACTTGAACCCAGGAGGTGGAGGG - Intronic
1178856157 21:36252092-36252114 ACTTGAGCCTGGGAGGTGGAGGG + Intronic
1179443975 21:41418824-41418846 ACTTGAGCCCAGGAGTTCGAGGG - Intergenic
1179782682 21:43712374-43712396 ATTTGCCGCCAGGGTGTGGACGG + Intergenic
1179806391 21:43840606-43840628 ACTTGAACCTGGGAGGTGGAGGG - Intergenic
1180206030 21:46261120-46261142 GCTTCAGCCCAGGGGGTGGATGG - Intronic
1180463971 22:15594198-15594220 ACTTGAACCCTGGAGGTGGAGGG + Intergenic
1180605070 22:17052419-17052441 ACCTGATCCCAGGAGGTTGAGGG + Intergenic
1180648791 22:17361654-17361676 ACTTGAACCCGGGGGCTGGGGGG + Intronic
1180678458 22:17605445-17605467 ACTTGAACCCAGGAGGCGGGGGG + Intronic
1180850305 22:19015830-19015852 GCTTGAACCCAGGACGTGGAGGG + Intergenic
1180863418 22:19101021-19101043 ACTTGAACCTCGGAGGTGGATGG + Intronic
1180884363 22:19230184-19230206 GCTTGAACCCAGGAGGTGGAGGG - Intronic
1180949995 22:19716636-19716658 ACTGGGCCCCAGTGGGTGGCAGG + Intronic
1181008741 22:20027879-20027901 ACTTGAACCCAGGAGCCGGAGGG - Intronic
1181021083 22:20103047-20103069 GCTTGAACCCAGGAGGCGGAAGG + Intronic
1181110298 22:20598764-20598786 GCTTGAACCCAGGAGGCGGACGG - Intergenic
1181294259 22:21822335-21822357 GCTTGAACCCAGGAGGTGGAGGG + Intronic
1181378698 22:22481807-22481829 GCTTGAACCCAGGAGGTGGAAGG - Intergenic
1181473742 22:23156343-23156365 ACTGGACTCCAGGGGGAGGTCGG + Intronic
1181561362 22:23703708-23703730 ACTTGAACCCGGAAGGTGGAGGG + Intergenic
1181643741 22:24219238-24219260 GCTTGAGCCCAGGAGGTTGAGGG + Intergenic
1181746530 22:24958566-24958588 CCTTGAACCCCGGAGGTGGAGGG + Intronic
1181748886 22:24975399-24975421 GCTTGAGCCCAGGAGGTCGAAGG - Intronic
1181789307 22:25251496-25251518 ACTTGAGCCCAAGAGGTGGAAGG - Intergenic
1182244127 22:28941826-28941848 TCTTGAACCCGGGAGGTGGAAGG + Intronic
1182367143 22:29786891-29786913 ACTTGAGCCCGGGAGTTGGAGGG - Intergenic
1182449653 22:30411661-30411683 GCTTGAACCCAGGAGGTGGAAGG + Intronic
1182525464 22:30914684-30914706 ACTTGAACCCGGGAGGCGGAGGG + Intergenic
1182541235 22:31043528-31043550 GCTTGAACCCAGGAGGTGGAGGG + Intergenic
1182568148 22:31214876-31214898 ACTTGAACCTGGGAGGTGGAGGG - Intronic
1183026119 22:35066999-35067021 TCTTGACCCCAGGAGGTTCAGGG + Exonic
1183167484 22:36158733-36158755 ACTTGAACCCAGGAGGCGGAGGG + Intronic
1183194893 22:36346683-36346705 ACTTGAGCCCAGGGGGTCAAGGG - Intronic
1183642904 22:39102877-39102899 GCTTGAACCCAGGAGGTGGGAGG + Intronic
1183761152 22:39819280-39819302 GCTTGAACCCGGGAGGTGGAAGG + Intronic
1183881170 22:40831933-40831955 ACTTGAACCTGGGAGGTGGAAGG - Intronic
1183882216 22:40843035-40843057 ACTTGAGCCCAGGGCGTCAAGGG + Intronic
1183919524 22:41153665-41153687 ACTTGAACCCGGGAGATGGAAGG + Intronic
1184025489 22:41852836-41852858 ACCTGAACCCAGGAGGTGGAGGG - Intronic
1184029972 22:41886949-41886971 ACTTGAACCCAGGAGGTGGAGGG + Intronic
1184061870 22:42088023-42088045 ACTTGAACCCGGGAGGTGGAGGG + Intronic
1184115977 22:42422520-42422542 GCTTGAACCCGGGAGGTGGAGGG + Intronic
1184163433 22:42713228-42713250 CCTTGACCCAAGGGGGCGGGTGG - Intronic
1184198403 22:42947659-42947681 ACAAGACCCCTGGGGGTGGGGGG + Intronic
1184270962 22:43383165-43383187 ACTTGAACCCAGGAGTTGGGAGG + Intergenic
1184329236 22:43815872-43815894 GCTTGAACCCAGGAGGTGGAGGG - Intergenic
1184395532 22:44234420-44234442 ACTTGAACCCGGGAGGCGGAGGG - Intergenic
1184405066 22:44296240-44296262 ACTTGAACCCAGGAGGCAGAGGG - Intronic
1184555402 22:45230011-45230033 ACTCGAACCCAGGGGGCGGAGGG + Intronic
1184612120 22:45611152-45611174 ACTTGAGCCTGGGGGGTGGGAGG + Intergenic
1185074293 22:48675022-48675044 TCTTGAACCCAGGAGGCGGAGGG - Intronic
1185404639 22:50640941-50640963 ACTTGAGCCCGGGAGGCGGAGGG - Intergenic
949278549 3:2318720-2318742 CCTTGAGCCCAGGAGGTGGAGGG - Intronic
949362408 3:3245353-3245375 TCTTGAACCGAGGAGGTGGAGGG + Intergenic
949475727 3:4443193-4443215 GCTTGAGCCCAGTAGGTGGAGGG + Intronic
949483895 3:4519307-4519329 GCTTGAACCCAGGAGGTGGAGGG - Intronic
949954258 3:9254711-9254733 ACTTGCACCCAAGAGGTGGAGGG + Intronic
950056521 3:10029416-10029438 ACTTGAGCTCAGGAGGTCGAGGG + Intronic
950062851 3:10086562-10086584 ACTTGAGCCCAGGAGGTGGAGGG - Intronic
950067258 3:10122636-10122658 ACTTGAACCTAGGAGTTGGAGGG + Intronic
950240558 3:11366133-11366155 GCTTGAACCCGGGAGGTGGAGGG + Intronic
950277771 3:11678135-11678157 ACTTGAACCCAGGAGGTGGGAGG - Intronic
950371771 3:12536918-12536940 ACTTGAACCCGGGAGGTGGGAGG + Intronic
950847301 3:16027394-16027416 GCTTGAACCCAGGAGGCGGAAGG - Intergenic
950855270 3:16098720-16098742 ACTTGAGCCCTGGAGGTCGAGGG - Intergenic
950879675 3:16313126-16313148 GCTTGAGCCCAGGAGGTCGAGGG - Intronic
951520550 3:23606926-23606948 ACTTGAACCCAGGAGGTGGAGGG + Intergenic
951880223 3:27473623-27473645 GTTTGAGCCCGGGGGGTGGAGGG + Intronic
952798541 3:37265941-37265963 GCTTGAGTCCAGGAGGTGGAGGG + Intronic
952812915 3:37421385-37421407 ACTTGAACCCAGGGGGGTGGAGG - Intronic
952819289 3:37471969-37471991 ACTTGAACCCAGGAGGTCAAGGG + Intronic
953165680 3:40462998-40463020 ACTTGAACCCGGAAGGTGGAGGG - Intergenic
953311670 3:41886656-41886678 GCTTGAACCCAGGAGGCGGAGGG - Intronic
953492570 3:43363788-43363810 ACTTGACCCCAGTGGGGGTTTGG - Intronic
953532333 3:43749828-43749850 TCTTGAGCCCAGGAGGTGGAAGG - Intergenic
953592870 3:44276871-44276893 GCTTGAACCCAGGAGGCGGAGGG - Intronic
953762813 3:45705583-45705605 ACTTGAACCCGGGAGGCGGAGGG - Intronic
953989188 3:47470776-47470798 GCTTGAACCCAGGGGGGCGAAGG + Intronic
954204393 3:49047564-49047586 ACTTGAACCCGGGAGGCGGAGGG - Intronic
954256293 3:49409310-49409332 ACTTGAACCCAGGAGGCAGACGG + Intronic
954261332 3:49440993-49441015 ACTTGAACCTGGGAGGTGGAGGG + Intergenic
954310261 3:49761230-49761252 ACTTGAACCCGGGAGGTGGAGGG + Intronic
954311352 3:49770560-49770582 GCTTGAGCCCAGGAAGTGGAGGG + Intronic
954394375 3:50285555-50285577 GCTTGAACCCAGGAGGTGGAAGG + Intronic
954703882 3:52468174-52468196 ACTTGAACCCAGGAGGTGGAGGG + Intronic
954723615 3:52587911-52587933 ACTTGAGCCCAAGAGGTTGAGGG - Intronic
954730915 3:52661106-52661128 GCTTGAACCCAGGAGGTGGAGGG - Intronic
954861288 3:53692973-53692995 GCTTGAACCCAGGAGGTGGAGGG + Intronic
954886447 3:53878739-53878761 GCTTGAGCCCAGGAGGTGGAAGG + Intronic
954945440 3:54420165-54420187 ACTTGAACTCAGGAGGCGGAGGG - Intronic
955005969 3:54969340-54969362 ACTTGAACCAGGGAGGTGGAGGG - Intronic
955604650 3:60688512-60688534 ACTTGAACCCAGGAGGTGAAGGG - Intronic
955794745 3:62623898-62623920 AAATGTCCCCAGGGAGTGGAAGG - Intronic
955861322 3:63333497-63333519 ACTTGAGCTCAGGAGGTTGAGGG - Intronic
956002211 3:64741533-64741555 ACTTGAGCCCAGGAGTTCGAGGG - Intergenic
956103818 3:65795966-65795988 GCTTGACCACAGGAGGCGGAAGG + Intronic
956480887 3:69673168-69673190 GCTTGAGCCCAGGAGGTGGAGGG - Intergenic
956627612 3:71282024-71282046 GCTTGAACCCAGGAGGCGGAGGG + Intronic
