ID: 912922029

View in Genome Browser
Species Human (GRCh38)
Location 1:113877959-113877981
Sequence CTGTGGGTATGGAATTGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 1, 2: 1, 3: 21, 4: 213}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912922029 Original CRISPR CTGTGGGTATGGAATTGAGA AGG Intergenic
901568963 1:10143556-10143578 TTAAGGGTATGGATTTGAGATGG - Intronic
902122890 1:14182984-14183006 CTGTGGGTATGGAACTGAGAGGG - Intergenic
902127380 1:14227289-14227311 CTATGGGTCAGGAATTCAGAAGG + Intergenic
902263023 1:15241096-15241118 CTGTGGGTCAGGAATTGGGCAGG - Intergenic
903643286 1:24875008-24875030 CTGTGGGTACGGGATGGAGGAGG - Intergenic
903830294 1:26170395-26170417 CTGTAGGAATGGAAGTGAGAAGG - Intronic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
905571998 1:39013519-39013541 CAGTGGCTATGGAATTGGGCTGG - Intergenic
905732545 1:40306550-40306572 CAGGAGGTATGGAATGGAGATGG + Intronic
908353441 1:63308746-63308768 CTGTGGATCGGGAATTCAGAAGG - Intergenic
909198523 1:72658435-72658457 CTATGGGTCTGCAATTCAGAAGG - Intergenic
912922029 1:113877959-113877981 CTGTGGGTATGGAATTGAGAAGG + Intergenic
912997827 1:114549332-114549354 CTGAGGCTGTGGAATTGAGAGGG - Intergenic
913243705 1:116852743-116852765 CTGGGAGTATGGAAGTGAGATGG + Intergenic
913489871 1:119368922-119368944 CTGTGTGCTTGGAACTGAGAAGG + Intronic
913610527 1:120505711-120505733 CTGTGGGTTTGGAGTTAAGCTGG + Intergenic
914580663 1:149016528-149016550 CTGTGGGTTTGGAGTTAAGCTGG - Exonic
916064709 1:161126825-161126847 ATGGGGGTGTGGAATAGAGAAGG - Intronic
918111772 1:181461018-181461040 CGGTGGGGATTGAATTGAGGTGG + Intronic
918147043 1:181766120-181766142 CTTTGGGTATGGGAGTGGGAGGG + Intronic
919870887 1:201820382-201820404 CAGTGGTGATGGAATTGGGAAGG - Exonic
920573571 1:207037444-207037466 CTGTGTGGATGGAAGAGAGAAGG - Intronic
920917928 1:210272986-210273008 CTGTGCTAATGGAATTCAGAAGG - Intergenic
921454949 1:215359603-215359625 GTCTGGGTATTCAATTGAGATGG + Intergenic
922233296 1:223704639-223704661 CTGAGGGAAGGGAAATGAGAAGG + Intronic
922916618 1:229263278-229263300 CTGGGGGGATGAAATGGAGAGGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923526801 1:234778966-234778988 CTGTGTGTCTTGACTTGAGATGG + Intergenic
1063665970 10:8060890-8060912 CTGTGAGAAAGGAATTAAGAAGG - Intronic
1063956581 10:11273084-11273106 GTGTGGGCAGGGAATGGAGAGGG + Intronic
1064019987 10:11801238-11801260 CTGTGGGAATGGAATTGCTAGGG + Intergenic
1065072892 10:22045710-22045732 CTGTGGGTCAGGAATCCAGAAGG - Intergenic
1065889112 10:30106064-30106086 CTATGGCTCTGGAATTGTGAAGG - Intronic
1066513949 10:36134261-36134283 CTGAGGGAATGGATTTGGGAGGG - Intergenic
1067724880 10:48762511-48762533 CTGTGGGTCAGGGATTCAGAAGG + Intronic
1069569408 10:69485283-69485305 CTGGGGGTATGGCAGTGAGCAGG + Intronic
