ID: 912921019

View in Genome Browser
Species Human (GRCh38)
Location 1:113867235-113867257
Sequence TAGTTTTAGGGTAAGTTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 556
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 507}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912921019_912921025 5 Left 912921019 1:113867235-113867257 CCCTAAAACTTACCCTAAAACTA 0: 1
1: 0
2: 3
3: 45
4: 507
Right 912921025 1:113867263-113867285 TTTGAGAGACTCAGTGTCATTGG 0: 1
1: 0
2: 1
3: 12
4: 168
912921019_912921026 25 Left 912921019 1:113867235-113867257 CCCTAAAACTTACCCTAAAACTA 0: 1
1: 0
2: 3
3: 45
4: 507
Right 912921026 1:113867283-113867305 TGGATGAAGTAGAACACTATTGG 0: 1
1: 0
2: 0
3: 8
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912921019 Original CRISPR TAGTTTTAGGGTAAGTTTTA GGG (reversed) Intronic
901145547 1:7062319-7062341 TATATTTAGGGTAAATTATAAGG + Intronic
904073526 1:27821147-27821169 TAATTATACGTTAAGTTTTAGGG - Intronic
905189157 1:36219929-36219951 TAGATTTAGCGTAATTCTTAAGG - Intergenic
905398597 1:37685076-37685098 TCGTTCTAGGGTAAGATTTGGGG - Intronic
905852079 1:41281951-41281973 TAGGGTTAGGGTTAGGTTTAGGG - Intergenic
906269726 1:44466842-44466864 TAGATTTAGCATAATTTTTAAGG + Intronic
906467219 1:46093026-46093048 TAAATTTAGGGTAAGATTTTTGG - Intronic
906582079 1:46944154-46944176 TAATTTTTGTGTAAGGTTTAAGG - Intergenic
907029919 1:51160789-51160811 TAGTTTTATGGTAGATTTTGAGG - Intergenic
907944959 1:59127492-59127514 GAGTTTTTGGGGGAGTTTTAGGG + Intergenic
908333196 1:63092265-63092287 TAGATTTAGTGTAATTCTTAAGG + Intergenic
909654625 1:78017522-78017544 TATTTTAAGGGTAAACTTTATGG - Exonic
909814985 1:79981335-79981357 AAATTTTAGGGACAGTTTTATGG - Intergenic
910618436 1:89226366-89226388 TAATTTTAGTATAAGTTGTAAGG + Intergenic
911036369 1:93553519-93553541 TGGTTTTATGAGAAGTTTTATGG + Exonic
911112110 1:94199967-94199989 TAATTTTTGTGTAAGGTTTAAGG - Intronic
911876789 1:103175630-103175652 TAGTTTGAGGGAAATTTTTGTGG + Intergenic
912365553 1:109130800-109130822 AAGTTTTAGGGTAATTTGTTAGG - Intronic
912921019 1:113867235-113867257 TAGTTTTAGGGTAAGTTTTAGGG - Intronic
913368398 1:118068836-118068858 TAGCTTGAGGCTAAGCTTTAGGG - Intronic
913399080 1:118408092-118408114 TAATTTTTGTGTAAGGTTTAAGG - Intergenic
914456353 1:147840800-147840822 TAGTTCCAGAGTCAGTTTTAGGG - Intergenic
914931700 1:151940169-151940191 TATTTTAAGGGTAAACTTTATGG + Intergenic
915183727 1:154085712-154085734 TAGTTTTGTAGTAAGTTTTGAGG - Intronic
915644489 1:157258877-157258899 TAATTTTTGTGTAAGGTTTAAGG - Intergenic
915704161 1:157827778-157827800 TAGTTTCAGGGAAAGTGTTAAGG + Intergenic
916762833 1:167832725-167832747 TCGTTGTAAGGTAAGTTCTAGGG - Intronic
917115431 1:171598557-171598579 TAGATTTAGCTTAATTTTTAAGG - Intergenic
917312361 1:173690810-173690832 TGGTTTTGGGGTAAGGTTCAAGG + Intergenic
917602206 1:176587456-176587478 TAATTTTTGTGTAAGTTGTAAGG + Intronic
917932249 1:179830766-179830788 GGGTTTTGGGGCAAGTTTTATGG + Intergenic
918123830 1:181565006-181565028 TAGATTTAGCATAATTTTTAAGG + Intronic
918776468 1:188637652-188637674 TAATTATAGTTTAAGTTTTAGGG - Intergenic
919158935 1:193803598-193803620 TAATTTTAGTATAAGGTTTAAGG - Intergenic
919469783 1:197964100-197964122 TAGTTTTAGGCCATATTTTAAGG + Intergenic
920846999 1:209602364-209602386 TATTTTTAGGGTTAGTTCTGTGG - Intronic
920944285 1:210514022-210514044 TGATTTTTGGGTAAGTGTTATGG + Intronic
921500034 1:215890561-215890583 TGGTTTTAGGGTTTTTTTTAGGG - Intronic
922858758 1:228797431-228797453 AAATTATAGGGTAATTTTTAAGG + Intergenic
922948045 1:229533759-229533781 TAGTTTTTGGGAAAGGTGTAAGG - Intronic
923957156 1:239035278-239035300 GAGTGTGAGGGTAAATTTTATGG - Intergenic
924770444 1:247075228-247075250 GAGTTTAATGCTAAGTTTTATGG - Intronic
924863703 1:247954959-247954981 TATTTTTACTTTAAGTTTTAGGG + Intronic
1062765833 10:64334-64356 TAGGGTTAGGGTAAGGGTTAGGG - Intergenic
1062995682 10:1864366-1864388 TAGATTTAGCATAATTTTTAAGG - Intergenic
1063218356 10:3944011-3944033 TAGGTTTAGGGTTAGGGTTAGGG - Intergenic
1063218360 10:3944023-3944045 TAGGGTTAGGGTTAGGTTTAGGG - Intergenic
1063738079 10:8784637-8784659 TATTTGTAGGGTAAATTCTAAGG + Intergenic
1064958055 10:20933360-20933382 TAGTGTACGGGTAAGTTTTGAGG - Intronic
1065157947 10:22889922-22889944 TAATTTTAGTATAAGTTGTAAGG - Intergenic
1066089964 10:32007723-32007745 TATTTGTTGGGTATGTTTTAAGG + Intergenic
1067856585 10:49798922-49798944 TAGTTTTAGGGAGAGTTTCATGG + Intergenic
1069229113 10:65985206-65985228 TAGTATTAGGGAAAGGTTTTTGG - Intronic
1069481062 10:68782688-68782710 TAGGTTTAGCATAATTTTTAAGG - Intronic
1070302733 10:75216376-75216398 TAGGGTTAGGGAAAGTTTTATGG + Intronic
1070420725 10:76234383-76234405 TAGATTTAGCGTAATTCTTAAGG + Intronic
1071163244 10:82777246-82777268 TAGTGGCAGGGTAAGTTGTATGG + Intronic
1071283664 10:84125224-84125246 TGGTTTTGGGGTAAGGTTCAAGG + Intergenic
1071410296 10:85384934-85384956 TATTTTTATTGTAAGTTCTATGG - Intergenic