956833418 3:73075782-73075804 GCTTGAGCCCAGGAGGCGGAGGG - Intergenic
956841875 3:73147711-73147733 ACTTGAACCTGGGAGGTGGAGGG - Intergenic
956972431 3:74542149-74542171 ACTTGAGCCCAGGGAGTAAAAGG + Intergenic
957229903 3:77499729-77499751 ACTTGAACCCGGGAGGTGGAGGG - Intronic
957544473 3:81620263-81620285 ACTTGAACCCGGGAGGTGGAGGG - Intronic
957794572 3:84986967-84986989 ACTTGAACCCGGGAGGCGGAGGG + Intronic
958421248 3:93933924-93933946 ACTTGAACCCAGGAGGCGGAGGG + Intronic
958646699 3:96883747-96883769 ACTTCAACCCAGGAGGTGGGAGG - Intronic
959032608 3:101318051-101318073 ACTTGAACCCAGGAGGTGGAGGG + Intronic
959065619 3:101654121-101654143 ACTTGAACCCTGGAGGTGGGAGG - Intronic
959260825 3:104077401-104077423 ACTTGAACCCAGGGTGTAGGGGG + Intergenic
959367454 3:105480265-105480287 GCTTGACCCCAGGAGGCAGAGGG + Intronic
959717769 3:109452295-109452317 ACTTGAACCTAGGAGTTGGAGGG - Intergenic
959951047 3:112180816-112180838 GCTTGAACCCAGGAGGGGGAGGG - Intronic
960025408 3:113003257-113003279 GCTTGAGCCCAGGAGGTGGAGGG + Exonic
960268955 3:115653357-115653379 ACTTGAACCTAGGAGGCGGAGGG + Intronic
960817150 3:121685450-121685472 GCTTGAACCCGGGAGGTGGAGGG + Intronic
960959121 3:123056810-123056832 GCTTGAGCCCAGGAGGCGGAGGG - Intergenic
961257191 3:125566086-125566108 GCTTGAACCCAGGAGGCGGAGGG - Intronic
961293640 3:125866760-125866782 ATTTGGCACCATGGGGTGGATGG - Intergenic
961336372 3:126182227-126182249 GCTTGAACCTAGGAGGTGGAGGG - Intronic
961443233 3:126965253-126965275 CCTTTACCACAGGGGGTGGCCGG - Intergenic
961696415 3:128708540-128708562 ACTTGATCCCAGGAGGTTGAGGG - Intergenic
961767193 3:129220484-129220506 ACTGGAACCCGGGAGGTGGAGGG + Intergenic
961845305 3:129757744-129757766 GCTTGAACCCAGGAGGTTGAAGG + Intronic
962534005 3:136310437-136310459 ACTTGAGCCCAGGAAGTTGAGGG + Intronic
962547056 3:136447384-136447406 ACTTGATCCCAGGAGGCGGAGGG + Intronic
962571464 3:136717579-136717601 ACTTGCACCCAGGAGGTGGAGGG + Intronic
962582936 3:136814619-136814641 ACTTGAACCCAGGAGGTGGAGGG - Intergenic
962614643 3:137112760-137112782 ACTTGAACCTGGGAGGTGGAGGG + Intergenic
962765584 3:138559640-138559662 ACTTGATCCCAGGAGGCGGAGGG + Intronic
963348009 3:144119070-144119092 ACTTTACCCCAGGAGGCGAAGGG + Intergenic
963852022 3:150218797-150218819 GCTTGAACCCAGTGGGTGGAAGG - Intergenic
964067344 3:152595755-152595777 GCTTGATCCCAGAGGGTTGAGGG + Intergenic
964107475 3:153055034-153055056 GCTTGAACCCAGGAGGCGGAGGG + Intergenic
964357841 3:155866607-155866629 ACTTGAACCCAGGAGGTGGAGGG + Intergenic
964489164 3:157216557-157216579 ACTTGAGCCTAGGAGGTTGAGGG - Intergenic
964577554 3:158191003-158191025 ACTTGACTCCAGGAGTTAGAAGG - Intronic
964620904 3:158719352-158719374 GCTTGAACCCGGGAGGTGGAGGG - Intronic
964624460 3:158746109-158746131 ACCTGAGCCCAGGAGGTGAAGGG - Intronic
964784793 3:160384160-160384182 ACTTGAACCCAGGAGGTAGAGGG + Intronic
964957185 3:162374507-162374529 GCTTGAGCCCAGGAGGTGGAGGG + Intergenic
965095959 3:164226184-164226206 GCTTGAACCCTGGAGGTGGAGGG + Intergenic
965268179 3:166575836-166575858 ACTTGAACCCAGGAGGTGGAGGG - Intergenic
965357446 3:167693871-167693893 GCTTGAGCCCAGGAGGTTGAGGG + Intronic
965592291 3:170373247-170373269 GCTTGAACCCAGGAGGTGGAGGG - Intronic
965592968 3:170379724-170379746 ACTTGAACCCAGGAGATGGAGGG - Intronic
966202220 3:177369070-177369092 GCTTGAACTCAGGAGGTGGAGGG - Intergenic
966530550 3:180974239-180974261 GCTTGAACCCGGGAGGTGGAGGG - Intronic
966565289 3:181373204-181373226 ACTTGAGCCCAAAAGGTGGATGG + Intergenic
966766749 3:183470061-183470083 ACTTGAACCCAGGAAGTGGAGGG - Intergenic
966797199 3:183726882-183726904 GCTTGAACCCTGGAGGTGGAGGG - Intronic
966803183 3:183783986-183784008 GCTTGAGCCCAGGAGGTCGAGGG - Intronic
966883147 3:184361115-184361137 ACTTGGGCCCAGGTGGTGAAGGG + Intronic
967120400 3:186377727-186377749 ACTTGAACCCAGGAGGTGGAGGG + Intergenic
967410617 3:189163188-189163210 ACTTGAACCCAGGAGGTGGAGGG + Intronic
967743942 3:193033827-193033849 ACTTGAACCCGGGAGGTGGTGGG - Intergenic
967872543 3:194243979-194244001 ACCTGAACCCGGGGGGTGGGGGG + Intergenic
967893091 3:194376906-194376928 GCTTGAACCCGGGAGGTGGACGG + Intergenic
967902447 3:194469375-194469397 GCTTGAACCCAGGAGGCGGAGGG + Intronic
968056695 3:195697277-195697299 GCTTGAACCCAGGAGGTGGAGGG - Intergenic
968111661 3:196053029-196053051 ACTTGAACCTGGGAGGTGGAGGG + Intronic
968136158 3:196220971-196220993 ACCTGAGCCCAGCAGGTGGAGGG - Intronic
968169169 3:196494938-196494960 GCTTGAGCCCGGGCGGTGGAGGG + Intronic
968212548 3:196861045-196861067 ACTTGAACCCAAGAGGTGGAGGG + Intergenic
968295939 3:197576792-197576814 CAGAGACCCCAGGGGGTGGAGGG - Intergenic
968560930 4:1281606-1281628 GCCTGAACCCAGGAGGTGGAGGG + Intergenic
968757174 4:2422887-2422909 CCTTGAGCCCAGGAGGTTGAAGG - Intronic
968771316 4:2509298-2509320 ACTTGAACCCAGGAGGTGGAGGG - Intronic
968845494 4:3039131-3039153 GCGTGAACCCAGGAGGTGGAGGG + Intronic
969761135 4:9183129-9183151 ACTTGAACCCAGGAGGCAGAAGG - Intergenic
970117246 4:12711043-12711065 GCTTGAACCCAGGAGGCGGAGGG + Intergenic
970388299 4:15579244-15579266 ACTTGAGCCCAGGAGTTTGAGGG + Intronic
970508215 4:16754612-16754634 ACTTGAACCCAGGAGGCGGATGG - Intronic
970690871 4:18619120-18619142 ACTTGAATCCAGGAGGCGGAGGG - Intergenic
971049824 4:22849047-22849069 ACTTGAACCTGGGAGGTGGAGGG - Intergenic
971198719 4:24492772-24492794 CCTTGAGCCCAGGAGTTGGAGGG - Intergenic
971367434 4:25988637-25988659 ACTTGAACCCGGGAGGCGGAGGG - Intergenic
971431057 4:26568003-26568025 ACTTGAGCCCAGGAGGTCAAGGG - Intergenic
971483820 4:27139601-27139623 ACTTGAACCCTGGAGGAGGAGGG - Intergenic
971505808 4:27365373-27365395 GCTTGAATCCAGGAGGTGGAGGG + Intergenic
971677299 4:29648664-29648686 GCTTGAGCCCAGGAGGTTGAGGG + Intergenic
971754496 4:30689966-30689988 ACTTGAACCCAGGAGGCAGAGGG - Intergenic
971801196 4:31294117-31294139 GCTTGAACCCAGGAGGTGGAGGG - Intergenic
972141803 4:35969803-35969825 ACTTGAACCCAGGGGGATGGAGG - Intronic
972223507 4:36984255-36984277 GCTTGAACCCAGAAGGTGGAGGG + Intergenic
972322305 4:37983196-37983218 ACTTGAACCTGGGAGGTGGAGGG - Intronic
972424702 4:38921477-38921499 ACTTGAGCCCAGGAGTTTGAGGG - Intronic
972442580 4:39109732-39109754 ACTTGAACCCAGGAGGTGGAGGG - Intronic
972558981 4:40209526-40209548 ACCTGACCCCAGGAGGTGGAAGG - Intronic
972569560 4:40298102-40298124 ACTTGAGCCCAGGAGGTTGAGGG - Intergenic
972580675 4:40393302-40393324 GCTTGAGCCCAGGAGGTGGAGGG + Intergenic
972602196 4:40582449-40582471 GCTTCAACCCAGGAGGTGGAGGG + Intronic
972751751 4:41996176-41996198 GCTTGAACCCAGGAGGTGGAGGG - Intronic
973338402 4:48979590-48979612 ACTTGCACCAAGGAGGTGGAGGG - Intergenic
973338586 4:48981485-48981507 ATTTGAACCCAGGAGGCGGAGGG + Intergenic
973666379 4:53163645-53163667 GCTTGAATCCAGGAGGTGGAGGG + Intronic