1070321172 10:75355776-75355798 CTATGGGTCTGGAATTCAGATGG + Intergenic
1072374871 10:94804126-94804148 CTTTGAGGATGGAATGGAGAGGG + Intronic
1073469720 10:103715072-103715094 CTGGGGGAATGGAATTGGGTTGG - Intronic
1073471737 10:103726809-103726831 GTGTGGGTTTGGCATCGAGAAGG - Intronic
1073935050 10:108621149-108621171 CTGTGGCTATGGAAATTATATGG - Intergenic
1074825697 10:117214326-117214348 CTCTGGCAATGGAATTGACAAGG + Intergenic
1075786172 10:125051678-125051700 CTGTGGGCATTTAATTGAAAAGG - Intronic
1076453683 10:130574848-130574870 CAGTGGGCATGGGATTGAGCAGG - Intergenic
1078385808 11:10891508-10891530 CAGAGGGGATGGAATTTAGATGG + Intergenic
1078592258 11:12653385-12653407 TTTTGAATATGGAATTGAGAAGG - Intergenic
1081380412 11:42407730-42407752 CAGTGGTTAGAGAATTGAGAAGG + Intergenic
1089589612 11:119531997-119532019 CTGTGGGTGTGCAATGGACAAGG - Intergenic
1090422842 11:126587459-126587481 CTGTGGGTTTGGGAATGTGATGG - Intronic
1090429149 11:126631522-126631544 CTGTGTGTTGGAAATTGAGATGG + Intronic
1090672455 11:128958337-128958359 CTTAGGGTGTGGAACTGAGAAGG - Intergenic
1092223986 12:6734528-6734550 CTGTGGGTAAGGAATCGGCACGG + Intergenic
1092280843 12:7096708-7096730 CAGTGGGTTTGGCATGGAGATGG - Exonic
1094038056 12:26091537-26091559 CTGTGGCCATGGAAGAGAGATGG - Intergenic
1094123518 12:26998723-26998745 GTGTGGGGATGGATTGGAGAGGG - Intronic
1096270269 12:50160433-50160455 CTGAGAGAATGGCATTGAGAAGG + Intronic
1099178683 12:79453128-79453150 CTGGGGCTATGAAACTGAGATGG - Intergenic
1102727363 12:115077498-115077520 CTGTGGGTCAGGAATTTGGATGG - Intergenic
1102805381 12:115774993-115775015 CTGTGGATATGGATGGGAGAAGG - Intergenic
1104339309 12:127932405-127932427 CTGTTGGTGGGGAATTGAAAAGG - Intergenic
1105533921 13:21246282-21246304 CTGTTGATATGGATTTGAGTAGG - Intergenic
1107057018 13:36117126-36117148 CTGTTGCTTTGGATTTGAGAAGG - Intronic
1107295934 13:38907545-38907567 CTGTGTGTATGGAGTTTACATGG + Intergenic
1107580651 13:41780568-41780590 CTGTGGGGATGGAAAAGAAAGGG - Intronic
1107760475 13:43672866-43672888 CTGTAGGTAGTGAATTCAGATGG - Intronic
1108416876 13:50206550-50206572 CTGTAGGAATGGTGTTGAGAGGG + Intronic
1108717906 13:53100137-53100159 CTTTAGGTAAGCAATTGAGATGG + Intergenic
1110267886 13:73558954-73558976 CTGGTGGTATGCATTTGAGAGGG - Intergenic
1111314337 13:86533248-86533270 CTGTGGGTATCTATTTGGGATGG - Intergenic
1111383708 13:87495275-87495297 CTCTGGGGATGGAATAGGGAGGG + Intergenic
1111971706 13:94923693-94923715 TTGTGGGTCAGGAATTCAGATGG - Intergenic
1115394945 14:32897831-32897853 ATGTGGCTCTGGAAGTGAGAGGG + Intergenic
1118398370 14:65356575-65356597 GTGTGGGTGGGGAATTGGGAGGG + Intergenic
1119432231 14:74575916-74575938 CTGTGGGTTTGGAAGAGGGAGGG - Intronic
1119727280 14:76929038-76929060 CGGTGGGCATGGAATGGGGAGGG + Intergenic
1119925470 14:78489424-78489446 CTGTGGATGTGCAATTTAGAGGG + Intronic