1072566172 10:96618446-96618468 TAGTTTGAGGATAAGGTTAAGGG - Intronic
1072774601 10:98178231-98178253 TAGTTTTTGTATAAGTTGTAAGG + Intronic
1073687326 10:105769666-105769688 TGGTTTGTGGGTAAGCTTTAAGG + Intergenic
1073781134 10:106839814-106839836 TAGATTTAGGATAATTCTTATGG - Intronic
1074094520 10:110298456-110298478 TAGCTTTAGATTAAGTTTTGGGG - Intronic
1075841048 10:125503780-125503802 TAGTTTTTAGGTAAGATATAGGG - Intergenic
1076961462 10:133765426-133765448 TAGGTTTAGGGTTAGGGTTAGGG + Intergenic
1076961472 10:133765463-133765485 TAGGCTTAGGGTAAGGCTTAGGG + Intergenic
1076961503 10:133765580-133765602 TAGGTTTAGGGTTAGGGTTAGGG + Intergenic
1076976217 11:175355-175377 TAGGTTTAGGGTTAGGGTTAGGG - Intronic
1076976269 11:175512-175534 TAGGGTTAGGGTTAGTGTTAGGG - Intronic
1076976333 11:175720-175742 TAGGGTTAGGGTTAGTGTTAGGG - Intronic
1076976365 11:175824-175846 TAGGGTTAGGGTTAGTGTTAGGG - Intronic
1076976391 11:175925-175947 TAGGATTAGGGTAAGGGTTAGGG - Intronic
1077598519 11:3555838-3555860 TAGTCTTAGGGCAAGTTTGATGG - Intergenic
1077763757 11:5134442-5134464 TATTTTTTGGATAAGTTTTATGG - Intergenic
1080754297 11:35180677-35180699 TAGTTTTAGTGTAATTTATGTGG - Intronic
1082925376 11:58540086-58540108 TAGGTTTAGGTTCAGTTTTCGGG - Intronic
1083062380 11:59887463-59887485 TAGTTTTTGTGTAAGGTGTAAGG + Intergenic
1083165759 11:60886033-60886055 TAATTTTTGTGTAAGGTTTAAGG - Intergenic
1084254600 11:67931710-67931732 TAGTCTTAGGGCAAGTTTGATGG - Intergenic
1084280831 11:68091496-68091518 TAGTATTTGTGTTAGTTTTAGGG - Intronic
1084818272 11:71664177-71664199 TAGTCTTAGAGCAAGTTTGATGG + Intergenic
1085633177 11:78136659-78136681 TAGATTTAGCATAAGTCTTAAGG + Intronic
1085915856 11:80886885-80886907 TAGGGTTAGGGTTAGTGTTAGGG - Intergenic
1085982878 11:81745104-81745126 TAGTTCTACAGTAAGTTTTAAGG + Intergenic
1086440070 11:86820401-86820423 TAGTTTGAGGATAAGGTTAAGGG + Intronic
1087287853 11:96285304-96285326 TACTTTTTGTGTAAGTTTGAAGG - Intronic
1089727189 11:120492678-120492700 TAGTTTTATGAAAAGTTTTGGGG + Intergenic
1091470781 12:724929-724951 TAATTTTATGGTTAATTTTATGG + Intergenic
1091536080 12:1411019-1411041 TATTTTTAGGGATAGTTTGAGGG - Intronic
1091816369 12:3441797-3441819 TAGTTTAAGGGTGAATTTTGGGG - Intronic
1092424671 12:8365191-8365213 TAGTCTTAGGGCAAGTTTGATGG - Intergenic
1092564498 12:9649832-9649854 GAGATTTGGGGGAAGTTTTAAGG + Intergenic
1093517098 12:20001049-20001071 TAGTTTTGGGCTAAGTCATAAGG + Intergenic
1093541278 12:20288492-20288514 TAGATTTAGGATACTTTTTAAGG - Intergenic
1094274472 12:28655641-28655663 TAATTTTTGGATAAGGTTTAAGG + Intergenic
1095041826 12:37450830-37450852 TAATTTTACTTTAAGTTTTAGGG - Intergenic
1095657901 12:44692222-44692244 TAGTTTTAGCATAATTCTTAAGG - Intronic
1096568708 12:52504747-52504769 AAATTTTAAGGTATGTTTTATGG + Intergenic
1098585552 12:72150409-72150431 TAATTTTACTTTAAGTTTTAGGG + Intronic
1098657082 12:73045673-73045695 TAGCTTTAGGGAAGGTTTCAGGG + Intergenic
1098680290 12:73345567-73345589 TAATTTTTGGATAAGTTATAAGG + Intergenic
1099223758 12:79944198-79944220 TAATTTTTGTGTAAGTTGTAAGG + Intergenic
1099271939 12:80521529-80521551 TAATTTTTGTGTAAGTTGTAAGG + Intronic
1099938391 12:89155604-89155626 TTATTTTAGGGTAAGTGTTGAGG - Intergenic
1100222505 12:92521010-92521032 TCTTTTTAAGGTAAGTTTGATGG - Intergenic
1100257606 12:92900364-92900386 TAGATTTTGGGAAAGTTTAAAGG - Intronic
1100951532 12:99855534-99855556 TTGTTTTAGGGTATAGTTTAAGG - Intronic
1102742607 12:115221629-115221651 GAGGTTTAGGGTAAGTTCTGAGG + Intergenic
1106596804 13:31149582-31149604 TTGATTTAGGGGAAGTTTTCAGG - Intronic
1106612857 13:31300181-31300203 TAGTTCCAGAGTCAGTTTTAGGG + Intronic
1106810593 13:33354679-33354701 TAGTCTAAGTGTAAATTTTAAGG + Intergenic
1107244843 13:38281144-38281166 TAATTTTTGTGTAAGTTGTAAGG - Intergenic
1107432293 13:40351141-40351163 TAATTTTAGGCAAAGTTTTCAGG - Intergenic
1108371071 13:49769308-49769330 TCCTTTTAGGATAAATTTTATGG - Intronic
1108909202 13:55521712-55521734 TAGGTTTAGAATAATTTTTAAGG + Intergenic
1108968362 13:56340924-56340946 AAGTTTTAGAATAGGTTTTATGG - Intergenic
1109016059 13:57015757-57015779 TAATTTTTGTGTAAGTTGTAAGG - Intergenic
1109445577 13:62435669-62435691 TAATTTTAGTTTAAGTTTTGTGG + Intergenic
1109554301 13:63951399-63951421 TACTTTAAGTTTAAGTTTTAGGG + Intergenic
1110085492 13:71373940-71373962 TAATTTTAGAGTAATTTTTAAGG - Intergenic
1110291905 13:73817398-73817420 AAATTTTAGGGTTAGTTGTAGGG + Intronic
1111033550 13:82639364-82639386 TAGATTTAGTGTAATTCTTAAGG + Intergenic
1111374725 13:87363900-87363922 TAATTTTTGTGTAAGTTGTAAGG + Intergenic
1111530668 13:89533398-89533420 TAGATTTAGAGTAATTCTTAAGG + Intergenic
1111863210 13:93734978-93735000 AAGTTATAAGGTAAGATTTAAGG - Intronic
1112643112 13:101299452-101299474 TTGTTTTTGGGTAAGCTTTCAGG + Intronic
1112998288 13:105600772-105600794 TGGTTGAAGTGTAAGTTTTATGG - Intergenic
1113054538 13:106254059-106254081 TAGTTATAGGGTAAGGAATATGG + Intergenic
1113492306 13:110702130-110702152 GAGTTTTAAGGTAACTTTTATGG - Intronic