973711500 4:53634324-53634346 GCTTGAACCTAGGAGGTGGAGGG - Intronic
973712596 4:53644316-53644338 GCTTGAACCCAGGAGGTGGAGGG + Intronic
973889395 4:55354178-55354200 ACTTGAACCCAGGAGATGGGAGG - Intronic
973999880 4:56501342-56501364 ACGTGAACCCAGGAGGTGGATGG + Intronic
974325186 4:60404829-60404851 ATTTGAACCCAGGAGGCGGAGGG + Intergenic
974439056 4:61893788-61893810 ACTTGAACCCTGGAGGCGGAGGG - Intronic
974708611 4:65557957-65557979 GCTTGAACCCAGGAGGAGGAGGG - Intronic
975312625 4:72919356-72919378 ACTTGAACCCGGGAAGTGGAGGG + Intergenic
975573098 4:75837758-75837780 ACTTGAACCCAGGAGGTGGAGGG - Intergenic
975721105 4:77249514-77249536 TCTTGCCACCAGGGGGTAGAGGG - Intronic
975870960 4:78777146-78777168 GCTTGACACCAGGGGCTGCAGGG - Intronic
976274413 4:83261531-83261553 ACTGGCACCCAGAGGGTGGAGGG + Intronic
976373601 4:84318861-84318883 ACTTGAACCCAGGAGGCAGAGGG + Intergenic
976424433 4:84885081-84885103 GCTTGAACCCAGGAGGCGGAGGG - Intronic
976502188 4:85804032-85804054 CCTTGAACCCAGGAGGCGGAGGG - Intronic
976620566 4:87122975-87122997 ACTAGAACCCAGGAGGTGGAGGG - Intronic
977561954 4:98541590-98541612 GCTTGAACCCAGGAGGGGGAGGG + Intronic
977650612 4:99464496-99464518 GCTTGAACCCAGGAGATGGAGGG - Intergenic
977798261 4:101194647-101194669 TCTTGAACCCAGGAGGTAGAGGG - Intronic
977935950 4:102804755-102804777 ACTTGATCCCAGGAGGCAGAGGG - Intronic
978224147 4:106314706-106314728 GCTTGAACCCGGGAGGTGGAAGG - Intronic
978532831 4:109731261-109731283 ACTTGAACCCAGGAGGTGGATGG + Intergenic
978818588 4:112937408-112937430 ACTTGAACCCAGGAGGCAGAGGG - Intronic
979139911 4:117159759-117159781 ACTTGAACCCGGTAGGTGGAGGG - Intergenic
980292897 4:130868909-130868931 ACTTGAACCTGGGAGGTGGAGGG - Intergenic
981063814 4:140459987-140460009 ACTTGAGCCCAGGAGTTGGGAGG - Intronic
981070552 4:140532245-140532267 GCTTGAACCCGGGAGGTGGAGGG - Intronic
981089048 4:140713654-140713676 ACTTGAGCCCAGGAGGTAGAGGG + Intronic
981541126 4:145847069-145847091 GCTTGAACCTAGGAGGTGGAGGG + Intronic
981806936 4:148727712-148727734 ACTTGAACCCAGGAGGCCGAGGG - Intergenic
982377799 4:154713470-154713492 GCTTGAACCCAGGAGGCGGAGGG + Intronic
982700403 4:158654849-158654871 ACCTGAACCCTGGAGGTGGAGGG - Intergenic
982738623 4:159034052-159034074 ACTTGAACCTGGGAGGTGGAGGG + Intronic
982793252 4:159616617-159616639 ACTTGAACCCAGGAGTCGGAGGG - Intergenic
982941838 4:161569078-161569100 GCTTGAGCCCAGGAGGTTGAGGG - Intronic
983122880 4:163910575-163910597 ACTTGAACCCAAGAGGTGAAGGG - Intronic
983156719 4:164356953-164356975 TCTGGGCCCCAGTGGGTGGAGGG + Intronic
983211744 4:164965514-164965536 ACTTGAACCCAGGAGGCAGAAGG - Intronic
983279437 4:165661957-165661979 GCTTGAACCCGGGAGGTGGAGGG - Intergenic
983556641 4:169064911-169064933 ACTGGAACCCAGGAGGCGGAGGG + Intergenic
984487994 4:180396924-180396946 ACTTGAACCCAGGGAGGCGAAGG + Intergenic
984690915 4:182725133-182725155 ACTTGAGCCCAGGAGTTCGAGGG - Intronic
984892496 4:184506190-184506212 GCTTGAACTCAGGAGGTGGAGGG - Intergenic
984900936 4:184585845-184585867 AGTTTTCCACAGGGGGTGGAGGG - Intergenic
985243105 4:187951613-187951635 GCTTGAGCCCGGGAGGTGGAGGG - Intergenic
985304787 4:188527382-188527404 ACTTGAACCTGGGAGGTGGACGG + Intergenic
985666642 5:1184560-1184582 ACCTGACCCCAGGGCGTACAGGG - Intergenic
986291700 5:6405187-6405209 ACTTGAACCCAGGAGGTGGAGGG - Intergenic
987062199 5:14253436-14253458 ACTTGAGCCCAGGAGGCAGAGGG - Intronic
987139423 5:14930165-14930187 ACTTGAACCCAGGAGGCAGAGGG - Intergenic
987345032 5:16971494-16971516 GCTTGAACCCAGGAGGCGGAGGG + Intergenic
988429504 5:31102728-31102750 GCTTGAGCCCAGGAGTTGGAGGG + Intergenic
988597701 5:32610262-32610284 ACTTGAACCCAGGAGGCAGACGG - Intergenic
989047139 5:37284173-37284195 GCTTGAACCCAGGAGGCGGAGGG + Intergenic
989054760 5:37356144-37356166 GCTTGAACCCAGGAGGCGGAGGG + Intronic
989491543 5:42060929-42060951 ACTTGAGCGTAGAGGGTGGAAGG + Intergenic
989815549 5:45733118-45733140 GCCTGAACCCAGGAGGTGGAAGG - Intergenic
990258843 5:53999506-53999528 ACTTGAACCCGGGAGGTGGAGGG + Intronic
990805699 5:59658918-59658940 ACTTGATCCCAGGGGTTTGAGGG + Intronic
991150672 5:63364710-63364732 GCTTGAACTCAGGAGGTGGAGGG + Intergenic
991340790 5:65606361-65606383 ACTTGAGCCCAGGAGGCAGAAGG + Intronic
991572746 5:68072935-68072957 ACCTGAACCCAGGAGGCGGAGGG - Intergenic
991684835 5:69172337-69172359 ACTTGACCCGAGGCGGAGGCTGG - Intronic
991716213 5:69453357-69453379 ACTTGAGCCCAGGAGGTCCAGGG + Intergenic
991911037 5:71561316-71561338 GCTTGAACCCAGGAGGCGGAGGG + Intronic
992286410 5:75240285-75240307 ACTTGAACCCGGGAGGTGGGAGG - Intergenic
992302141 5:75393880-75393902 ACTTGAACCCGGGAGGCGGAGGG + Intronic
992333517 5:75741846-75741868 ACTTGAACCCGGGAGGCGGAAGG - Intergenic
992535409 5:77696833-77696855 ACTTGAGCCCAGGAGCTGGGAGG + Intronic
992546690 5:77820625-77820647 ACTTGTGCCCAGCTGGTGGATGG + Intronic
992635690 5:78723925-78723947 ACTTGAACCCAGGAGGCAGAGGG + Intronic
992716579 5:79516515-79516537 ACTTGAACCTGGGAGGTGGAGGG - Intergenic
992732226 5:79683425-79683447 CCTTGAGCCCAGGAGGTTGAGGG + Intronic
992794320 5:80242046-80242068 ACTTGAGCCCAGGGCATTGAAGG + Intronic
992823369 5:80521205-80521227 ACTTGAGCCCAGGAGGTTGAAGG - Intronic
992988937 5:82263826-82263848 ACTTGAACCCAGGAGGCAGAGGG - Intronic
993112920 5:83681591-83681613 ACTTGAGCCCAGGAGGTTGAGGG - Intronic
993350019 5:86838506-86838528 ACTTGAGCCCAAGAGGTTGAGGG - Intergenic
993359846 5:86960771-86960793 ACTTGAACCCAGGAGGCAGAGGG + Intergenic
993714214 5:91258578-91258600 ACTTGAGCCCGGGAGGTGGAGGG + Intergenic
994255832 5:97595108-97595130 ACTTGAACCCAGGAGGTGGAGGG - Intergenic
994346159 5:98689201-98689223 ACTGGAGCCCAGGAGGTTGAGGG + Intergenic
994371486 5:98972466-98972488 GCTTGAACCCGGGAGGTGGAGGG - Intergenic
994614275 5:102083840-102083862 GCTTGAACCCAGGAGGTGGAGGG - Intergenic
994997539 5:107083123-107083145 ACTTGAACCCAGGAGATGGAGGG + Intergenic
995709510 5:115020888-115020910 GTTTGAACCCAGGAGGTGGAGGG + Intergenic
996313394 5:122133640-122133662 GCTTGAGCCCAGGAGGTCGAGGG - Intronic
996388434 5:122933863-122933885 GCTTGAACCCAGGAGGCGGAGGG - Intronic
996405227 5:123097715-123097737 TTTTGACCCCAGGGCCTGGATGG - Intronic
996571234 5:124934378-124934400 ACTTGAACCCAGGAGGTGGAGGG - Intergenic
996669093 5:126095833-126095855 ACTTGAACTCAGGAGGTGAAAGG + Intergenic
996730185 5:126709811-126709833 ACTTGAGCCTAGGAGGCGGAGGG - Intergenic
997107627 5:131038765-131038787 ACTTGAACCCAGGAGGTAGGTGG + Intergenic
997158809 5:131585741-131585763 GCTTGAACCCATGAGGTGGAGGG + Intronic
997167195 5:131673951-131673973 ACTTGAACCCAGGAGGCAGAGGG + Intronic
997326813 5:133028463-133028485 ACTTGAACCCGGGAGGCGGAGGG - Intergenic
997699914 5:135889967-135889989 ACTTGAGCCTAGGAGGTCGAGGG - Intergenic
998156718 5:139790966-139790988 GCTTGAACCCAGGAGGTGGGGGG + Intergenic