1120121068 14:80680632-80680654 ATGTGGGTATGGACTGCAGAGGG - Intronic
1120961280 14:90127356-90127378 CTGTGTGTATGGATCTGAGCCGG + Intronic
1121026603 14:90620866-90620888 CTCAGGATATGGAATTGAAAAGG + Intronic
1122625451 14:103083307-103083329 CTGTGGGTATTGAATGGAAGTGG + Intergenic
1125130544 15:36279254-36279276 GCCTGGGTATGGAATGGAGAGGG + Intergenic
1125310324 15:38372098-38372120 CTGTGGGTCTGGAATTCAGGAGG - Intergenic
1128795236 15:70461872-70461894 CCCTGGGGATGGAATTTAGAAGG + Intergenic
1129065703 15:72902221-72902243 CTGTGTGCATGGCATGGAGAAGG - Intergenic
1131601788 15:93856744-93856766 ATGTGGGTATGGGATGGTGAGGG + Intergenic
1131645395 15:94336783-94336805 CTGTGTGTTTGGAATGGAGCAGG + Intronic
1134373064 16:13643738-13643760 CTGTGGGGAGGGCAGTGAGAGGG + Intergenic
1136508486 16:30721493-30721515 CTGTGGTGAGGGACTTGAGATGG + Intronic
1137054639 16:35738275-35738297 CTGTGGCTAAGGAATTGACCTGG + Intergenic
1138239231 16:55413057-55413079 CTGAGGGAAAGGAACTGAGAAGG + Intronic
1139050473 16:63119230-63119252 CTGTGGGTATAGAATTTCTATGG - Intergenic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1140836530 16:78799549-78799571 CTCTGCGTATGGAATTGAGGAGG + Intronic
1140901579 16:79372810-79372832 CAGTGGGTCTGGAGCTGAGAGGG - Intergenic
1141753765 16:85977639-85977661 CTGCTGGCATGGAAATGAGAAGG - Intergenic
1144728305 17:17512655-17512677 CTGTGGGCAGGGGATGGAGAGGG + Intronic
1146143074 17:30386604-30386626 CTGGGGGTAAGGGATAGAGATGG - Intronic
1146949988 17:36899345-36899367 CTGTGGAGATGGAATTCAGTAGG + Intergenic
1148825977 17:50394726-50394748 CAGTGGGAAAGGAATTGAGATGG - Intronic
1149556547 17:57577416-57577438 CTATGGGTCTGGAAATGGGACGG - Intronic
1151327487 17:73388153-73388175 CTGCGTGCATGGAATTGGGATGG - Intronic
1151363859 17:73604726-73604748 ATGTGGGTATAGAAATGAGGAGG + Intronic
1152271596 17:79328177-79328199 CTGTGTGTCTGGAACGGAGATGG + Intronic
1158603010 18:58870937-58870959 CTGTGAGTCTGGAATTTAGGAGG + Intronic
1159985407 18:74835419-74835441 CTGAGGGTGTGCAGTTGAGATGG + Intronic
1160421471 18:78750022-78750044 AAGTGGGTATGGAATTAAAAAGG - Intergenic
1161086486 19:2337924-2337946 CTGTGGGGATGGGATTGGGGTGG + Intronic
1166333589 19:42092166-42092188 CAGAGGGGATGGAATTGAGGGGG + Exonic
1168575205 19:57503446-57503468 CTGTGGGGATAGACATGAGATGG + Intronic
925522793 2:4766360-4766382 CTGTGGTTCTAGAATTGAGATGG + Intergenic
926620142 2:15040045-15040067 CTGCGAGGATGGAATCGAGAAGG + Intergenic
928624507 2:33125895-33125917 CTGTGGTTCAGGAATTTAGAGGG + Intronic
929723608 2:44399033-44399055 CTGTGTGTATGAGATTGAAAAGG + Intronic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
932799320 2:74725814-74725836 CTGTCAGTATGGAAATTAGAGGG + Intergenic
934858708 2:97745702-97745724 CTGTGGGTGGGGATGTGAGATGG + Intergenic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
