ID: 912926264

View in Genome Browser
Species Human (GRCh38)
Location 1:113915810-113915832
Sequence GCATCATTCTGTTCAGGTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912926264_912926268 21 Left 912926264 1:113915810-113915832 CCTATACCTGAACAGAATGATGC 0: 1
1: 0
2: 0
3: 6
4: 105
Right 912926268 1:113915854-113915876 GAGTCTAACAGCTGCCTGTGAGG 0: 1
1: 0
2: 0
3: 13
4: 142
912926264_912926269 22 Left 912926264 1:113915810-113915832 CCTATACCTGAACAGAATGATGC 0: 1
1: 0
2: 0
3: 6
4: 105
Right 912926269 1:113915855-113915877 AGTCTAACAGCTGCCTGTGAGGG 0: 1
1: 0
2: 1
3: 14
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912926264 Original CRISPR GCATCATTCTGTTCAGGTAT AGG (reversed) Intergenic
902978423 1:20106202-20106224 GAATCATACTCTTCAGGTTTGGG + Intergenic
903705783 1:25284744-25284766 TCATCACACTGTTCAGGTATTGG + Exonic
903721454 1:25408676-25408698 TCATCACACTGTTCAGGTATTGG - Exonic
906717663 1:47982169-47982191 GCATCATCCAGTGCAGGGATGGG - Intronic
909286905 1:73830960-73830982 CCATCTTTCTGTTCTGGTACAGG + Intergenic
909450657 1:75795031-75795053 GCATCATTTAATTCATGTATGGG - Exonic
912926264 1:113915810-113915832 GCATCATTCTGTTCAGGTATAGG - Intergenic
920537754 1:206750601-206750623 TCCTGATTTTGTTCAGGTATCGG - Intergenic
922175159 1:223191568-223191590 GCAACATACTGTTTTGGTATTGG - Intergenic
1077875674 11:6302940-6302962 GCATTTTTCTGGTCAGGTAATGG - Intergenic
1078106182 11:8359516-8359538 GCATCATGCTGTTAAGACATGGG - Intergenic
1084700341 11:70782755-70782777 GCACCTTTCTGTGCATGTATTGG - Intronic
1085748870 11:79141449-79141471 TCATTAGTCTGTTCAGGTTTTGG - Intronic
1089742533 11:120594657-120594679 GCCTGATTTTGTTCAGATATAGG + Intronic
1091659048 12:2368911-2368933 GCACCATTCTGTTCATCTGTAGG - Intronic
1094301641 12:28970716-28970738 CCATCCTTCTTTCCAGGTATAGG - Intergenic
1096961284 12:55580444-55580466 GCATCACTCTGAGCAGCTATAGG + Intergenic
1098337355 12:69417529-69417551 GCAGCCTTATGTTCAGGCATCGG - Intergenic
1100891559 12:99131833-99131855 GCCTCCTTCTGTTCAGCCATGGG + Intronic
1101380849 12:104212642-104212664 GAAACATTCTTTTCATGTATAGG + Intergenic
1103991830 12:124804582-124804604 GCTTCATTCTTTGCTGGTATCGG - Intronic
1113370549 13:109721154-109721176 GGATCATTCTGTTCACTTAAAGG + Intergenic
1113770742 13:112906907-112906929 GCATCACACTGTTCAGGTGCTGG + Intronic
1114940954 14:27609416-27609438 AGATCATTCTGTTTTGGTATGGG - Intergenic
1115239424 14:31240202-31240224 GCATCAATCTATACAGGTGTTGG + Intergenic
1118406378 14:65427965-65427987 GCATGATTCTGTTTAGTAATGGG + Intronic
1120281560 14:82444928-82444950 GTATCAATGTGTTCAGCTATAGG + Intergenic
1131195889 15:90354522-90354544 GGACCATTCTGGTCAGGTGTGGG + Intronic
1142697276 17:1640419-1640441 GCACCATTCTGTTCAGGGTGGGG - Intronic
1145041613 17:19581702-19581724 TCATCATCCTGTTAAGGTAGAGG - Intergenic
1147357140 17:39906954-39906976 GCTTCATCCTGTTTAGGTAAGGG - Exonic
1151292194 17:73158295-73158317 GCATAATTATGTTCAGGATTTGG + Intergenic
1151764240 17:76124025-76124047 GCCTCATTTTCTTCAGCTATAGG + Intergenic
1153910919 18:9706371-9706393 GTCTCATTCTGATCAGGTCTTGG - Intergenic
1156100609 18:33590162-33590184 GCAGGATTCTATTTAGGTATTGG + Intronic
1165151498 19:33763364-33763386 GCATCAGACTGGTCATGTATTGG - Intronic