998227586 5:140338874-140338896 CCTTTACCCCAGGAGGTGGAGGG + Intronic
998401934 5:141852792-141852814 CCTTGATCTCAGGGGGTGGGAGG - Intergenic
998470560 5:142380680-142380702 ACTTGAACCTTGGAGGTGGAGGG - Intergenic
998853617 5:146374117-146374139 ACTTGAACCCAGGAGGTGGAGGG + Intergenic
998967266 5:147553958-147553980 GCTTGAACCCAGGAGGTGGAGGG + Intergenic
998979859 5:147690248-147690270 ACTTGAGCCCAGAAGGTTGAGGG + Intronic
999264800 5:150259437-150259459 GTTTGAGCCCAGGGGGCGGAGGG + Intronic
999464833 5:151793189-151793211 GCTTGAACCCGGGAGGTGGAGGG - Intronic
999470123 5:151847634-151847656 GCTTGAACCCGGGAGGTGGAGGG + Intronic
999756046 5:154665239-154665261 ACTTGAACCCAGAAGGTGGAGGG - Intergenic
999809895 5:155117848-155117870 GCTTGAACCCGGGAGGTGGAGGG - Intergenic
1000010571 5:157227911-157227933 GCTTGAACCCAGGAGGTGGAGGG - Intronic
1000081975 5:157857162-157857184 ACTTGAGCCCAGGAGTTGGAGGG + Intronic
1000298620 5:159934724-159934746 GCCTGAACCCAGGAGGTGGAGGG + Intronic
1000318660 5:160117007-160117029 ACTTGAACCAGGGAGGTGGAGGG + Intronic
1000596334 5:163218972-163218994 ACTTGAACCCAGGAGGCAGAGGG + Intergenic
1001220602 5:169897265-169897287 GCTTGAACCCAGGAGGTGGAAGG - Intronic
1001291798 5:170468792-170468814 ACCTGAGCCCAGGAGGTGGAGGG + Intronic
1001357781 5:171047521-171047543 TCTTGAACCCGGGAGGTGGAGGG - Intronic
1001468529 5:171990906-171990928 GCTTGAACCCAGGAGGTGGGGGG - Intronic
1001478591 5:172069534-172069556 ACTTGAGCCCAGGAGTTTGAGGG + Intronic
1001609248 5:172986868-172986890 GCTTGAACCCAGGAGGCGGAGGG - Intronic
1001819227 5:174696644-174696666 ACTTGAACCCAGGGGCAGGGTGG - Intergenic
1001819959 5:174702845-174702867 ACTTGAGCCTGGGAGGTGGAGGG - Intergenic
1002002618 5:176206702-176206724 GCTTGAACCCGGGAGGTGGAGGG - Intergenic
1002088769 5:176792564-176792586 ACTTGAGCACCTGGGGTGGAAGG - Intergenic
1002223981 5:177704916-177704938 GCTTGAACCCGGGAGGTGGAGGG + Intergenic
1002358153 5:178647835-178647857 ACTTGAACCCAGGAGGCAGAGGG - Intergenic
1002459250 5:179364740-179364762 ACTTGAGCCCAGGAGGTCGAGGG - Intergenic
1003118680 6:3301642-3301664 ACGTGGCCCTAGGGGTTGGAAGG - Intronic
1003166653 6:3685048-3685070 ACTTGAGCCCAGGCGGTTGGAGG + Intergenic
1003203527 6:3986533-3986555 ACTTGAGCCCAGGTGTTTGAGGG - Intergenic
1003482244 6:6544882-6544904 GCTTGAACCCAGGAGGCGGAGGG + Intergenic
1003655711 6:8005782-8005804 GCTTGAACCCAGGAGGTGGGAGG - Intronic
1003887525 6:10534777-10534799 ACTTGAGCCCAGGAGGTCAAGGG + Intronic
1004002862 6:11611365-11611387 ACTTGAACCCGGGAGGCGGACGG + Intergenic
1004655668 6:17657479-17657501 ACTTGAACTCAGGAGGTGGAGGG + Intronic
1004656574 6:17668156-17668178 ACTTGAACCCGGGAGGCGGAGGG - Intronic
1004657098 6:17673283-17673305 GCTTGAACCCAGGAGGTGGAGGG + Intronic
1005046514 6:21648206-21648228 ACTTGAACCCGGGAGGCGGAGGG - Intergenic
1005375819 6:25181258-25181280 TCCTGGCCCCAGGGGTTGGAGGG + Intergenic
1005432368 6:25771489-25771511 ACTTGAACCCAGGAGGTGGAGGG + Intronic
1005723921 6:28630358-28630380 ACTTGAGCCCAAGAAGTGGAAGG + Intergenic
1005829705 6:29660789-29660811 ACTTGAACCCAGGAGGCGGAGGG - Intronic
1005945436 6:30591914-30591936 GCTTGAGCCCAGGAGGTTGAGGG - Intronic
1006104574 6:31708841-31708863 ACTTGAACCTGGGAGGTGGAGGG + Intronic
1006233426 6:32605448-32605470 CCTTGAACCCAGGAGGTGGAGGG + Intergenic
1006274829 6:32994967-32994989 ACCTGAACCCAGGAGGTGGAGGG + Intergenic
1006307862 6:33235501-33235523 ACTTAACGCCAGGAAGTGGAGGG + Intergenic
1006497704 6:34435780-34435802 GCTTGAACCCAGGAGGCGGAGGG - Intergenic
1006652004 6:35559390-35559412 ACTTGAGCCCAGGAGTTAGAGGG - Intergenic
1006831361 6:36970236-36970258 AGTTTACCCCAGGGGGTGCTGGG + Intronic
1007338033 6:41169083-41169105 GCTTGAACCCAGGAGGCGGAGGG - Intergenic
1007415125 6:41687214-41687236 ACTTCTCCCCATGGGGTGGGGGG - Intronic
1007568237 6:42869970-42869992 ACTTGAACCCAGGGAGAGGTGGG + Intergenic
1007597018 6:43057425-43057447 ACTTGAGCCCGGGAGGTGGAGGG - Intronic
1007675528 6:43590838-43590860 ACTTGAGTCCAGGAGGCGGAGGG + Intronic
1007866462 6:44975086-44975108 ACTTGAACCCAGGAGGCGGAGGG + Intronic
1008021984 6:46589368-46589390 GCTTGAGCCCAGGAGGTTGAGGG + Intronic
1008064981 6:47037941-47037963 ACTTGAACCCAGGAGGAAGAGGG - Intronic
1008070163 6:47091466-47091488 GCTTGAACCCAGGAGGTGGGAGG - Intergenic
1008325474 6:50175532-50175554 ACTTGAGCCCAGGAGGCAGAGGG + Intergenic
1008448665 6:51623664-51623686 GCTTGAAACCAGGAGGTGGAGGG - Intronic
1008464621 6:51816917-51816939 CATTGACCCCAGGGAGTGGAGGG - Intronic
1008516201 6:52321383-52321405 GCTTGAACCCGGGAGGTGGAGGG + Intergenic
1008760451 6:54846867-54846889 ACGGGACCCCAGCGGGTGCAGGG + Intronic
1008836994 6:55845745-55845767 ACTTGAGTCCAGGGGGTTCATGG - Intronic
1008929178 6:56919727-56919749 ACTTGAGCCCAGGAGTTTGAGGG + Intronic
1009772217 6:68158224-68158246 GCTTGAACTCAGGAGGTGGAGGG + Intergenic
1009923792 6:70096162-70096184 ACTCCAGCCCAGGAGGTGGAGGG - Intronic
1010193053 6:73213219-73213241 ACTTGAGCCCAGGCAGTTGAGGG - Intronic
1010219222 6:73432999-73433021 GCTTGAACCCAGGAGGTGGAGGG + Intronic
1010232196 6:73544979-73545001 ACTTGAGCCCAGGAGGCAGAGGG - Intergenic
1010247057 6:73671352-73671374 GCTTGAACCCAGGAGGCGGAGGG - Intergenic
1010376589 6:75177352-75177374 ACTTGAACCCAGGAGGCAGAGGG + Intronic
1010648367 6:78421983-78422005 GCTTGAACCCAGGAGGCGGAGGG - Intergenic
1010919902 6:81668485-81668507 GCTTGAACCCAGGAGGTGAAGGG + Intronic
1011260847 6:85468362-85468384 ACCTGACCCCAGGGTGGGGTTGG - Intronic
1011445565 6:87435740-87435762 CCTTGAACCCAGGAGTTGGAAGG - Intronic
1011461608 6:87611017-87611039 GCTTAAGCCCAGGAGGTGGAGGG - Intronic
1011573082 6:88761406-88761428 GCTTGAACCCGGGAGGTGGACGG + Intronic
1011585130 6:88916388-88916410 GCTTGAGTCCAGGAGGTGGAGGG + Intronic
1011727823 6:90228654-90228676 GCTTGAACCCAGGAGGTGGAGGG + Intronic
1011732893 6:90283922-90283944 ACTTGAACCTGGGAGGTGGAGGG + Intronic
1011768817 6:90653246-90653268 GCTTGAACCCAGGGAGTGGGTGG + Intergenic
1012322540 6:97868053-97868075 ACTTGAATCCAGGAGGCGGAGGG + Intergenic
1012461940 6:99473462-99473484 ACTTGAACCCAGGAGGTTGGAGG + Intronic
1012602877 6:101119647-101119669 ACTTGAACCCAGGAGGCTGAGGG - Intergenic
1012934044 6:105347015-105347037 ACTTGAACCCAGGAGGCGGAAGG + Intronic
1012971080 6:105731826-105731848 CCATGGCCCCAGGGGGTGGGAGG - Intergenic
1013201134 6:107896894-107896916 ACTTGAACCCAGGAGATGGGAGG + Intronic
1013328922 6:109078297-109078319 ACTTGAACCCAGGAGATTGAAGG + Intronic
1013515773 6:110884514-110884536 GCTTGAGCCCAGGAGATGGAGGG - Intronic
1013526655 6:110980771-110980793 GCTTGAACCCGGGAGGTGGACGG + Intergenic
1013544160 6:111139382-111139404 ACTTGAACCCAGGAGGCAGAGGG - Intronic
1013785802 6:113778687-113778709 ACTTGAACCCAGGAGGCAGACGG + Intergenic
1014249532 6:119101147-119101169 GCTTGAACCCAGGAGGTGGAGGG - Intronic