1114591915 14:23873670-23873692 TAGATTTAGGGTAGTTCTTAAGG + Intergenic
1114980765 14:28160526-28160548 AATTTTTAAGGTAAGTTCTAAGG - Intergenic
1116112663 14:40606619-40606641 TAATTTTTGTGTAAGTTGTAAGG - Intergenic
1116193867 14:41696612-41696634 TAGTTCTAAGGTTAGTTTTTGGG + Intronic
1116499350 14:45601555-45601577 TAGATTTAGGTTAATTTTTAAGG + Intergenic
1116547021 14:46181405-46181427 TAGTTTTTGTGTAAGGTGTAAGG - Intergenic
1117263363 14:54059975-54059997 TAGATTTAGCGTAATTCTTAAGG + Intergenic
1118273830 14:64367626-64367648 TAGTTTGAGTCTAAGTTTGAAGG + Intergenic
1119092106 14:71793414-71793436 TATTTTTAGTGTATCTTTTAGGG + Intergenic
1119157491 14:72424282-72424304 TAGTTTGGGGGTAAGTTTTCTGG + Intronic
1119464938 14:74849537-74849559 TAGTTTAAAGCTAAGTTTTATGG + Intronic
1120031984 14:79652136-79652158 TAACTTTTGTGTAAGTTTTAAGG + Intronic
1123626739 15:22232433-22232455 TAGTGTTAGGGTTAGGATTAGGG - Intergenic
1123626816 15:22232836-22232858 TAGATTTAGGGTTAGTGTTAGGG - Intergenic
1124188255 15:27548775-27548797 TAGTCTTAGGGTAACTTTCAAGG + Intergenic
1124907546 15:33885450-33885472 TTGTTTTAGGGTAAATATTGAGG - Intronic
1124923809 15:34051062-34051084 CAGTTTTAGAGTAAGTTCTGTGG - Intronic
1126874318 15:53023194-53023216 TAGTTTTATGGTATGCTTTGTGG - Intergenic
1128053922 15:64685718-64685740 GAGTTTTAGGGGTAGTTTTCCGG - Exonic
1129821613 15:78605950-78605972 TACTTTTAGGGCAAGTTCTTGGG - Intronic
1130797857 15:87229803-87229825 TAATTATACGTTAAGTTTTAGGG + Intergenic
1131565480 15:93481633-93481655 TAATTTTACTTTAAGTTTTAGGG + Intergenic
1131694420 15:94860492-94860514 TAATTTTACTTTAAGTTTTAGGG + Intergenic
1131878935 15:96841899-96841921 TAGATTTAGCATAACTTTTAAGG - Intergenic
1132984172 16:2755414-2755436 TAGATTTAGGGCAAGGTATATGG + Intronic
1133373578 16:5264841-5264863 TAGTCTTAGGGCAAGTTTGATGG + Intergenic
1134478894 16:14600627-14600649 CAGTGTTGGGGTTAGTTTTAAGG - Intronic
1134565836 16:15251278-15251300 TATTTTTAAAGTAACTTTTATGG - Intergenic
1134736659 16:16505420-16505442 TATTTTTAAAGTAACTTTTATGG + Intergenic
1134896184 16:17888990-17889012 TAATTTAATGGTAACTTTTAGGG - Intergenic
1134930858 16:18206748-18206770 TATTTTTAAAGTAACTTTTATGG - Intergenic
1135223350 16:20633972-20633994 TAGTTTTGTAGTAAGTTTTGAGG - Intronic
1136025681 16:27467273-27467295 TAGATTTAGCGTAATTCTTAAGG - Intronic
1136502316 16:30678274-30678296 TGGTTTTAGGGGAAGAGTTAGGG - Intergenic
1137308202 16:47226383-47226405 TATTTTTATATTAAGTTTTAGGG + Intronic
1137367380 16:47872533-47872555 GAGTTTCAGGGAAGGTTTTACGG + Intergenic
1138178141 16:54921981-54922003 TACTTTTAAAGTAAGTTTAAAGG + Intergenic
1141977152 16:87524487-87524509 TAGGCTTAGGGTTAGTGTTAGGG + Intergenic
1141977167 16:87524569-87524591 TAGATTTAGGGTTAGTGTTAGGG + Intergenic
1144468350 17:15515255-15515277 TAATTTTAGGTTAAGTTCCAGGG - Intronic
1144619289 17:16806349-16806371 TAGTTTGATGGAAACTTTTAGGG - Intergenic
1144893405 17:18509325-18509347 TAGTTTGATGGAAACTTTTAGGG + Intergenic
1145138821 17:20434949-20434971 TAGTTTGATGGAAACTTTTAGGG - Intergenic
1146115451 17:30133537-30133559 TAGATTTAGCATAATTTTTAAGG + Intronic
1146838247 17:36129984-36130006 TAGATTTAGGATAATTCTTAAGG - Intergenic
1148162861 17:45461553-45461575 TAGTTTTTGTGTAAGGTGTAAGG + Intronic
1148658702 17:49309605-49309627 TAGTTCTAGTGTCATTTTTAGGG - Intronic
1149219445 17:54399087-54399109 TAGATTTAGCATAATTTTTAAGG - Intergenic
1150394091 17:64808207-64808229 TAGTTTTTGTGTAAGGTGTAAGG + Intergenic
1150459462 17:65335884-65335906 TAGCTTTACAGTAAGTTTTGAGG - Intergenic
1150530341 17:65974498-65974520 TAGATTCAGGGTAACTTTTTAGG - Intronic
1151090761 17:71437809-71437831 TAGTTTTACTGTAAATTTTCTGG + Intergenic
1152958639 18:63695-63717 TAGTGTTAGGGTTAGGGTTAGGG - Intronic
1152958710 18:63936-63958 TAGGGTTAGGGTAAGGGTTAAGG - Intronic
1152963386 18:94586-94608 TAGGGTTAGGGTTAGCTTTAGGG - Intergenic
1152963393 18:94611-94633 TAGGGTTAGGGTTAGTTTTAGGG - Intergenic
1152963402 18:94643-94665 TAGGGTTAAGGTTAGTTTTAGGG - Intergenic
1152964786 18:105224-105246 TAGGTTTAGGGTTAGGGTTAGGG - Intergenic
1152964790 18:105236-105258 TAGGGTTAGGGTTAGGTTTAGGG - Intergenic
1152964808 18:105295-105317 TAGGGTTAGGGTTAGGTTTAGGG - Intergenic
1152964811 18:105307-105329 TAGGTTTAGGGTTAGGGTTAGGG - Intergenic
1152964834 18:105381-105403 TAGGTTTAGGGTTAGGGTTATGG - Intergenic
1152964865 18:105504-105526 TAGGCTTAGGGTAAGGCTTAGGG - Intergenic
1152964875 18:105541-105563 TAGGTTTAGGGTTAGGGTTAGGG - Intergenic
1153102063 18:1483709-1483731 TAGATTTAGGGCAGCTTTTATGG - Intergenic
1153826786 18:8882411-8882433 TGGTTTTGGGGTAAGGTTCAAGG + Intergenic
1154074376 18:11185006-11185028 TAGTTTTATGGTTGGTGTTAAGG - Intergenic
1154139903 18:11814019-11814041 TAGTTTTTGGGTATGGTGTAAGG - Intronic
1154262420 18:12848097-12848119 TAGATTTAAGTTAAATTTTATGG - Intronic
1154350388 18:13578340-13578362 TAGTTTTAGGGAAAATTTCAAGG - Intronic
1155724105 18:29057597-29057619 GAGTTCTAGGGTAGGATTTATGG - Intergenic