938302041 2:130222755-130222777 CTGTGGGAAGGGAAATGAAATGG + Intergenic
938454659 2:131451697-131451719 CTGTGGGAAGGGAAATGAAATGG - Intergenic
941070114 2:160945979-160946001 CTGTGGGTTTGGAAGAGACATGG + Intergenic
941370392 2:164657442-164657464 CTGTGGGTAAGGAATTGGAGTGG - Intronic
941396851 2:164983878-164983900 CTTTGGGTATGGGTGTGAGAGGG + Intergenic
942520029 2:176793919-176793941 CTCTGGGTAGGGAATAAAGAGGG - Intergenic
942627071 2:177912594-177912616 CTGAGGGTCTGGAAATAAGAGGG - Intronic
943198566 2:184788963-184788985 CTGTGGGTTTGTCATAGAGATGG + Intronic
946444595 2:219727402-219727424 CTTAGGGTAGGGAAATGAGAAGG + Intergenic
947126900 2:226878719-226878741 CTGTGGGTCAGGAATTCAGAAGG - Intronic
947165732 2:227259948-227259970 ATGTGCTTATGGAATTGACATGG + Intronic
1168926785 20:1588170-1588192 CTCTGGGTATTGAATACAGAAGG + Intronic
1170657995 20:18308085-18308107 CTGTGGGGATAGAATTGGGGAGG + Intronic
1170808832 20:19657739-19657761 CTGGGGGCATGGAATAGATATGG - Intronic
1171394095 20:24819867-24819889 CTGTGGGTAAGGAATTTGGAAGG - Intergenic
1171431868 20:25087964-25087986 CTGTGGCTGTGGAATAAAGATGG - Intergenic
1172435569 20:34926762-34926784 CTGTGGGCAGGGACTTGAGGAGG + Intronic
1173745494 20:45433617-45433639 CTGTAGGTCTGGAATTCAGGCGG - Intergenic
1174706106 20:52657807-52657829 ATGTGGCTATAGAAGTGAGAGGG + Intergenic
1175547479 20:59787926-59787948 CTGTGGGTGTGTATTTCAGATGG - Intronic
1177113002 21:17050902-17050924 CTGTGGGGAGGGAAGTGAGGTGG + Intergenic
1177828003 21:26105845-26105867 CAGTGGGTATGGATTAGAAAAGG - Intronic
1178257181 21:31064825-31064847 CTGTGGGTCAGGAATTCACAAGG - Intergenic
1179022792 21:37655530-37655552 GTGTGTGTATGTATTTGAGAAGG + Intronic
1179422918 21:41250302-41250324 CTGGGCTTATGGAATTCAGAGGG + Intronic
1182515298 22:30855320-30855342 CTTTGGCTCTGGGATTGAGAAGG - Intronic
1182534974 22:30994208-30994230 CTGTGGGTCAGGAATTGGGCAGG + Intergenic
1183405738 22:37629747-37629769 CTTTGGGATTGGGATTGAGATGG + Intronic
1184307414 22:43615315-43615337 CTGTGATTATGGTATTGAGATGG - Intronic
950041728 3:9924033-9924055 CAGTGGGAATGGACTTGGGAAGG - Intronic
950918487 3:16668964-16668986 CTGTGGGTTTGGAGTTGGCAGGG + Intronic
954092698 3:48297731-48297753 CTGTGGGATTAGAATTGTGAAGG + Intronic
954332448 3:49898198-49898220 CTGTGGGGGTGGAACTGAAATGG + Exonic
954454131 3:50587922-50587944 CTGAGGGTTTGGATGTGAGATGG + Intergenic
955985308 3:64567701-64567723 ATGTGTGTATGGGATGGAGAAGG - Intronic
956319900 3:67985104-67985126 TTGTGGGTATGAAAATGAAAGGG - Intergenic
956541528 3:70345119-70345141 CTGTGGTAATGGATTAGAGATGG - Intergenic
957252713 3:77794233-77794255 CTGTGGGTCAGGAATTTAGGGGG - Intergenic
959333584 3:105036872-105036894 CCATGGCCATGGAATTGAGAAGG + Intergenic
960041967 3:113159177-113159199 CTGTGTATAAGGAATTGACAAGG - Intergenic