1014513131 6:122349180-122349202 ACTTGAACCCAGGAGGCAGACGG + Intergenic
1014697954 6:124647414-124647436 ACTTGAACCCAGGAGGTGGAGGG + Intronic
1014808484 6:125858552-125858574 GCTTGAGCCCAGGAGTTGGAAGG + Intronic
1014911382 6:127097526-127097548 GCTTGAACCCAGGAGGCGGAGGG + Intergenic
1015001080 6:128216450-128216472 ACTTGAACCCAGGAGGCAGAGGG + Intronic
1015086881 6:129305405-129305427 TCTTGAGCCCAGAAGGTGGAGGG - Intronic
1015265625 6:131289280-131289302 ACTGGAACCCAGGAGGCGGAGGG + Intergenic
1015519118 6:134114092-134114114 AATTGACCCTAAAGGGTGGAGGG - Intergenic
1015571804 6:134629301-134629323 TCTTGAACCCAGGGGGCAGAGGG + Intergenic
1015589202 6:134806058-134806080 GCTTGAACCCAGGAGGTGGAGGG + Intergenic
1015594819 6:134856247-134856269 GCTTGAACCCAGGAGGTGGATGG + Intergenic
1015690480 6:135916473-135916495 ACTTGAACCCAGGAGGCGGAGGG - Intronic
1015965163 6:138690656-138690678 GCTTGAACCCAGGAGGCGGAGGG + Intronic
1016145936 6:140673709-140673731 ACTTGAGCCCTGGAGGTTGAGGG - Intergenic
1016211652 6:141542984-141543006 GCTTGAACCCAGGAGGTGGAGGG - Intergenic
1016477082 6:144439573-144439595 ACTTGAACCCAGGAGGCAGAGGG - Intronic
1017504424 6:155054662-155054684 ACTTGAACCCAGGGGGCGGGAGG - Intronic
1017517296 6:155168438-155168460 ACTTGAACCCGGGAGGCGGAGGG - Intronic
1017646183 6:156541684-156541706 ACTTGAATCCAGGAGGCGGAGGG + Intergenic
1017757842 6:157544564-157544586 GCTTGAACCCAGGAGGCGGAGGG + Intronic
1017768123 6:157623630-157623652 GCTTGAACCCAGGAGGTGGAGGG - Intronic
1017796760 6:157851670-157851692 GCTTGAACCCTGGAGGTGGAGGG - Intronic
1017840283 6:158216615-158216637 ACTTGAACCCAGGAGGCGGAGGG - Intergenic
1017899905 6:158710861-158710883 GCTTGAACCCGGGAGGTGGAGGG - Intronic
1018000430 6:159573957-159573979 GCTTGACCCCGGGAGGTGGAGGG - Intergenic
1018071179 6:160166130-160166152 TCTTGAGCCCGGGAGGTGGATGG - Intergenic
1018190510 6:161305752-161305774 ACTTGAGCCCAGGAGTTTGAAGG + Intergenic
1018192482 6:161322274-161322296 ACTTGAGCCCAGGAGGTCAAGGG + Intergenic
1018254227 6:161902641-161902663 ACTTGAACCCAAGAGGCGGAGGG - Intronic
1018308262 6:162480886-162480908 ACTTGAACCCAGGAGGCGGAGGG - Intronic
1018318476 6:162581674-162581696 ACTTGAACCCAGGAGGCAGAGGG + Intronic
1018402525 6:163439428-163439450 ACTTGAAACCAGGAGGCGGAGGG - Intronic
1018439940 6:163802228-163802250 ACTTGAACCCAGGAGGTGGAGGG + Intergenic
1019130569 6:169870210-169870232 ACTTGAGCCCAGGAGGTTGAGGG - Intergenic
1019214777 6:170436061-170436083 GGTTGACCCCAGGGAGAGGATGG + Intergenic
1019696271 7:2447959-2447981 GCTTGAACCCAGGAGGTGGACGG - Intergenic
1019730946 7:2629344-2629366 GCTTGAACCCGGGAGGTGGAGGG - Intergenic
1019755819 7:2768984-2769006 GCTTGAACCCAGGAGGTGGAGGG - Intronic
1019765396 7:2846055-2846077 ACTTGAGCCCAGGAGGTCAAGGG + Intergenic
1019783424 7:2958367-2958389 ACTTGAGCCAAGGAGGTGGAGGG + Intronic
1020083818 7:5299967-5299989 GCTTGAACCCAGGAGGTGGAGGG + Intronic
1020101843 7:5398251-5398273 ACTTGAACCCGGGTGGCGGAAGG - Intronic
1020102242 7:5400527-5400549 ACTTGAACCTAGGAGGTGGAAGG + Intronic
1020206569 7:6122366-6122388 ACTTGAACCCAGAAGGTTGAGGG - Intronic
1020221080 7:6237623-6237645 ACTTGAACCCGGGGGGCAGAAGG + Intronic
1020245704 7:6427698-6427720 ACTTGAGCCCAGGAGGTTGAGGG + Intronic
1020483433 7:8691229-8691251 GCTTGAACCCAGGAGGTGGATGG - Intronic
1020639658 7:10739426-10739448 GCTTGAACCCAGGAGGCGGAGGG + Intergenic
1020847205 7:13301218-13301240 GCTTGAACCCAGGAGGCGGAAGG - Intergenic
1021653025 7:22850118-22850140 ACTTGAACCCAGGAGGTGGATGG - Intergenic
1021665104 7:22969255-22969277 ACTTGAGCCCCAGAGGTGGAGGG - Intronic
1021802514 7:24321390-24321412 GCTTGAACCCAGGAGATGGAGGG + Intergenic
1022119757 7:27296724-27296746 GCTTGAACCCAGAAGGTGGAGGG + Intergenic
1022278149 7:28876550-28876572 GCTTGAAGCCAGGGGGTGGACGG + Intergenic
1022420355 7:30215061-30215083 GCTTGAACCCAGGAGGCGGAGGG + Intergenic
1022453187 7:30534741-30534763 ACTTGAACCTGGGAGGTGGAGGG - Intronic
1022540521 7:31130745-31130767 GCTTGAACCCGGGAGGTGGAGGG + Intergenic
1023628315 7:42138560-42138582 CCTTCACCCCTGGGGGAGGAGGG + Intronic
1023911408 7:44559455-44559477 ACTTGAACCCGGGAGGTGGATGG + Intergenic
1023955946 7:44886620-44886642 GCTTGAACCCGGGAGGTGGAGGG - Intergenic
1024195475 7:47054161-47054183 ACTTGAGCCCAGGAGTTTGAGGG - Intergenic
1025008792 7:55378375-55378397 ACTTGAACCCAGGAGGTAGGAGG + Intronic
1025099284 7:56122085-56122107 GCTTGAACCCAGGGGGGTGAAGG + Intergenic
1025192274 7:56905041-56905063 GCTTGAACCCGGGAGGTGGAGGG - Intergenic
1025210456 7:57017218-57017240 GCTTGAACCCAGGAGGTGGAGGG - Intergenic
1025239006 7:57256286-57256308 GCTTGAACCCGGGAGGTGGAGGG - Intergenic
1025637063 7:63331472-63331494 ACTTGAACCCAGGAGGCAGAGGG - Intergenic
1025645632 7:63416630-63416652 ACTTGAACCCAGGAGGCAGAGGG + Intergenic
1025661500 7:63559628-63559650 GCTTGAACCCAGGAGGTGGAGGG + Intergenic
1025679675 7:63671890-63671912 GCTTGAACCCGGGAGGTGGAGGG + Intergenic
1025712158 7:63922076-63922098 GCTTGAACCCAGGAGGAGGAGGG + Intergenic
1025713627 7:63932752-63932774 ACTTGAACCCGGGAGGTGGAGGG - Intergenic
1025735085 7:64139782-64139804 GCTTGAACCCAGGAGGCGGATGG + Intronic
1025785657 7:64641286-64641308 GCTTGAACCCAGGAGGTGAAGGG - Intergenic
1025797310 7:64751235-64751257 TCTTGATCCCGGGAGGTGGAGGG + Intergenic
1025927450 7:65971139-65971161 TCTTGAACACAGGAGGTGGATGG + Intronic
1026048558 7:66925101-66925123 ACTTGAGCCCAGGAGGAGGAGGG - Intronic
1026064522 7:67058564-67058586 ACTTCAGCCCAGGAGGTGGGAGG - Intronic
1026352387 7:69528869-69528891 GCTTGAACCCAGGAGGTGGAAGG - Intergenic
1026517780 7:71087642-71087664 GCTTGAGCCCAGGAGGTTGAGGG + Intergenic
1026552823 7:71382295-71382317 GCTTGAACCCAGGGGGCGGAGGG + Intronic
1026682193 7:72475370-72475392 ACTTGAACCCAGGAGGTGGACGG + Intergenic
1026705421 7:72687349-72687371 ACTTGAAGCCAGGAGGCGGAGGG + Intronic
1026838581 7:73654702-73654724 ACTAGAACCCGGGAGGTGGAGGG + Intergenic
1026844641 7:73691680-73691702 ACTTGAGCCCAGGAGTTCGAGGG - Intronic
1026885299 7:73938471-73938493 ACTTGAGCCCAGGGGTTGCAGGG - Intergenic
1026963862 7:74426975-74426997 GCTTGAACCCGGGAGGTGGAGGG - Intergenic
1027006444 7:74697849-74697871 GCTTGAACCCGGGAGGTGGAGGG - Intronic
1027109941 7:75429546-75429568 ACTTGAACCCGGGAGGTGGAGGG + Intronic
1027147822 7:75709952-75709974 ACTTGAGCCCAGGAGGTTGAGGG - Intronic
1027154701 7:75758401-75758423 GCTTGAGCCCAGGAGGTGGAGGG - Intergenic
1027198303 7:76046731-76046753 GCTTGAACCCGGGAGGTGGAGGG - Intronic
1027216966 7:76189890-76189912 ACTTGAACCCGGGAGGCGGAGGG + Intergenic
1027399135 7:77789481-77789503 GCTTGAACCCAGGAGGTGGTAGG - Intergenic
1027500982 7:78951052-78951074 GCTTGAACCCAGGAGGTGGGAGG - Intronic
1027545838 7:79526519-79526541 ACTGGAGCCCAGGGTGTGGGGGG - Intergenic
1027657866 7:80953445-80953467 GCTTGAACCCAGGAGGCGGAGGG + Intergenic