1156277248 18:35595054-35595076 CAGTGTGAGGGTAAGTTTTTTGG + Intronic
1156280948 18:35637892-35637914 TAGATTTAGTGTAATTCTTAAGG - Intronic
1156291549 18:35752391-35752413 TAGCTTTAGGTTTAGTTTTGGGG + Intergenic
1156607434 18:38682410-38682432 TAATTTTTGGGTAAGGTATAAGG - Intergenic
1156632912 18:38992072-38992094 TAGATTTAGAGTTAGGTTTAGGG - Intergenic
1156706911 18:39893776-39893798 AAGTTTTGGGGTGATTTTTAAGG + Intergenic
1158977760 18:62727719-62727741 TAAGTTTAGGGTAGGTATTAGGG + Intronic
1159126203 18:64227549-64227571 TAGTTTTTGTGTAAGGTGTAAGG + Intergenic
1159129711 18:64267224-64267246 TAGTTTTTGTGTAAGGTGTAAGG + Intergenic
1159239270 18:65720061-65720083 TACTTTTAGTGTAATCTTTAGGG - Intergenic
1159377052 18:67605693-67605715 TATTTTTATTATAAGTTTTAGGG - Intergenic
1159866774 18:73715026-73715048 GAGTTTTAGGTTAAATTTTCTGG - Intergenic
1162268587 19:9595973-9595995 TGGTTTTGGGGTAAGGTTCAAGG + Intergenic
1163092288 19:15028936-15028958 TATTTTAAGGGGAAGTTGTAGGG - Intergenic
1163940430 19:20487398-20487420 TAGTTTTTGTGTAAGGTGTAAGG - Intergenic
1164471377 19:28537606-28537628 TAGTTTTAGGCTACATTTCAAGG - Intergenic
1164484847 19:28646425-28646447 TGGTTTGAGGTTAAGTATTATGG + Intergenic
1164888227 19:31801376-31801398 AAGCTTTAGGTTAATTTTTACGG - Intergenic
1166403140 19:42498820-42498842 TAGTCTTAGGCTAGGTTTTAGGG + Intergenic
1166417758 19:42609199-42609221 TAGTTGTAGGTTAAGGGTTAAGG + Intronic
1167914297 19:52727543-52727565 TTGTGTTAGGGTTAGTGTTAGGG - Intronic
1167964662 19:53133178-53133200 TTGTTTTTTGGTAACTTTTATGG - Intronic
1168214334 19:54914222-54914244 TTTTTTTAATGTAAGTTTTAGGG + Intronic
927349904 2:22097973-22097995 TAGTTTTTGTGTATGGTTTAAGG - Intergenic
927573183 2:24177699-24177721 TAGTTTTAGTGTAAATCTTGAGG - Intronic
928461161 2:31474133-31474155 TAGGTTTAGATTATGTTTTAAGG - Intergenic
928743355 2:34382412-34382434 TAGTTTTGGGGAAACTTTGAAGG - Intergenic
928818961 2:35337219-35337241 TAGATTTAGTGTAACTATTAAGG - Intergenic
928852138 2:35761078-35761100 TAGATTTAGCGTAATTATTAAGG - Intergenic
928860311 2:35849457-35849479 TAATTTTTGTGTAAGTTGTAAGG - Intergenic
928889817 2:36190771-36190793 TACACTTGGGGTAAGTTTTATGG + Intergenic
929328690 2:40651504-40651526 TTTTTTTAGGGTAAGTTGCATGG - Intergenic
929339066 2:40790698-40790720 TAATTTTTGCGTAAGGTTTAAGG - Intergenic
930616749 2:53601955-53601977 TGATTTTAGGGGAGGTTTTAAGG - Intronic
932527474 2:72486625-72486647 TAGTGGTTGGGTAAGTATTATGG - Intronic
933343570 2:81053295-81053317 TTGATTTAAAGTAAGTTTTATGG + Intergenic
933630245 2:84647558-84647580 TAGATTTAGTGTAATTCTTAAGG - Intronic
935848223 2:107189387-107189409 TAATTTTTGTGTAAGGTTTAAGG - Intergenic
936569560 2:113602828-113602850 TAGGGTTAGGGTAAGGGTTAAGG + Intergenic
936569631 2:113603014-113603036 TAGGGTTAGGGTAAGGGTTAAGG - Intergenic
936877007 2:117202099-117202121 TAGATTTAGGATCAATTTTATGG - Intergenic
938045958 2:128120486-128120508 TACTTTTTGGCTAAGTTTTATGG + Intronic
939821653 2:146964690-146964712 TTGTTTTGTGGTAAGTTTTGTGG - Intergenic
939964361 2:148596003-148596025 AAGTTTTATGCTAATTTTTATGG - Intergenic
940576605 2:155514425-155514447 TAGTTTTGGTGTGAGTTTTGTGG - Intergenic
940594638 2:155774516-155774538 TAGCTTTACAGTAAGTTTTAAGG + Intergenic
940815528 2:158293573-158293595 TTGTTTCAGGGAAAATTTTAGGG - Intronic
942852986 2:180512548-180512570 TAGTTTTTGGGGAGGTTTGAGGG - Intergenic
943432024 2:187815935-187815957 TAGTTATAGGGTAAGGCATACGG + Intergenic
944856098 2:203768803-203768825 TAATTTTACTTTAAGTTTTAGGG + Intergenic
945074007 2:206018971-206018993 TAGATATAAGGTAAGTGTTAAGG - Intronic
945646861 2:212507076-212507098 TAGATTTAGGATAATTATTAAGG - Intronic
946718448 2:222578505-222578527 TAGTTTCAGAGTAAGATTTCAGG + Intronic
947556705 2:231099604-231099626 TGGTTTTGGGGTAAGGTTCAAGG + Intronic
948833678 2:240613671-240613693 TAGTGTTATGGTTAGGTTTAGGG - Intronic
948833769 2:240614111-240614133 TAGTGTTAGGGTTAGGCTTAGGG - Intronic
1170144504 20:13158043-13158065 TTGTTTAAGTGTATGTTTTATGG - Intronic
1170287371 20:14725021-14725043 TAGTTTCAGAGTATGTTTTGGGG + Intronic
1171383064 20:24747777-24747799 TATTTTTAGGGGGAGGTTTAGGG - Intergenic
1172385336 20:34530167-34530189 TGGCTTTAGGGGCAGTTTTAAGG - Intronic
1174693036 20:52528457-52528479 TAATTTTTGGTTAAGTTTAATGG - Intergenic
1177126777 21:17203967-17203989 TAATTTTTGTGTAAGGTTTAAGG - Intergenic
1177139991 21:17347452-17347474 CACTTTAAGAGTAAGTTTTAAGG + Intergenic
1178011957 21:28297822-28297844 TACTTTGAGTGTAGGTTTTATGG - Intergenic
1179965082 21:44799185-44799207 TAGATTTAGCATAATTTTTAAGG + Intronic
1180031765 21:45214777-45214799 TAGTTTTATTATAAGTTTTGAGG + Intronic
1180184836 21:46134389-46134411 CAGATTTAGGGTCAGGTTTAGGG + Intergenic
1181176533 22:21040371-21040393 GAGATCTAGGGTAATTTTTATGG - Intergenic
1182083851 22:27548034-27548056 TAGTTTTAGAGTTAGATTGATGG - Intergenic
1182914984 22:34021256-34021278 GATTTTTAGGGTAAAATTTATGG - Intergenic
949174470 3:1042764-1042786 TGGTTATAGGGTAAATTTTGTGG + Intergenic