961222287 3:125210806-125210828 CTGTAGATATGGAATTGAAGTGG - Intronic
961554457 3:127688629-127688651 GTGTGGGTATAGAATGGAGAGGG + Intergenic
964961106 3:162427742-162427764 CTGTGCCTATGGAAAGGAGATGG + Intergenic
967227399 3:187305188-187305210 TTGTGGGTGGGGAATTGAGCAGG - Intergenic
968285571 3:197506612-197506634 CTGCGGGTATAGAAGTCAGATGG + Intergenic
969943629 4:10760364-10760386 CTGTAGGTATGGAACTTTGAAGG - Intergenic
969957075 4:10902000-10902022 CTGTCGGTAGGGCATGGAGAGGG - Intergenic
970793189 4:19883693-19883715 GTGTGGGTATGAAATTGCAATGG - Intergenic
975050252 4:69854751-69854773 CTGTGTGCATGGTATTGGGATGG - Intronic
980820833 4:138014651-138014673 CTCTGTGTAATGAATTGAGAAGG - Intergenic
982695727 4:158597799-158597821 CTGTGGGGATGGGATGGAAAAGG - Intronic
983399628 4:167246406-167246428 CTGTGGGTCAGGAATTCAGGAGG - Intergenic
985323597 4:188741796-188741818 CAGTGGTAATGGAATTGAAAAGG - Intergenic
986280650 5:6319355-6319377 TGGCGGGTATGGAATTGGGAAGG + Intergenic
988687537 5:33539581-33539603 CTGTGGGTCTTGAGTTGAGAAGG - Intronic
992187680 5:74259888-74259910 CTGAGGGTAGGGAATGGAGGTGG - Intergenic
994580928 5:101641027-101641049 CTGTGTTTATGGAAGGGAGAGGG - Intergenic
995355585 5:111234460-111234482 CAGTGGTCATGGAGTTGAGAGGG + Intronic
996907967 5:128623448-128623470 CTGTAGGTAAGCAATTAAGAAGG - Intronic
997035935 5:130191207-130191229 TGGTGGGTATGGAAGTGAAAGGG - Intergenic
998371058 5:141661788-141661810 CTCTGGGGATGGAATGGAGGAGG + Exonic
998523931 5:142825427-142825449 CTGAGGTTATGGAGATGAGAAGG + Intronic
999096220 5:148980193-148980215 CTCTGGGAATGGAATAGAAAAGG - Intronic
1000160046 5:158588448-158588470 CTGAGGATATGGAATCTAGAAGG - Intergenic
1001702572 5:173718012-173718034 CTGTGGGAATGGAACTGAAATGG - Intergenic
1004240840 6:13920242-13920264 CTATGATTAAGGAATTGAGAAGG + Intergenic
1005928338 6:30463248-30463270 CTGGGGGTGTGGAATTGGGAGGG - Intergenic
1007107931 6:39296068-39296090 GTGTGTGTATGTAACTGAGAGGG + Intergenic
1009369872 6:62885731-62885753 CTCTGGGTAGGAAATGGAGAAGG + Intergenic
1010350767 6:74871666-74871688 CAGTGGTCATGGAAATGAGAAGG + Intergenic
1011903109 6:92325656-92325678 GTGTGGGTAGGGAAGTGAGTGGG - Intergenic
1012359325 6:98357468-98357490 CTCAGGGTATAGAATTGAGTGGG + Intergenic
1013917837 6:115363587-115363609 CTATGGGAAAGGAAGTGAGATGG - Intergenic
1015863602 6:137705713-137705735 CTGTGTGGATGGTTTTGAGAAGG + Intergenic
1016291916 6:142536529-142536551 CTTTGGGACTGGACTTGAGAGGG - Intergenic
1016730234 6:147420705-147420727 GTGTGGGAATGGAATTGTGGTGG - Intergenic
1017153588 6:151303260-151303282 CAGGGGGTAGGGAATGGAGAAGG - Intronic
1017312256 6:152987572-152987594 CAGTGGTAATGGAATTGAAAAGG + Exonic