1027752536 7:82168224-82168246 ACTTGAACCTGGGAGGTGGAGGG - Intronic
1028195586 7:87903775-87903797 ACTTGAACCCAGGAGGTGGAGGG - Intronic
1028303624 7:89233719-89233741 ACTTGAACCCAGGAGGCAGAGGG - Intronic
1028472563 7:91220970-91220992 GCTTGAGCCCGGGAGGTGGAGGG - Intergenic
1028726715 7:94096498-94096520 ACTTGAACCTGGGAGGTGGAAGG - Intergenic
1028760740 7:94493663-94493685 TCTTGAATCCAGGAGGTGGAGGG - Intergenic
1028927485 7:96374883-96374905 GCTTGAGCCCAGGAGGTGGAGGG - Intergenic
1029228807 7:99049006-99049028 ACTTGAACCCAGGAGGTGGAGGG + Intronic
1029280312 7:99431210-99431232 ACTTGAACCCAGGAAGTGGAGGG - Intronic
1029288876 7:99486233-99486255 ACTTGAACCCAGGAGGCGGAGGG + Intronic
1029295616 7:99538150-99538172 ACTTGAGCCCAGGAAGTCGAGGG - Intergenic
1029303035 7:99599364-99599386 ACTTGAGCCCAGGGGTTGCCTGG + Intronic
1029304616 7:99609815-99609837 ACTTGAGCCCAGGAGGTCAAGGG - Intergenic
1029351898 7:100019287-100019309 ACTTGAACCTGGGAGGTGGAGGG - Intronic
1029360942 7:100088425-100088447 ACTTGAGCCCAGGAGTTTGAGGG + Intergenic
1029378824 7:100199398-100199420 GTTTCACCCTAGGGGGTGGAAGG - Intronic
1029404251 7:100364869-100364891 ACCTGAGCCCAGGAGGTTGAGGG + Intronic
1029421383 7:100473522-100473544 ACTTGAACCCAGGAGGCAGAGGG - Intronic
1029496692 7:100898921-100898943 GCTTGAACCCAGGAGGTGGAGGG + Intergenic
1029536215 7:101159359-101159381 CCCTGACCCCATGGGGTGGGAGG + Intronic
1029569798 7:101362123-101362145 ACTTGAACTCAGGAGGCGGAGGG - Intergenic
1029660600 7:101958561-101958583 ACTTGAACCTGGGAGGTGGAGGG - Intronic
1029933124 7:104394781-104394803 GCTTGAACCAAGGAGGTGGAGGG - Intronic
1030018675 7:105250250-105250272 ACTTGAACCCAGGAGGCGGAGGG + Intronic
1030071827 7:105704691-105704713 ACTTGAACCCAGGAGGCGGGAGG - Intronic
1030133842 7:106227152-106227174 ACTTGAACCCAGGAGGCGGGAGG + Intergenic
1030205211 7:106945765-106945787 GCTTGAGCCCAGGAGATGGAGGG - Intergenic
1030563010 7:111114651-111114673 GTTTGAACCCAGGAGGTGGAGGG + Intronic
1030568834 7:111195947-111195969 ACTTGAGCCCAGGAGTTCGAGGG - Intronic
1031051319 7:116949107-116949129 CCGTGAGCTCAGGGGGTGGAGGG + Intergenic
1031374759 7:121010332-121010354 GCTTGAACCCAGGATGTGGAGGG - Intronic
1031457482 7:122000767-122000789 GCTTGAACCCAGGAGGTGGAGGG - Intronic
1031508661 7:122620987-122621009 GCTTGAGCCCAGGAGGTTGAGGG - Intronic
1031614987 7:123869768-123869790 GCTTGAACCCAGGAGGTGGGGGG - Intronic
1031897807 7:127372395-127372417 GCTTGAACCCAGGAGGCGGAAGG + Intronic
1032025053 7:128434563-128434585 ACTTGAGCCCAGGAGGTTGAAGG + Intergenic
1032104439 7:129014438-129014460 ACTTGAGCCCAGGAGGAGGAGGG + Intronic
1032136933 7:129288441-129288463 GCTTGAACCCAGAAGGTGGAGGG - Intronic
1032178913 7:129658506-129658528 ACTTGAGCCCAGGTGTTTGAGGG + Intronic
1032229442 7:130061521-130061543 GCATGAACCCAGGAGGTGGAGGG - Intergenic
1032304178 7:130716966-130716988 GCTTGAGCCCAGGAGGTTGAGGG + Intergenic
1032352830 7:131181740-131181762 GCTTGAACCCAGGAGGTGGAGGG - Intronic
1032370976 7:131351542-131351564 ACTTGAGCCCAGGAGGTTCAAGG - Intronic
1032567702 7:132964496-132964518 ACTTGAACCCGGGAGGCGGAAGG + Intronic
1032681681 7:134191096-134191118 ATTTGCCCTCAGGTGGTGGAGGG + Intronic
1032735399 7:134688029-134688051 ACTTGAACCTGGGAGGTGGAGGG - Intergenic
1032736862 7:134700747-134700769 GCTTGAACCCAGGAGGCGGAGGG - Intergenic
1032835169 7:135665982-135666004 GCTTGAACCCAGGAGGCGGAGGG - Intronic
1033065826 7:138153188-138153210 GCTTGAACCCGGGAGGTGGAGGG - Intergenic
1033151902 7:138921780-138921802 GCTTGAACCCAGGAGGCGGAGGG + Intronic
1033170803 7:139082180-139082202 ACTTGAACCCAGGAGGCGGCCGG + Intronic
1033236328 7:139640730-139640752 GCTTGAGCCCAGGAGGTGGAAGG - Intronic
1033284739 7:140031288-140031310 GCTTGAGCCCGGGAGGTGGAAGG + Intronic
1033295096 7:140125647-140125669 ACTTGAGCCCAGGAAGTTGAGGG - Intronic
1033315262 7:140292038-140292060 GCTTGAACCCAGGAGGTGGAGGG - Intergenic
1033389700 7:140914955-140914977 ACTTGAACCCGGGGGGGGGGGGG + Intronic
1034085696 7:148320464-148320486 ACTTGAACCCAGGAGGCGGAGGG - Intronic
1034092456 7:148376435-148376457 ACTTGAGCCCAGGGGTTCAAGGG + Intronic
1034134968 7:148758532-148758554 ACTTGAGCCCAGGAGGTGGAGGG + Intronic
1034148018 7:148889443-148889465 GCTTGAGCCCAGGAGATGGAGGG - Intergenic
1034202075 7:149289066-149289088 ACTTGAACCCGGGAGGCGGAGGG - Intronic
1034716783 7:153250557-153250579 ACTTGAACCTGGGAGGTGGAGGG + Intergenic
1034837870 7:154369449-154369471 GCTTGAACCCAGGAGGCGGAAGG - Intronic
1035015614 7:155763293-155763315 ACGTATCCACAGGGGGTGGAAGG + Intronic
1035017626 7:155780659-155780681 AGTTGAAGCCAGGAGGTGGAGGG - Exonic
1035063070 7:156083774-156083796 ACTTGAACCCAGGAGGCAGAGGG - Intergenic
1035097148 7:156364990-156365012 ACGTGGCCCCAGGGGACGGATGG - Intergenic
1035185361 7:157121923-157121945 ACTCGAACCTAGGAGGTGGAGGG - Intergenic
1035220615 7:157404372-157404394 ACTTGAGCCGAGGGGGTTCAAGG - Intronic
1035343809 7:158184727-158184749 ACTTGAACCCAGGAGGCAGAGGG + Intronic
1035356669 7:158279896-158279918 ACTTGACCCCACGGTGTGCCAGG + Intronic
1036128375 8:6084736-6084758 AATTGAGGCCAGGAGGTGGAGGG + Intergenic
1036441812 8:8788594-8788616 GCTTGAACCCAGGAGGCGGAGGG + Intronic
1036845388 8:12165895-12165917 ACTTGAACCCAGGAGGCAGAAGG + Intergenic
1036958852 8:13221451-13221473 GCTTGAACCCAGGAGTTGGAAGG - Intronic
1037418210 8:18674061-18674083 CCTTGAGCCCAGGAAGTGGAGGG + Intronic
1037843021 8:22258955-22258977 ACATGAACCCAGGAAGTGGAGGG + Intergenic
1037846855 8:22291049-22291071 ACTTGAACCCAAGAGGTAGAGGG - Intronic
1037903134 8:22699880-22699902 ACTTGAACCCAGAAGGTGAAAGG - Intergenic
1037943644 8:22973309-22973331 GCTTGAGCCCAGGAGGTTGAGGG - Intronic
1038108681 8:24467980-24468002 CCTTGAACCCAGGAGGTGGAAGG + Intronic
1038257977 8:25968643-25968665 ACTTGAACCCAGGGGGGTGGAGG - Intronic
1038471669 8:27828669-27828691 ACTTGAGCCCAGGAGGTTAAGGG + Intronic
1038547902 8:28440183-28440205 ACTTGAGCCCAGGAGGTTAAGGG - Intronic
1038601747 8:28951213-28951235 GCTTGAACCCAGGAGGTGGAGGG - Intronic
1038620504 8:29138250-29138272 GCTTGAACCCAGGAGGTGGAGGG + Intronic
1038737872 8:30188781-30188803 GCTTGAGCCCAGGAGGTTGAGGG - Intergenic
1038760014 8:30377325-30377347 ACTTGAGCCCAGGAGTTTGAGGG - Intergenic
1038804219 8:30775830-30775852 GCTTGAACCCAGGAGGCGGAGGG - Intronic
1039043530 8:33429911-33429933 ACTTGAACCCAGGAGGCAGAGGG + Intronic
1039289000 8:36073547-36073569 GCTTGAACCCAGTGGGTGGAGGG + Intergenic
1039852292 8:41379591-41379613 ACTTGAACCCGGGAGGTGGAGGG - Intergenic
1039875574 8:41582090-41582112 ATTTGAGCTCAGGAGGTGGAGGG - Intronic
1039951578 8:42177060-42177082 GCTTGAACCCCGGAGGTGGAGGG - Intronic
1039955464 8:42203880-42203902 ACTTGAGCCCAGGAGTTTGAAGG + Intronic
1040068418 8:43168477-43168499 GCTTGAACCCAGGAGGCGGAGGG - Intronic