949174541 3:1043779-1043801 TGGTTTTAAGGTAAATTTTGTGG + Intergenic
950751930 3:15136011-15136033 TAGTCTTAGGGCAAGTTTGATGG + Intergenic
950846853 3:16023240-16023262 TGGTTTTGGGGTAAGGTTCAAGG + Intergenic
950992868 3:17459570-17459592 TATTTTTATGGAGAGTTTTAAGG + Intronic
951451191 3:22840620-22840642 TATTTTTTGGGGCAGTTTTAGGG - Intergenic
952440639 3:33324469-33324491 TAATTTTAGTGTAAGGTATAAGG + Intronic
952666210 3:35907383-35907405 TAGTGTTAGGGTTAGTGTTTGGG + Intergenic
955811277 3:62792919-62792941 TAGTTTTGGGAGAAGGTTTAAGG + Intronic
957036723 3:75300314-75300336 CAGTATTAGGGGAAGTTATAAGG + Intergenic
957068678 3:75548293-75548315 TAGTCTTAGGGCAAGTTTGATGG - Intergenic
957641048 3:82854094-82854116 TTGCTTTAGGATAATTTTTAGGG - Intergenic
957955658 3:87183799-87183821 TAGATTTAGGATAAGTTTTAAGG + Intergenic
958552077 3:95628220-95628242 TAGTTTTAGGGGAAACTTAATGG + Intergenic
958573588 3:95918262-95918284 TATTTTTAAGACAAGTTTTAAGG + Intergenic
959550301 3:107648277-107648299 AAGTTTTAGGAAAAGTTGTAAGG - Intronic
959737304 3:109674511-109674533 TATTTTTATTTTAAGTTTTAGGG - Intergenic
960833287 3:121874963-121874985 AACTTTTAGGGAAACTTTTAGGG + Intronic
960833294 3:121875029-121875051 AACTTTTAGGGAAACTTTTAGGG + Intronic
961010848 3:123434830-123434852 TAGGGTTAGGGTTAGGTTTAGGG - Intronic
961080469 3:124022779-124022801 CAGTATTAGGGGAAGTTATAAGG + Intergenic
961284733 3:125792027-125792049 TAGTCTTAGGGCAGGTTTGATGG + Intergenic
961396218 3:126593040-126593062 TAGATTTAGCATAATTTTTAAGG + Intronic
961573146 3:127815006-127815028 GAGTTTAAGAGTAAATTTTATGG + Intronic
962621594 3:137185716-137185738 TTTTATTAGGGTAAGTTTTCTGG + Intergenic
962757315 3:138475440-138475462 TACTTTTAGGTTTATTTTTAGGG - Intronic
962759905 3:138501302-138501324 TATACTTAGGGTAAATTTTATGG - Intronic
963278833 3:143360621-143360643 TAGTTTTTGGAAAACTTTTAGGG + Intronic
963481055 3:145875211-145875233 TAGTTTTTGTGTAAGGTGTAAGG + Intergenic
963967878 3:151393536-151393558 TAATTTTAGGGTAAATCTTTTGG + Intronic
965005449 3:163017116-163017138 TAGATTTAGCATAATTTTTAAGG - Intergenic
965284098 3:166794872-166794894 TAATTTTACTTTAAGTTTTAGGG + Intergenic
966021632 3:175219225-175219247 TAGTTTTAGTTTGAGTTTTATGG + Intronic
966041090 3:175489112-175489134 TAGTTTTATTTGAAGTTTTAGGG - Intronic
966106274 3:176338704-176338726 CAGTTTTAGGTTAAGTTTTTTGG + Intergenic
967187228 3:186954997-186955019 TAATTTTTGGGTAAGGTATAAGG + Intronic
968364316 3:198173277-198173299 TAGGGTTAGGGTAAGGATTAGGG + Intergenic
968364686 3:198174498-198174520 TAGGATTAGGGTTAGGTTTAGGG + Intergenic
968456958 4:705060-705082 TAGGGTTAGGGTTGGTTTTACGG - Intergenic
968457038 4:705335-705357 TAGGTTTAGGGTCAGGGTTAGGG - Intergenic
969013011 4:4082834-4082856 TAGTCTTAGGGCAAGTTTGATGG - Intergenic
969740837 4:9024960-9024982 TAGTCTTAGGGCAAGTTTGATGG + Intergenic
969747533 4:9085497-9085519 TAATTTTTGTGTAAGTTGTAAGG - Intergenic
969800175 4:9557791-9557813 TAGTCTTAGGGCAAGTTTGATGG + Intergenic
971238731 4:24868317-24868339 TGGTTTTAGGGTAGGTGGTAAGG - Intronic
971450939 4:26801174-26801196 TAATTTTAGTGTAAGGTGTAAGG + Intergenic
971506822 4:27375700-27375722 TAGTTATACTTTAAGTTTTAGGG + Intergenic
971535754 4:27748853-27748875 TAATTCTAGTGTAAGTTTTCTGG + Intergenic
971603610 4:28628226-28628248 AAGTTTTAAGAAAAGTTTTAAGG - Intergenic
971756575 4:30716595-30716617 TAAGTTTAGGGTAAGATTTCTGG + Intergenic
971810415 4:31418246-31418268 TGTTTTTAGGGTAAGCTTCAAGG - Intergenic
971894271 4:32571199-32571221 TAATTTTTGAGAAAGTTTTATGG - Intergenic
972691799 4:41406293-41406315 TAGAATTTGGGTATGTTTTATGG + Intronic
974498793 4:62669593-62669615 TGGTTTTAGGGTAACATTCAAGG - Intergenic
974504515 4:62751119-62751141 TAGCTTCAGGGTAATTTTTCTGG - Intergenic
974655767 4:64818969-64818991 TAGCTTTGTAGTAAGTTTTAAGG + Intergenic
974927282 4:68315670-68315692 TAGTTTTAGTTTGAGTTTTCTGG - Intronic
975780258 4:77831811-77831833 TAGCTTTAATGTAAATTTTATGG + Intergenic
976066194 4:81190416-81190438 TACTTTTTGTATAAGTTTTAAGG - Intronic
976432728 4:84981844-84981866 TAGTTTTAGTATAAGGTGTAAGG + Intergenic
977158431 4:93603760-93603782 TAGATTTAGCATAATTTTTAAGG - Intronic
977952000 4:102982061-102982083 TAATTTTGTGGAAAGTTTTAAGG + Intronic
978523399 4:109639779-109639801 TAGCTTTAGTGTAATTCTTAAGG + Intronic
978592451 4:110340141-110340163 CTGTTATAGAGTAAGTTTTAAGG - Intergenic
978850467 4:113330243-113330265 TAGTTTCCTGGTTAGTTTTATGG + Exonic
978872615 4:113598359-113598381 TAGTTTTGGGGAAAGGTGTAAGG - Intronic
979459368 4:120963468-120963490 TAGTTTTTGGCTAAGTCTCAGGG + Intergenic
979725919 4:123960482-123960504 TAATTTTTGTGTAAGGTTTAAGG - Intergenic
979759436 4:124382744-124382766 TAGATTTAGCATAAGTGTTAAGG + Intergenic
980419858 4:132545595-132545617 TACTTTAAGTTTAAGTTTTAGGG - Intergenic
980563824 4:134511349-134511371 TAGTTTTAGTTTTTGTTTTATGG - Intergenic
980752738 4:137113110-137113132 TAGTTTTAGTGGAATTTTTAGGG + Intergenic
