ID: 912924996

View in Genome Browser
Species Human (GRCh38)
Location 1:113905696-113905718
Sequence CCGTGGGCCTGTCTAGCACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912924989_912924996 30 Left 912924989 1:113905643-113905665 CCGGGCTGGCACCGCACGTCTCT 0: 1
1: 0
2: 0
3: 4
4: 123
Right 912924996 1:113905696-113905718 CCGTGGGCCTGTCTAGCACCTGG 0: 1
1: 0
2: 0
3: 1
4: 89
912924990_912924996 19 Left 912924990 1:113905654-113905676 CCGCACGTCTCTTCTTCTTGTCT 0: 1
1: 0
2: 2
3: 39
4: 432
Right 912924996 1:113905696-113905718 CCGTGGGCCTGTCTAGCACCTGG 0: 1
1: 0
2: 0
3: 1
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912924996 Original CRISPR CCGTGGGCCTGTCTAGCACC TGG Exonic
900645839 1:3708351-3708373 CCGTGGGCCAGTCTGTCTCCAGG - Intronic
903972708 1:27129488-27129510 CCCTGGGCCTTCCTGGCACCAGG - Intronic
906525094 1:46489236-46489258 CCGCTCACCTGTCTAGCACCTGG - Intergenic
912924996 1:113905696-113905718 CCGTGGGCCTGTCTAGCACCTGG + Exonic
916182137 1:162094588-162094610 CCCTGGGCCTGTCCTGAACCTGG + Intronic
919978569 1:202628452-202628474 CCTGGGGCCTGGCCAGCACCTGG - Intronic
1064018920 10:11793942-11793964 CCGTGGGTCTGTCTGATACCAGG + Intergenic
1067567287 10:47348562-47348584 CCTTGGCCATGTCCAGCACCAGG - Exonic
1069896756 10:71684850-71684872 ACTTAGGCCTGTCTAGCCCCGGG - Intronic
1072260330 10:93664124-93664146 CCCAGGGCCTGCCTAACACCGGG - Intronic
1074078711 10:110151468-110151490 CCGTGGACCCCTCCAGCACCAGG - Intergenic
1078441453 11:11371976-11371998 CTGTGGGTCTGGCTAGCACCTGG + Intronic
1080570690 11:33554148-33554170 CCTTGGGGCTGTCTTTCACCAGG + Intronic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1085047546 11:73362361-73362383 CGGTGGGCGTGTCCACCACCGGG + Intronic
1089014446 11:115154933-115154955 CTGTGGGCCTGGCTCGCATCCGG + Intergenic
1090436252 11:126689123-126689145 CAGTGGGCCAGTTTATCACCTGG - Intronic
1091595936 12:1879100-1879122 CCCTGGGCCTGTCCAGAGCCTGG + Intronic
1097174603 12:57135622-57135644 CCGAGGGCCTGGCCAGCACAAGG - Intronic
1101640518 12:106583244-106583266 CCCTGGGCATCTCTAGCACAGGG + Intronic
1101762851 12:107673332-107673354 CCGTGGTCCTGTCTACAACATGG + Intergenic
1108595651 13:51946364-51946386 CCGTGGGCGTGGCCAGCCCCAGG + Exonic
1112047846 13:95615724-95615746 CTGCTGGCCTGTCTAGCTCCAGG - Intronic
1114668753 14:24398115-24398137 CCTTGGGCCTGAATAGAACCTGG - Intergenic
1115641575 14:35338823-35338845 CTGTGGACCTGTCTCCCACCAGG + Intergenic
1115770099 14:36658702-36658724 CCGCGGGCCGCTCTAGCGCCGGG + Intronic
1116149254 14:41117792-41117814 CGGTGGGTCTGTGTAGCACGTGG - Intergenic
1117987121 14:61397438-61397460 CCATGTGCCTGTCTTCCACCTGG - Intronic
1122659020 14:103282032-103282054 CCTTCGGCCTGTCCAGCAGCTGG - Intergenic
1202896672 14_GL000194v1_random:14391-14413 CCTTGGGCCTGTTTACTACCCGG + Intergenic
1124623299 15:31292475-31292497 CCATGGGCTTGTCTGGGACCTGG + Intergenic
1132519767 16:381801-381823 CCATGGGCCGGGCTGGCACCGGG - Exonic
1132758180 16:1496078-1496100 CCGGGGGCCTGCACAGCACCCGG + Intronic
1132760219 16:1505388-1505410 CCCTGGGCCTGTCTCCCTCCAGG + Exonic
1132808732 16:1787726-1787748 CCGGGGGCGTGTCCACCACCAGG - Exonic
1141130487 16:81433048-81433070 CTGTGAGCCTGTCCAGCCCCTGG - Intergenic
1144301130 17:13923695-13923717 CCCTGGGCCTGTTTAGCCCACGG - Intergenic
1144641692 17:16940600-16940622 CTGTGAGCCTGTCTGGCTCCTGG + Intronic
1145209773 17:21004454-21004476 CTGTGGGCCTGTCAACCCCCAGG + Intronic
1149301056 17:55304943-55304965 CCTTGGGCCTGTCCTGCACGAGG - Intronic
1151957249 17:77386531-77386553 CCATGGGCCTCTCTGGCACAAGG + Intronic