1041264805 8:56053923-56053945 ACTTGAACCTGGGAGGTGGAGGG - Intergenic
1041381076 8:57254960-57254982 CCTGGATCCCTGGGGGTGGAGGG - Intergenic
1041438432 8:57867389-57867411 GCTTGAACCCAGGAGGCGGAGGG - Intergenic
1041661797 8:60408009-60408031 ACTTGAACCCAGGAGGAGGAGGG + Intergenic
1041914896 8:63128822-63128844 GCTTGAAGCCAGGAGGTGGAGGG - Intergenic
1041923028 8:63204442-63204464 GCTTGAACCCATGAGGTGGAGGG - Intronic
1042051779 8:64717762-64717784 ACTTGAGCCCAGAAAGTGGAGGG + Intronic
1042264613 8:66895487-66895509 GCTTGAGCCCAGGAGTTGGAGGG - Intronic
1042275367 8:66999301-66999323 TCTTGAACCCAAGAGGTGGAGGG - Intronic
1042548260 8:69970442-69970464 GCTTGAACCCAGGAGGTGGAGGG + Intergenic
1042556918 8:70041483-70041505 ACTTGGACCCAGGAGGTCGAAGG - Intergenic
1042611247 8:70603632-70603654 ACTTGAACCCAGGAGGCGGAGGG + Intronic
1042896220 8:73671295-73671317 GCTTGAACCCAGGAGGCGGAGGG + Intronic
1042921819 8:73927666-73927688 ACTTGAAACCAGGAGGTGGATGG - Intergenic
1043055885 8:75437590-75437612 GCTTGAACCCAGGAGGTGCAGGG + Intronic
1043459225 8:80442610-80442632 ACTTGAACCCAGGAGGTCGAGGG - Intergenic
1043464883 8:80494840-80494862 CCTTGAACCCAGGAGGTTGAGGG + Intronic
1043863722 8:85352164-85352186 ACCTAACCTCAAGGGGTGGATGG + Intronic
1044003773 8:86916951-86916973 ACTAGAACCCAGGAGGTGGAGGG - Intronic
1044036511 8:87310270-87310292 ACTTGACCCCAGGAGGTAGAGGG + Intronic
1044333857 8:90952692-90952714 GCTTGAACCCAGGAGGCGGAGGG + Intronic
1044341278 8:91048994-91049016 ACTTGAACCCAGGGGTAGGGTGG - Intergenic
1044490051 8:92802771-92802793 TCTTGAACCCAGGAGGTGGATGG + Intergenic
1044655968 8:94548972-94548994 ACTTGAGCCCAGGAGTTGGGAGG - Intronic
1044704546 8:94995858-94995880 GCTTGAACCCAGGAGGTGAAGGG - Intronic
1044834104 8:96279051-96279073 GCTTGAGCCCGGGAGGTGGAGGG - Intronic
1044954918 8:97470064-97470086 ACTTGAGCCCAGGAGGTTGAGGG + Intergenic
1045066642 8:98453169-98453191 ACTTGAACCCAGGAGGCAGAAGG - Intronic
1045280156 8:100743120-100743142 ACTTGAACCCAGGAGGCAGAGGG - Intergenic
1045489887 8:102660060-102660082 ACTTGAACCCAGGAGGCGGAGGG - Intergenic
1045610466 8:103835182-103835204 CCTTGAACCCGGGAGGTGGAGGG - Intronic
1045809818 8:106208293-106208315 GCTTGAGCCCAGGAGGTGGAGGG + Intergenic
1046084019 8:109409330-109409352 GCTTGAACCCAGGAGGTGGAGGG - Intronic
1046476770 8:114755690-114755712 ACTTGAGCCAAGGAGGTTGAGGG - Intergenic
1046996695 8:120531621-120531643 GCTTGAACCCAAGAGGTGGAAGG + Intronic
1047337163 8:123947201-123947223 ACTTGAACCTGGGAGGTGGAGGG + Intronic
1047420164 8:124701152-124701174 ACTTGAGCCCAGGAGGTCAAGGG + Intronic
1047442843 8:124894255-124894277 ACTTGAAACCGGGAGGTGGAGGG - Intergenic
1047672683 8:127165584-127165606 ACTTGAACCCAGGAGGAGGAGGG - Intergenic
1047791270 8:128206203-128206225 CCTTGCCACCAGGGAGTGGAGGG - Intergenic
1047857322 8:128925826-128925848 CCTTGAACCCGGGAGGTGGAGGG - Intergenic
1047963364 8:130027091-130027113 ACTTGAACCCAGGAGGCAGAGGG + Intergenic
1048652914 8:136499889-136499911 GCTTGAACCCAGGAGGTCGAGGG + Intergenic
1049082770 8:140456327-140456349 GCTTGAACCCAGGAGGCGGAGGG + Intronic
1049189899 8:141281254-141281276 ACTTGAACCCGGGAGGCGGAGGG + Intronic
1049590159 8:143455229-143455251 ACTTGAACCCAGGAGATGGAGGG + Intronic
1049627247 8:143630429-143630451 GCTTGAACCCGGGAGGTGGAGGG + Intergenic
1049713293 8:144077160-144077182 ACTTGAACCCTGGAGGTGGAGGG + Intergenic
1049863711 8:144919450-144919472 ACTTGAACCCAGGAGGTGGAGGG - Intergenic
1049878814 8:145047006-145047028 GCTTGGACCCAGGAGGTGGAGGG + Intergenic
1049948833 9:624714-624736 ACTTGAACCTGGGAGGTGGAGGG + Intronic
1050312277 9:4365866-4365888 CCTTGACCCTTTGGGGTGGAGGG - Intergenic
1050392664 9:5161994-5162016 ACTTGAGCCCAGGAGGTTGAGGG + Intronic
1050541805 9:6676773-6676795 ACTTGAGCCCAGGAGGTCAAGGG + Intergenic
1050556810 9:6796360-6796382 ACTTGAACCCGGGAGGTGGAGGG + Intronic
1050751956 9:8949139-8949161 GCTTGAACCCGGGAGGTGGAGGG + Intronic
1051246992 9:15122160-15122182 GCTTGAACCCAGGAGGTGGAGGG - Intergenic
1051283476 9:15468035-15468057 GCTTGAACCCAGAAGGTGGAGGG + Intronic
1051471039 9:17442479-17442501 ACTTGAACCCAGAAGGTGCAGGG - Intronic
1051595004 9:18816317-18816339 ACTTGAACCTGGGAGGTGGAAGG - Intronic
1052304625 9:26992608-26992630 ACTTGAACCCAGGAGGCGGAGGG + Intronic
1052683242 9:31721367-31721389 ACTTGAACCCAGAAGGTGGAGGG + Intergenic
1052828103 9:33191962-33191984 ACTTGAACCCGGGAGGTGGAGGG + Intergenic
1052962880 9:34315944-34315966 ACTTGAACCCAGGAGGCAGAGGG + Intronic
1053127024 9:35589968-35589990 ACTTGGACCCAGGTGGCGGAGGG + Intergenic
1054799504 9:69333385-69333407 ACTTGAACCCAGGAGGTAGAGGG - Intronic
1054826089 9:69574997-69575019 ACTTGAGCCCAGGAGGTTGAGGG - Intronic
1054846274 9:69801744-69801766 GCTTGAACCCAAGAGGTGGAAGG + Intergenic
1054881488 9:70149126-70149148 GCTTGAACCCAGGAGGTGGATGG + Intronic
1055092891 9:72380562-72380584 ACTTGAACCCAGGAGGTGGAGGG + Intergenic
1055455121 9:76465063-76465085 ACTTGAGCCCAGGAGTTTGATGG - Intronic
1055498586 9:76881048-76881070 GCTTGAACCCAGGGGGAGGGAGG - Intronic
1055962147 9:81830707-81830729 GCTTGAACTCAGGAGGTGGAGGG + Intergenic
1056090454 9:83200311-83200333 GCTTGAACCCAGGGGGCGGAGGG + Intergenic
1057088037 9:92228629-92228651 ACTTGAGCCCAGGAGGCCGAGGG + Intronic
1057106316 9:92421120-92421142 ACTTGAGCCCAGGAGATGGAGGG - Intronic
1057107205 9:92430876-92430898 ACTTGAACTCAGGAGGCGGAGGG - Intronic
1057298475 9:93862828-93862850 AATTGACCCCAGAGGGTTGCCGG + Intergenic
1057315162 9:93963671-93963693 GCTTGAGCCCAGGAGGTGGGAGG - Intergenic
1057590194 9:96366217-96366239 ACTTGAGCCCAGGAGGTGAAGGG + Intronic
1057665871 9:97045038-97045060 GCTTGAGCCCAGGAGGTTGAGGG + Intergenic
1058017572 9:100052998-100053020 GCTTGAGCCCTGGAGGTGGAGGG - Intronic
1058066738 9:100556927-100556949 ACTTGAACCCAGGAGGTGGAAGG - Intronic
1058686039 9:107480472-107480494 GCTTGAACCCAGGTGGCGGAGGG + Intergenic
1058982086 9:110179381-110179403 ACTTGAACCCAGGAGGTTAAGGG + Intergenic
1059084322 9:111283699-111283721 GCTTGAACCCAGTAGGTGGAGGG + Intergenic
1059153561 9:111970348-111970370 ACTTGAACCAGGGAGGTGGAAGG - Intergenic
1059196050 9:112372156-112372178 ACTTGAGCCCAGGAGCTTGAGGG - Intergenic
1059727730 9:117025872-117025894 ACTTGAACCTGGGAGGTGGAGGG - Intronic
1059830724 9:118092843-118092865 ACTTGAACCCAGGAGGCGGAGGG - Intergenic
1059955938 9:119516086-119516108 GCTTGAACCAAGGAGGTGGAAGG - Intronic
1060036656 9:120261661-120261683 GCTTGCCCTCTGGGGGTGGACGG + Intergenic
1060163593 9:121389648-121389670 ACCTGAGCCCAGGAGGTTGAGGG - Intergenic
1060344785 9:122806537-122806559 ACTTGAGCCCAGGAGTCGGAAGG + Intronic
1060361487 9:122962436-122962458 ACTTGAGCCCAGGAGGTTGATGG + Intronic
1060365923 9:123013412-123013434 ACTTGAACCCAGGAGGCGGAGGG - Intronic
1060515073 9:124260474-124260496 ACTTGAACCCAGGAGGCAGAGGG - Intronic