981789201 4:148517133-148517155 TAATTTTTGTGTAAGTTGTAAGG + Intergenic
982431968 4:155333062-155333084 TAGTTTTATTTTAAGTTCTATGG + Intergenic
982546510 4:156739789-156739811 TAAATTTAGGTTAGGTTTTATGG - Intergenic
982876094 4:160651913-160651935 TAGATTTAGCGTAATTCTTAAGG - Intergenic
983590437 4:169404792-169404814 TAATTTTACTTTAAGTTTTAGGG + Intronic
985430320 4:189873065-189873087 TAGGTTTAGCGTAAGTTTTAAGG - Intergenic
985464552 4:190182256-190182278 TAGGTTTAGGGTTAGGGTTAGGG + Intronic
985464566 4:190182311-190182333 TAGGCTTAGGGTAAGGCTTAGGG + Intronic
985464597 4:190182428-190182450 TAGGTTTAGGGTTAGGGTTAGGG + Intronic
985464701 4:190182945-190182967 TAGGCTTAGGGTAAGGCTTAGGG + Intronic
985464732 4:190183062-190183084 TAGGTTTAGGGTTAGGGTTAGGG + Intronic
985618251 5:937532-937554 GAGTTTTAGGGTAAGAGTTCAGG + Intergenic
986642080 5:9881832-9881854 TAATTTTTGTGTAAGTTATAAGG - Intergenic
987471216 5:18330982-18331004 TACTTTTATGGTAAGTTCCAGGG + Intergenic
987905569 5:24071925-24071947 TAATTATACGTTAAGTTTTAGGG + Intronic
988080292 5:26405810-26405832 TAGTTTTATAGAAAATTTTATGG - Intergenic
988364380 5:30277022-30277044 TAGTTTGACTGGAAGTTTTATGG + Intergenic
989303148 5:39918000-39918022 TAGTATTAGGGAGAGTTTTATGG + Intergenic
989987775 5:50722137-50722159 TTGTTTTTGAGAAAGTTTTAAGG + Intronic
990901438 5:60754494-60754516 TATTTTTATGGTAAGTTATTGGG - Exonic
991524634 5:67542767-67542789 TAGGTTTAGGGTTAGGATTAGGG - Intergenic
992083931 5:73261016-73261038 TTGTTTTAAGCTAAGTTTTGGGG - Intergenic
992885741 5:81158115-81158137 TAGTCTTATAGTAAGTTTTAAGG - Intronic
993299890 5:86194965-86194987 AACTTTTAAGGAAAGTTTTAAGG - Intergenic
993380403 5:87200358-87200380 TAATTTTTGTGTAAGTTGTAAGG + Intergenic
993402574 5:87472273-87472295 TGTTTTTATGGAAAGTTTTAAGG + Intergenic
994172190 5:96669825-96669847 TGGTTTTGGGGGAAGATTTATGG - Intronic
994839479 5:104904516-104904538 TAGTTTTAGGGGTAGCTTTATGG - Intergenic
995007307 5:107215502-107215524 TATTTTAAGTGTACGTTTTAGGG - Intergenic
995307711 5:110673433-110673455 TAGTTATACTTTAAGTTTTAGGG - Intronic
995889678 5:116936975-116936997 AAGTTCTGGGGCAAGTTTTAAGG + Intergenic
996210547 5:120803524-120803546 AAGTTTAATGGTAAGTTTAATGG - Intergenic
996231870 5:121074337-121074359 TAGCTGTATGGTTAGTTTTAAGG + Intergenic
996352030 5:122554654-122554676 TAGATTTAGCATAATTTTTAAGG - Intergenic
996492362 5:124112953-124112975 TGGTTTTATGGAAAGTATTATGG - Intergenic
996892496 5:128438517-128438539 TAGTTTTATGGTAAGTGGAAAGG + Intronic
996910416 5:128651149-128651171 TAATTTTTGTGTAAGGTTTAAGG + Intronic
997020118 5:129990284-129990306 TAGGTTTAGGATAGGTTTCAGGG + Intronic
998883119 5:146665053-146665075 TAGATTTAGTGTAATTCTTAAGG + Intronic
1000405153 5:160879516-160879538 TAATTTTACTTTAAGTTTTAGGG - Intergenic
1000683466 5:164217075-164217097 GATTTTTAGGGTCAGTCTTAAGG - Intergenic
1002865072 6:1114762-1114784 TAGGGTTAGGGTTAGTGTTAGGG - Intergenic
1003187667 6:3847085-3847107 TAGATTTAGCATAATTTTTAAGG + Intergenic
1003215729 6:4108868-4108890 TGTTTTTATGGGAAGTTTTATGG + Intronic
1003672224 6:8170169-8170191 TAATTTTAGGGTAAACTTTTAGG + Intergenic
1004550718 6:16644542-16644564 TAAATTTATGGTAAATTTTATGG + Intronic
1005269825 6:24151696-24151718 TAATTATAGGTTAAGTTCTATGG - Intronic
1005832623 6:29682701-29682723 TAATTATACTGTAAGTTTTAGGG + Intergenic
1006245282 6:32728841-32728863 TAGATTTAGTGTAATTCTTAAGG - Intergenic
1006762337 6:36474085-36474107 TTGTTTTATTATAAGTTTTAGGG + Intronic
1008068028 6:47071553-47071575 GAGTCTTAGGGTACATTTTAAGG - Intergenic
1008112502 6:47508032-47508054 TAGTTTTAGCATAATTCTTAAGG + Intronic
1008359612 6:50600018-50600040 TAGTTTTATGGGAAGCTTCATGG + Intergenic
1008788260 6:55197084-55197106 TAGTTTTACAGTTGGTTTTAGGG - Intronic
1009191105 6:60630952-60630974 TAATTTTAGTGTAAGGTGTAAGG + Intergenic
1009431142 6:63567586-63567608 TAGATTTAGCATAATTTTTAAGG + Intronic
1010593875 6:77741630-77741652 TATTTTTAATTTAAGTTTTAGGG + Intronic
1010595039 6:77753076-77753098 TAATTTTTGTGTAAGTTGTAAGG - Intronic
1010677779 6:78764120-78764142 TTGTTATAGTTTAAGTTTTAGGG - Intergenic
1010750659 6:79613435-79613457 TAGTTTCTGGGTACATTTTAGGG + Intergenic
1010898527 6:81396865-81396887 TAGTTTTAGCATAATTCTTAAGG - Intergenic
1010964996 6:82195078-82195100 TAGTTTTAGGGTTCCTTTCAAGG - Intronic
1011069748 6:83367274-83367296 TAGATTTAGCATAATTTTTAAGG + Intronic
1011069846 6:83368520-83368542 TACTTTTATGGTCACTTTTATGG + Intronic
1011096022 6:83663969-83663991 TAGGTTTAGTGTAATTCTTAAGG - Intronic
1011978198 6:93334828-93334850 TAGTTTTGGATTAAGTTTAAAGG - Intronic
1012109004 6:95202452-95202474 TAGATTTAGCATAATTTTTAAGG + Intergenic
1012284531 6:97372980-97373002 TAGATTTAGCATAATTTTTAAGG - Intergenic
1012682610 6:102202353-102202375 TAATTTTAGTGTAAGGTGTAAGG + Intergenic
1012824764 6:104133416-104133438 TAGATTTAGCATAAGTTTTAAGG - Intergenic
1013200252 6:107887728-107887750 TAGTTATACTTTAAGTTTTAGGG - Intronic
1013746560 6:113353039-113353061 TATTTTCAGGGGAGGTTTTATGG - Intergenic