1018906541 6:168079197-168079219 CACTGGGAAGGGAATTGAGAGGG + Intronic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1022067455 7:26874022-26874044 TTGTGTGTATGGGAATGAGATGG - Intronic
1025804398 7:64816855-64816877 CTCTGGGTTTGTAATGGAGAGGG + Intronic
1032752497 7:134855362-134855384 CTGTGTAGATGGAATTGAAATGG + Intronic
1033197583 7:139341019-139341041 GTGTGGGTGTGGATTTGATATGG - Intronic
1035889583 8:3329049-3329071 CTGTTGGCATGGAATGGAGGTGG + Intronic
1037077488 8:14738801-14738823 CTGTGAGTCTGAAAATGAGAGGG + Intronic
1037487149 8:19358435-19358457 CTGGGAGGATGGAATTGGGATGG + Intronic
1037988128 8:23302320-23302342 ATGTGGGTAGGGAATTGAGTGGG - Intronic
1042129036 8:65568347-65568369 CTGTGGGAATGGAAGTGGGAAGG - Intergenic
1042303220 8:67308207-67308229 CTGTGTGTCAGGAATTCAGATGG - Intronic
1045190562 8:99878547-99878569 TGGTGGGCATAGAATTGAGAAGG - Intronic
1046606324 8:116375414-116375436 GTCTGGGCATGGAATGGAGAGGG + Intergenic
1046895747 8:119470525-119470547 CTGTGAATAAGGAATTTAGAAGG - Intergenic
1048425475 8:134319372-134319394 CTGAGGGTGAGGAATTGAGATGG - Intergenic
1050252463 9:3759576-3759598 GGGTGGGGATGGAAATGAGAAGG - Intergenic
1050839614 9:10131707-10131729 GTGTGTGTGTGGAATTGTGAAGG + Intronic
1051632318 9:19151632-19151654 ATGTGGTGATGGAATTCAGAAGG + Intergenic
1052197894 9:25740373-25740395 GTGTGTGTATGGAGTGGAGAGGG + Intergenic
1053559184 9:39171598-39171620 CTGTGGCTGTGGACATGAGAAGG + Exonic
1053823302 9:41991839-41991861 CTGTGGCTGTGGACATGAGAAGG + Exonic
1054137927 9:61447348-61447370 CTGTGGCTGTGGACATGAGAAGG - Intergenic
1054607271 9:67195526-67195548 CTGTGGCTGTGGACATGAGAAGG - Intergenic
1055407450 9:75989526-75989548 CTGAGGGTCAGGAATTCAGACGG + Intronic
1056958797 9:91103768-91103790 CAGTGGGTTGGGAATTCAGACGG - Intergenic
1057967204 9:99515836-99515858 CTGTGGCCATGGAATTAATAAGG + Intergenic
1059463262 9:114448861-114448883 CTGTGGGTGAGGAAGTGACAAGG - Intronic
1186045341 X:5530518-5530540 GTGTGTGTATGTAATTGAGAAGG - Intergenic
1186063590 X:5737984-5738006 CCATGGGAATGGAATTGAAATGG - Intergenic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1187354082 X:18550333-18550355 CTGTGGGTATGGATGTGGGTGGG - Intronic
1187600602 X:20825139-20825161 CTGGGGGTAGGGAGTGGAGAAGG - Intergenic
1190154246 X:47974947-47974969 CTGGGGGGATGGAATTGAGAGGG - Exonic
1192917281 X:75666224-75666246 CTCTGGGCATGGAGTGGAGAGGG + Intergenic
1195539632 X:106047924-106047946 CTGTGGGAATGGAAGTTAGGAGG - Intergenic
1195608027 X:106831340-106831362 TTCTGCGTCTGGAATTGAGATGG - Intronic
1197188248 X:123613154-123613176 AGGTGGGAATGGAATGGAGAGGG + Intronic
1198086645 X:133288579-133288601 CTGTGGGAGTTGAATTGAGCTGG + Intergenic
1199056987 X:143308085-143308107 CTGGAGGTATGGGATAGAGAAGG + Intergenic
1199860750 X:151798734-151798756 CTGTGTGTCTGGAATTAGGAGGG + Intergenic
1201532735 Y:15010105-15010127 CCATGGGAATGGAATTGACATGG + Intergenic