1060591174 9:124817867-124817889 TCTTGAACCCAGGAGGCGGAGGG - Intergenic
1060598208 9:124860912-124860934 ACTTGAGCCCAGGAGTTGGGAGG - Intronic
1060599120 9:124866319-124866341 ACCTGAACCCTGGAGGTGGAGGG + Intronic
1061073678 9:128327719-128327741 AGTTGAGCCCAGGAGGTCGAGGG + Intronic
1061148180 9:128812782-128812804 GCTTGACCTCGGGAGGTGGACGG - Intergenic
1061238969 9:129358256-129358278 GCTTGAACCCAGGAGGCGGAGGG - Intergenic
1061348692 9:130046683-130046705 GCTTGAACCCAGGAGGCGGAGGG + Intergenic
1061733531 9:132635859-132635881 GCTTGAACCCGGGAGGTGGAGGG + Intronic
1061756748 9:132818763-132818785 ACTTGAGCCCAGGAGTTTGAGGG + Intronic
1062065353 9:134523746-134523768 ACTAGATCCCAGGGGATGGGAGG - Intergenic
1062065407 9:134523946-134523968 ACTGGATCCCAGGGGATGGGAGG - Intergenic
1062065438 9:134524066-134524088 ACTGGATCCCAGGGGATGGGAGG - Intergenic
1062065615 9:134524716-134524738 ACTGGATCCCAGGGGATGGGAGG - Intergenic
1062065630 9:134524776-134524798 ACTGGATCCCAGGGGATGGGAGG - Intergenic
1062209876 9:135357678-135357700 GCTTGAACCCAGGAAGTGGAGGG - Intergenic
1062222043 9:135421768-135421790 ACTTGAACCCAGGAGTCGGAGGG - Intergenic
1062410215 9:136420060-136420082 ACCTGAACCCGGGAGGTGGAAGG - Intronic
1062647137 9:137553822-137553844 ACTTGAACCTGGGAGGTGGAGGG + Intergenic
1203734884 Un_GL000216v2:127190-127212 ACTTGAGCCCAGGAGGTGGAGGG + Intergenic
1185499724 X:587540-587562 GCTTGAACCCAGGGGGTGGAGGG + Intergenic
1185783968 X:2874011-2874033 ACTTGAACCCAGGAGGCAGAAGG + Intronic
1185879889 X:3731597-3731619 ACTTGAACCTGGGGGGCGGAGGG + Intergenic
1186087944 X:6011660-6011682 CCTTGACCCCTGGCGGTGGTAGG - Intronic
1186141438 X:6578583-6578605 ACTTGAGCCCAGGAGGTCGAGGG - Intergenic
1186338807 X:8621281-8621303 ACTTGAACCCAGGAGGTGGAGGG + Intronic
1186409548 X:9334646-9334668 ACTTGAGCCCAGGAGGTTGAGGG + Intergenic
1186512410 X:10139710-10139732 GCTTGAGCCCAGGGGGCAGAGGG - Intronic
1186827570 X:13356368-13356390 GCTTGAACCCGGGAGGTGGAGGG - Intergenic
1186879697 X:13852861-13852883 ACTTGAGCCCAGGAGTTTGAAGG - Intronic
1187127857 X:16470746-16470768 ACTTGATCCCGGGAGGTCGAGGG - Intergenic
1187182216 X:16954034-16954056 GCTTGAGCCCAGGAGGTTGAGGG - Intronic
1187371683 X:18714352-18714374 ACTTGAACCCGGGAGGTGAAGGG - Intronic
1187468482 X:19547067-19547089 ACTTGAGCCCCGGAGGTCGAGGG + Intronic
1187479457 X:19641921-19641943 ACTTGAGCCCAGGAGGTCCAAGG - Intronic
1187718366 X:22126952-22126974 GCTTGAACCCGGGAGGTGGAGGG - Intronic
1187857902 X:23654773-23654795 GCTTGAACCCAGGAGGTGGAGGG + Intergenic
1187883488 X:23867015-23867037 ACTTGAACCCAGGAGGCGGAGGG + Intronic
1187887204 X:23900590-23900612 GCTTGAACCCAGGAGGCGGAGGG + Intronic
1188354426 X:29174001-29174023 CCTTGAACCCAGGAGGTGGAGGG - Intronic
1188924336 X:36021383-36021405 ACTTGAACCCAGGAGGTTGAGGG - Intergenic
1189132717 X:38517304-38517326 GCTTGAACCCAGGAGGTGGAGGG - Intronic
1189278539 X:39804723-39804745 ACTTGAACCCAGGAGATGGGAGG + Intergenic
1189315672 X:40054586-40054608 CCTTGAACCCGGGAGGTGGAGGG - Intronic
1189429077 X:40931416-40931438 GCTTGAACCCAGGAGGTGGAGGG - Intergenic
1189517572 X:41730783-41730805 ACTTGACCCCGGGGGGGTGGAGG - Intronic
1189587911 X:42479599-42479621 ACTTGAAGCCAGGAGGTGGGAGG + Intergenic
1190076102 X:47318251-47318273 ACTTGAACCCAGGAGGAGGAGGG + Intergenic
1190098756 X:47504221-47504243 GCTTGAACCCAGGGGTTGGAGGG - Intergenic
1190273927 X:48888067-48888089 GCTTGAACCCAGGAGGTTGAGGG + Intergenic
1190283952 X:48949768-48949790 ACTTGAGTCCAGGAAGTGGAGGG + Intronic
1190292848 X:49004265-49004287 GCTTGAACCCAAGAGGTGGAGGG + Intergenic
1190467091 X:50735922-50735944 GCTTGAACCCAGGAGATGGAGGG + Intronic
1190572729 X:51800739-51800761 ACTTGAACCCAGGAGGCAGAGGG - Intergenic
1190826146 X:54019703-54019725 GCTTGAACCCAGGAGGCGGAGGG + Intronic
1191700981 X:64042583-64042605 GCTTGAACCCAGGAGGTGGAAGG + Intergenic
1191951701 X:66599970-66599992 TCTAGACCCCAGGGAGAGGAAGG - Intronic
1192481006 X:71486056-71486078 GCTTGAACCCAGGAGGTGGAGGG - Intronic
1192813909 X:74572003-74572025 ACTTGAACCTGGGAGGTGGAGGG - Intergenic
1193131241 X:77921821-77921843 ACTTGAACCCAGGAGGCGGAGGG + Intronic
1193319151 X:80099298-80099320 GCTTGAACCCAGGAGGTGGAGGG + Intergenic
1193908184 X:87268492-87268514 ACTTGAGCCCAGGAGTTTGAGGG + Intergenic
1193980608 X:88177258-88177280 GCTTGAACCCGGGAGGTGGAGGG - Intergenic
1194674381 X:96776291-96776313 ACTTGAACCCAGGAGGCAGAGGG - Intronic
1194762368 X:97809954-97809976 ATTTGAACCCAGGAGGTGGATGG - Intergenic
1195014050 X:100761136-100761158 GCTTGAACCCAGGAGGTGGAGGG + Intergenic
1195071284 X:101282846-101282868 ACTTGAGCCCAGGAGGTCGAGGG - Intronic
1195083751 X:101394869-101394891 ACTTGAACCCGGGAGGTGGGCGG - Intronic
1195084655 X:101402678-101402700 ACTTGAACCCAAGAGGTGGAGGG + Intronic
1195226400 X:102799068-102799090 ACTTGAGCCCAGGAGTTTGAGGG - Intergenic
1195263736 X:103160055-103160077 ACTTGAGCCCAGGAGTTTGAGGG + Intergenic
1195598402 X:106719301-106719323 ACTTGAACCCAGGGTGGGGGAGG - Intronic
1195783544 X:108490796-108490818 ACTTGAGAACAGAGGGTGGAAGG - Intronic
1195953856 X:110307950-110307972 GCTTGAACCCAGGAGGTCGAGGG - Intronic
1195957022 X:110342452-110342474 ACTTGAACCCAGGAGGCGGAGGG - Intronic
1196387247 X:115171767-115171789 ACTTGAGCCCAGGATGTCGAGGG - Intronic
1196631856 X:117950382-117950404 ACTTGAACCTGGGGGGCGGAGGG + Intronic
1196824478 X:119730370-119730392 GCTTGAACCCGGGAGGTGGAGGG + Intergenic
1196833508 X:119794439-119794461 GCTTGAACCCAGGAGGTGGAGGG + Intergenic
1196841637 X:119864745-119864767 ACTTGAACCCAGGAGGCGGAGGG + Intergenic
1196847279 X:119906315-119906337 ACTTGAACCTAGGAGGCGGAGGG - Intronic
1196917123 X:120548749-120548771 GCTTGAACCCAGGAGGTGGAGGG + Intronic
1197192859 X:123667653-123667675 ACTTGAGCCCAGGAGGTAGAAGG + Intronic
1197803569 X:130377433-130377455 ACTTGAACCCGGGAGGCGGAGGG - Intergenic
1198106862 X:133470212-133470234 ACTTGAGCCCAGGAGGTCGAGGG + Intergenic
1198230272 X:134682636-134682658 ACTTGAACTCAGGAGGCGGAGGG - Intronic
1198978647 X:142367341-142367363 ACTTGAACCCAGGAGTCGGAGGG + Intergenic
1199162763 X:144633641-144633663 ACTTGAACCTGGGAGGTGGAGGG + Intergenic
1199591846 X:149475193-149475215 GCTTGAACCTGGGGGGTGGAGGG - Intergenic
1200130076 X:153837312-153837334 ACTTGAGCCCAGAAGGCGGAAGG - Intergenic
1200256967 X:154587759-154587781 ACTTGAACCCAGGAGGTGGAGGG + Intergenic
1200260802 X:154616643-154616665 ACTTGAACCCAGGAGGTGGAGGG - Intergenic
1200781767 Y:7223111-7223133 ACTTGAACCCAGGAGGTTGAGGG - Intergenic
1200789970 Y:7291087-7291109 ACTTGAACCCAGGAGGTGGATGG - Intergenic
1201017539 Y:9621846-9621868 ACTTGAGCCCAGGATTTGGAGGG - Intergenic
1201224920 Y:11809381-11809403 GCTTGAACCCGGGAGGTGGAGGG + Intergenic
1202626150 Y:56861364-56861386 ACTTGAGCCCAGGAGGTGGAGGG - Intergenic