1014347615 6:120293884-120293906 TAATTTTTGTGTAAGGTTTAAGG + Intergenic
1014369908 6:120592190-120592212 TACTTTTAGGGACAGTTTTTGGG + Intergenic
1015963564 6:138675279-138675301 TAGCTTTAGGGTAGTTTCTAGGG - Intronic
1016109312 6:140202447-140202469 GAGATTTAGGTTGAGTTTTAAGG - Intergenic
1016611419 6:145994779-145994801 TTATTATAGTGTAAGTTTTAGGG + Intergenic
1019230737 6:170559913-170559935 TAGATTTAGCGTAATTCTTAAGG - Intronic
1019250867 7:10098-10120 TAGGTTTAGGGTTAGGGTTAGGG - Intergenic
1019250871 7:10110-10132 TAGGGTTAGGGTTAGGTTTAGGG - Intergenic
1019465872 7:1188642-1188664 TAGGGTTAGGGTTAGGTTTATGG - Intergenic
1019465874 7:1188654-1188676 TAGGTTTAGGGTTAGGGTTAGGG - Intergenic
1021112472 7:16710760-16710782 TAGATTTATGATAATTTTTAAGG - Intergenic
1021815611 7:24444711-24444733 TATGTTTAGAGTAAGTTTCATGG - Intergenic
1021829794 7:24593809-24593831 TAGATTTAGCATAATTTTTATGG + Intronic
1021934038 7:25612525-25612547 TAGATTTAGTGTAATTCTTAAGG + Intergenic
1022562197 7:31361189-31361211 TAGGTTTAGGGTTAGGATTAGGG - Intergenic
1022690155 7:32641912-32641934 TAGATTTAGTGTAATTCTTAAGG - Intergenic
1023187610 7:37548481-37548503 TGGTTTTAGGGTTAGTTTATGGG + Intergenic
1023514738 7:40990468-40990490 TATCTTTAGCATAAGTTTTAAGG + Intergenic
1023798691 7:43814513-43814535 TGGTTTTGGGGTAAGGTTCAAGG - Intergenic
1024635479 7:51285830-51285852 TAGCTTTATAGTAAGTCTTAAGG - Intronic
1024844292 7:53623589-53623611 TCATTTTATGGTAAATTTTATGG - Intergenic
1025857302 7:65293173-65293195 TTGTTTTAAGGAAAGTTTAATGG + Intergenic
1027469431 7:78554824-78554846 TATTTTTATGCTAAGTTTGATGG - Intronic
1027712040 7:81616404-81616426 CAGTTTTAGGGAAGGTTTCAGGG + Intergenic
1027961888 7:84956426-84956448 TAATTTTTGTGTAAGTTGTAAGG - Intergenic
1028049335 7:86162350-86162372 TAATTTTTGTGTAAGTTGTAAGG - Intergenic
1028349540 7:89828350-89828372 TAGATTTAGTGTAATTCTTAAGG - Intergenic
1028863130 7:95677495-95677517 TAGTTTCAGGGTAACTTTCAGGG + Intergenic
1029071667 7:97904468-97904490 TAGTCTTAGGGCAAGTTTGATGG - Intergenic
1030225928 7:107150887-107150909 CAGTTAAAGGGTAAATTTTATGG - Intronic
1030459788 7:109819553-109819575 TTGTTTTTGGGTAATTTTCATGG - Intergenic
1030522836 7:110619682-110619704 TAGTTTTAGAGCTAGTATTATGG + Intergenic
1030670529 7:112331035-112331057 TATTTTTAAGGGAAGTTTCAAGG + Intronic
1030910916 7:115247805-115247827 TAATTTTCATGTAAGTTTTAAGG + Intergenic
1031117315 7:117682299-117682321 TAATTTTACGGAAAGTTTCAAGG - Intronic
1031176412 7:118357385-118357407 TAATTATACTGTAAGTTTTAGGG - Intergenic
1032659076 7:133963311-133963333 TAGTTGTAGAGTACATTTTAGGG + Intronic
1033372018 7:140717706-140717728 TAGTTCTGGGCTAAATTTTAAGG + Intronic
1035036122 7:155895609-155895631 TAGATTTAGCATAATTTTTAAGG - Intergenic
1036246039 8:7117528-7117550 TAGTCTTAGGGCAAGTTTGATGG + Intergenic
1036254760 8:7196935-7196957 TACTCTTAGGGAAAGTTTGATGG - Intergenic
1036362728 8:8090572-8090594 TACTCTTAGGGAAAGTTTGATGG + Intergenic
1036663386 8:10722662-10722684 GAGCTTTACGGAAAGTTTTATGG - Intergenic
1036888231 8:12576500-12576522 TAGTCTTAGGGCAAGTTTGATGG - Intergenic
1036895828 8:12634599-12634621 TACTCTTAGGGAAAGTTTGATGG - Intergenic
1037064487 8:14559869-14559891 AAGCTTTATGGTCAGTTTTAAGG - Intronic
1037120539 8:15280651-15280673 TAGATTTAGGATAATTCTTAAGG - Intergenic
1039382032 8:37094671-37094693 TAGATTTAGCATAATTTTTAAGG - Intergenic
1039736825 8:40341630-40341652 TACATTTAGGGTATGTTTTTAGG - Intergenic
1041551574 8:59108171-59108193 TAGTTTCAGGGAAAGCATTAAGG - Intronic
1041779848 8:61565878-61565900 TAGATTTAGCATAATTTTTAAGG - Intronic
1041808695 8:61884307-61884329 TAGTTTTATGGTAAGACTGAGGG + Intergenic
1042121896 8:65497642-65497664 TAGTTTTAGGGTAAAGATAAGGG - Intergenic
1042959546 8:74288937-74288959 TAGTTTGAGTGTCATTTTTAAGG - Intronic
1043449967 8:80356669-80356691 TATTTTTAGGTGAAGTTTTTGGG + Intergenic
1043650606 8:82586306-82586328 ATGTTTTAGGGTAAGTTTTAGGG - Intergenic
1043863448 8:85349525-85349547 AAGTTATAGGGTCTGTTTTAGGG - Intronic
1044546160 8:93462242-93462264 TAATTTTTCTGTAAGTTTTAAGG - Intergenic
1044826531 8:96203604-96203626 AATTTTTAGGTTAAGTTTTCCGG - Intergenic
1045769037 8:105712566-105712588 TAGTTTTAGGTTCAGATTCAAGG + Intronic
1046158887 8:110332776-110332798 TAGTTTTTGTGTAAGTTGTAAGG + Intergenic
1046330585 8:112709806-112709828 TAGGGTTAGGGTTAGTGTTAGGG + Intronic
1046455476 8:114454223-114454245 TAGTTTCAGGTTAATGTTTAGGG - Intergenic
1047576818 8:126165428-126165450 TAGATTTAGCATAATTTTTAAGG + Intergenic
1047698614 8:127428368-127428390 TTGTTTAAGGGTAAATTTTGAGG + Intergenic
1048824214 8:138408054-138408076 TAGATTTAGTGTAATTCTTAAGG + Intronic
1049703791 8:144028029-144028051 TAATTTTTGTGTAAGGTTTAAGG - Intronic
1050403434 9:5281609-5281631 TAGTTTTTGTGTAAGATGTAAGG - Intergenic
1051003189 9:12310708-12310730 TAATTTTTGTGTAAGGTTTAAGG + Intergenic
1051185732 9:14459341-14459363 TAGTTTTTGTGTAAGGTGTAAGG - Intergenic