1154358034 18:13637308-13637330 CCATTGGTCTGTGTAGCACCTGG + Intronic
1156030436 18:32706854-32706876 CCCTGTGCCTGTCAAGCTCCAGG - Intronic
1156476195 18:37406892-37406914 AGGTGGGCCTGTCTAGGAGCGGG + Intronic
1162141836 19:8589824-8589846 CCGTGGGAGTGTCCAGCAGCAGG - Intronic
1164457611 19:28421569-28421591 CCGTGGGCCTCTCTGTCACATGG - Intergenic
1165146893 19:33736545-33736567 CCGTTGGCCTGGCAGGCACCAGG - Intronic
1167465115 19:49646522-49646544 CCGTGGCCATGTCCAACACCTGG - Exonic
925724906 2:6863317-6863339 CCCAGGGCCTGCCTAGCACAGGG + Intronic
933370218 2:81405792-81405814 CCATGAGCATGTCTATCACCTGG - Intergenic
937245157 2:120487811-120487833 CCGTGAGCCTGCCATGCACCAGG - Intergenic
940650283 2:156435376-156435398 CCTTGGGCTTGTCTAGCCCTAGG + Intronic
947807887 2:232981132-232981154 CCGAGGGCCTCCCAAGCACCTGG + Intronic
948262152 2:236612554-236612576 CAGAGGGCCTGGCCAGCACCAGG + Intergenic
948388562 2:237596698-237596720 CCCTGGGCCTGTCTCACACTGGG - Intronic
1172869183 20:38125315-38125337 CCTTCGGCCTCTCTACCACCAGG + Intronic
1175529286 20:59663042-59663064 CCCTGGGCCTCTCTAGCGTCTGG + Intronic
1176012374 20:62905805-62905827 CCCTGGGCCTGTCCAGGACTGGG - Intronic
1176616360 21:9030387-9030409 CCTTGGGCCTGTTTACTACCCGG + Intergenic
1176708768 21:10133242-10133264 CCTTGGGCCTGTTTACTACCCGG - Intergenic
1184404652 22:44293016-44293038 CCGGGGCCCTGTCTAGCCCAGGG - Intronic
1184635130 22:45821969-45821991 CCGCTGGCCTGACCAGCACCAGG + Intronic
1184889732 22:47372317-47372339 TCATGGGCCTGTGGAGCACCTGG + Intergenic
950612021 3:14132932-14132954 CCTTGGGCCTGGCTCTCACCTGG - Exonic
950929791 3:16777053-16777075 CCGTGTGCCTGCCTAGAATCAGG + Intergenic
954025824 3:47782206-47782228 CCTTGGGCATTTCTCGCACCAGG - Intergenic
956783401 3:72622589-72622611 CCCAGGGCCAGTCTAGGACCAGG + Intergenic
961492133 3:127263558-127263580 CTGTGGCCCTGTCTCCCACCTGG + Intergenic
967704269 3:192631517-192631539 CAGTGGGCAAGTTTAGCACCTGG + Intronic
969197396 4:5573841-5573863 CCGTGGGCCTTGCTAGCTGCAGG - Intronic
971255584 4:25010740-25010762 CCGTGAGCCTGTGAGGCACCAGG - Intronic
984565556 4:181325925-181325947 TCGTGGCCCTGTCTAGGACTAGG + Intergenic
992969336 5:82039954-82039976 CAGTTGTCCTGTCAAGCACCAGG - Intronic
998859168 5:146426155-146426177 CCGAGGGACTGTCTACCACATGG - Intergenic
1001907089 5:175481709-175481731 CGTTGGGCCTGCCTAGCATCAGG - Intronic
1006920421 6:37624283-37624305 CCCAGGGCCTGTCTGGCACAGGG - Intergenic
1019198786 6:170297145-170297167 CCCTGGGCCTGTCTGGCTGCAGG + Intronic
1031688571 7:124762846-124762868 CCCTGATCCTGTCTGGCACCAGG - Intronic
1048373959 8:133805455-133805477 CCGTGGGCCTGTTAAGCATGGGG + Intergenic
1048992808 8:139771172-139771194 CTGGGAGCCAGTCTAGCACCAGG - Intronic
1049733530 8:144191516-144191538 CCCTGGGCCTGGCCAGCATCTGG + Intronic
1053153292 9:35756578-35756600 TCGAAGGCCTGTCTAGCACGAGG + Exonic
1053645746 9:40118740-40118762 CCTTGGGCCTGTTTACTACCCGG - Intergenic
1054538825 9:66257232-66257254 CCTTGGGCCTGTTTACTACCCGG + Intergenic
1060216636 9:121742476-121742498 GCGTGGGCCATTCTGGCACCTGG - Intronic
1202793529 9_KI270719v1_random:102212-102234 CCTTGGGCCTGTTTACTACCCGG - Intergenic
1189143909 X:38636586-38636608 CTGTGGGCCTGCCTCCCACCAGG - Intronic
1197729536 X:129797880-129797902 CCGTGGGCCTCTCCAGGGCCTGG + Intergenic
1200036725 X:153335737-153335759 CACTGGGCCTGTCTAGAATCTGG - Intronic
1200063373 X:153493689-153493711 CCCAGGGCCTGGCTAGGACCTGG - Intronic
1201149736 Y:11089112-11089134 CCTTGGGCCTGTTTACTACCTGG + Intergenic