1051770702 9:20575794-20575816 TAGATTTAGCATAAGTCTTAAGG + Intronic
1053402945 9:37844104-37844126 TAGTTTTATGCTATGTTTTTAGG - Intronic
1054785746 9:69208782-69208804 TAATTTTAAAGTAAGTTTTGTGG + Intronic
1055083246 9:72288754-72288776 TATTATTAGTGTAAGTTTCAGGG - Intergenic
1055578700 9:77685932-77685954 TACTTTTTGTGTAAGGTTTAAGG + Intergenic
1055716944 9:79128285-79128307 TAATTATACGTTAAGTTTTAGGG + Intergenic
1056133941 9:83612648-83612670 TAATTTTTGTGTAAGTTGTAAGG - Intergenic
1056134308 9:83616440-83616462 TATATTTTGGGTAAATTTTATGG - Intergenic
1056425860 9:86476059-86476081 TAGTTTTTGTGTAAGGTGTAAGG + Intergenic
1056787196 9:89601888-89601910 GAGATTTAGGGGAAGGTTTAGGG + Intergenic
1057827614 9:98382866-98382888 TAGTTTTAGTGGAAGTGTGAAGG - Intronic
1057948267 9:99348733-99348755 TAGATTTTGGTTAAGTTATAAGG - Intergenic
1058310383 9:103493592-103493614 TACCTTTAGTATAAGTTTTATGG + Intergenic
1060832877 9:126729662-126729684 TATTTTTAGTGTAAGATTTAAGG + Intergenic
1062619459 9:137413121-137413143 AACTTTGAGGGTAAATTTTATGG - Intronic
1062734694 9:138129094-138129116 TAGGGTTAGGGTTAGTTTTAGGG + Intergenic
1062734701 9:138129119-138129141 TAGGGTTAGGGTTAGCTTTAGGG + Intergenic
1203401602 Un_KI270519v1:107855-107877 TAATTTTACTTTAAGTTTTAGGG + Intergenic
1185832119 X:3312159-3312181 GAGTTTCAAGGTGAGTTTTAAGG + Intronic
1186710491 X:12190476-12190498 TAGTTTTATAGTAAGTCTTAAGG - Intronic
1187890467 X:23929894-23929916 TAGATTTAGCATAATTTTTAAGG - Intronic
1188793194 X:34430541-34430563 TAGTTTGAGGGTGAATTTAATGG - Intergenic
1189034201 X:37479301-37479323 TGGTTTTGGGGTAAGGTTCAAGG - Intronic
1189145675 X:38652515-38652537 CAGTATTAGGGAAAGTTATAGGG - Intronic
1189609970 X:42721917-42721939 TAATTTTAGTGTAAGGTGTAAGG + Intergenic
1189834417 X:45005754-45005776 TGGTTTTGGGGTAAGTTTCAAGG + Intronic
1189942678 X:46141971-46141993 TAGATTTAGCGTAATTATTAAGG - Intergenic
1190801072 X:53789490-53789512 TAATTTTACTTTAAGTTTTAGGG - Intergenic
1191985454 X:66975182-66975204 TAATTTTTGTGTAAGTTGTAAGG + Intergenic
1192351953 X:70363255-70363277 TAATTATACTGTAAGTTTTAGGG + Intronic
1192541709 X:71978773-71978795 TAATTATACTGTAAGTTTTAGGG + Intergenic
1192832275 X:74763133-74763155 TAATTTTTGTGTAAGTTGTAAGG + Intronic
1192910362 X:75597672-75597694 TAATTTTTGTGTAAGTTGTAAGG + Intergenic
1193047121 X:77065335-77065357 TAGTTATACTTTAAGTTTTAGGG + Intergenic
1193835725 X:86341315-86341337 TAGTTTTAGCATACTTTTTAAGG - Intronic
1194196520 X:90900987-90901009 TTGTTTTCTGGTATGTTTTATGG + Intergenic
1196116542 X:112005442-112005464 TACTTTTAGGTTCAGTTTCAGGG - Intronic
1196151358 X:112378201-112378223 TAGTTATAGGGTATCCTTTAGGG + Intergenic
1196272663 X:113730839-113730861 TAATTTTTGTGTAAGTTGTAAGG + Intergenic
1196305574 X:114098598-114098620 TAATTATACTGTAAGTTTTAGGG - Intergenic
1197269501 X:124410344-124410366 TAGTTTTTGTGTAAGATGTAAGG - Intronic
1197308562 X:124875106-124875128 TAGATTAAGGGGAATTTTTATGG + Intronic
1197780619 X:130155968-130155990 TAGTCTTTGGGTAAGATTCAGGG + Intronic
1198677395 X:139145555-139145577 CAGTTGGAGTGTAAGTTTTATGG - Intronic
1198999628 X:142619336-142619358 TAGATTTAGCATAAATTTTAAGG + Intergenic
1199260234 X:145764705-145764727 TAGATTTAGTGTAATTCTTAAGG - Intergenic
1199466086 X:148138967-148138989 TAATTTTTGTGTAAGTTGTAAGG - Intergenic
1199637350 X:149826187-149826209 TGGTTTTGGGGTAAGGTTCAAGG - Intergenic
1200327723 X:155260101-155260123 TAGTTATAGGGTAATTTGCATGG + Exonic
1200542366 Y:4475187-4475209 TTGTTTTCTGGTATGTTTTATGG + Intergenic
1200967170 Y:9108136-9108158 TAATTTTAGGTTTAGGTTTAGGG + Intergenic
1200967189 Y:9108245-9108267 TAGGTTTAGGGTAATGTTTAGGG + Intergenic
1200977437 Y:9227927-9227949 TAGTTTTAGGGTAACAATTAAGG - Intergenic
1201408020 Y:13668088-13668110 TAATTTTAGAGTGACTTTTAAGG + Intergenic
1201730485 Y:17197330-17197352 TAGTGTTAGGGTTAGGGTTAGGG + Intergenic
1201754070 Y:17467759-17467781 TAGGATTAGGGTTAGTGTTAGGG + Intergenic
1201791102 Y:17841312-17841334 TAGTGTTAGGGTGAGCATTAGGG + Intergenic
1201810452 Y:18064677-18064699 TAGTGTTAGGGTGAGCATTAGGG - Intergenic
1201847482 Y:18438226-18438248 TAGGATTAGGGTTAGTGTTAGGG - Intergenic
1201930449 Y:19339422-19339444 TAATTTTTGTATAAGTTTTAAGG + Intergenic
1201991872 Y:20035912-20035934 TAATTTTTGTGTAAGTTGTAAGG - Intergenic
1202015550 Y:20402424-20402446 TATTTTTAGTGAAAGTTGTAAGG - Intergenic
1202133405 Y:21635101-21635123 TAGGTTTAGAGTTAGTGTTAGGG + Intergenic
1202172649 Y:22067218-22067240 TAGTTTTAGGGTTAGAGTTCAGG - Intergenic
1202218713 Y:22519153-22519175 TAGTTTTAGGGTTAGAGTTCAGG + Intergenic
1202324473 Y:23676902-23676924 TAGTTTTAGGGTTAGAGTTCAGG - Intergenic
1202335886 Y:23810758-23810780 CAGGGTTAGGGTTAGTTTTAAGG + Intergenic
1202335993 Y:23811639-23811661 TAGGATTAGGGTTAGTGTTAGGG + Intergenic
1202534773 Y:25858428-25858450 TAGGATTAGGGTTAGTGTTAGGG - Intergenic
1202534881 Y:25859309-25859331 CAGGGTTAGGGTTAGTTTTAAGG - Intergenic
1202546298 Y:25993152-25993174 TAGTTTTAGGGTTAGAGTTCAGG + Intergenic