1166250618 19:41567935-41567957 GCATCATTTTGTTTTGGGATTGG + Intronic
1167535106 19:50045037-50045059 GCAGGATTCTGTTCAGGAAGGGG + Exonic
928868349 2:35945631-35945653 GCATCATTGGGTTCTGGTAAGGG + Intergenic
929286730 2:40143506-40143528 GAATCATTCTTTTCAGCTAATGG + Intronic
929754135 2:44749832-44749854 GCATCATTCTTTTTAGCTAAGGG - Intronic
932922835 2:75936855-75936877 GCATCCTTCAGTTTACGTATTGG + Intergenic
935741898 2:106156577-106156599 GCATCTTTGCGTTTAGGTATGGG - Intronic
937470667 2:122171575-122171597 GCAACACTCTGTACAGGTTTTGG - Intergenic
945276353 2:207991417-207991439 CCCTAATTTTGTTCAGGTATGGG + Intronic
1169414147 20:5401512-5401534 GCATTATTCTGTTCATAAATTGG + Intergenic
1169950839 20:11041511-11041533 GAAGGATTCTGTTCAGGTTTTGG - Intergenic
1171888274 20:30678095-30678117 GAATGATTCAGTTCAGCTATAGG - Intergenic
1176136114 20:63522688-63522710 GCATCATTCTGGCCTGGTATAGG + Intergenic
1177442092 21:21138906-21138928 TCATCATTTTGTTCAGGTTATGG + Intronic
1178563913 21:33665364-33665386 GCATCTATCTGTTCATGTACTGG - Intronic
1179098176 21:38334264-38334286 GCACCATTTTTTTCAGGTTTCGG - Intergenic
1179183233 21:39062538-39062560 GCATCTTTCGTCTCAGGTATGGG - Intergenic
1182192007 22:28471038-28471060 TCCTCATTCTGTTAAGGTCTGGG - Intronic
1184486847 22:44784971-44784993 GCACCACTCTGTGCAGGAATGGG - Intronic
951090847 3:18572425-18572447 GCAGGATTCAATTCAGGTATGGG - Intergenic
955094549 3:55784242-55784264 CCATCATTGTGTGGAGGTATAGG - Intronic
957601513 3:82340977-82340999 GTAACATTCTGTACAGGGATGGG + Intergenic
957686839 3:83513510-83513532 ACATAATTCTGGTGAGGTATTGG + Intergenic
959946246 3:112128408-112128430 AAATCATTTTTTTCAGGTATGGG + Intronic
960886904 3:122405189-122405211 GCATCATCCTATTCAGGGACAGG + Intronic
962799369 3:138877045-138877067 GCATCATTATTTTCATTTATGGG - Intergenic
966212727 3:177469828-177469850 GCATCCTTCGTTTCACGTATGGG + Intergenic
970543444 4:17102342-17102364 GCAGCATTCTGTGCAGGTTCAGG - Intergenic
970960327 4:21863602-21863624 GCCTCATTCTCTTCATGCATTGG - Intronic
972414670 4:38826655-38826677 TCATCATTCTCTTCAAGTCTGGG - Exonic
972820244 4:42693517-42693539 GCATCATTCTTATCAAGGATGGG - Intergenic
973327098 4:48873682-48873704 TTATCACTCTGTTCAGGTCTTGG + Intergenic
976016995 4:80567809-80567831 GCATCATTCTAATTATGTATTGG - Intronic
977504183 4:97880850-97880872 GCATCCTTCTGAACTGGTATTGG - Intronic
979911178 4:126367547-126367569 TCATCATCCTGTACAGATATGGG + Intergenic
987104074 5:14619667-14619689 GCACCATTAAGTTCAGGTACTGG - Intergenic
987271362 5:16312815-16312837 TCATCTTTCTGTTCAGATGTTGG - Intergenic
988838642 5:35060830-35060852 GCATTGTTCTCTTCAGGTTTAGG + Exonic
989821947 5:45802968-45802990 CCTTTATTCTGTTCAGGTAGAGG + Intergenic
990524653 5:56612886-56612908 GCATCCTTCTGCTAAGGGATGGG + Intergenic
992244623 5:74807781-74807803 GCATCATTTTGTTCATTTACTGG - Intronic
993138604 5:84001741-84001763 GCTTCAATCTATTCAGGTTTTGG - Intronic
996561051 5:124829842-124829864 GCTTCATTCTGCCCAGCTATAGG - Intergenic
998304628 5:141061587-141061609 GTATCTTTTTGTTCAGTTATTGG - Intergenic
1004579395 6:16934050-16934072 GCAGAATTCTGTTCAGGTTCTGG + Intergenic
1007530586 6:42538422-42538444 GGGTCAGTCTGTTCAGGTACTGG + Intergenic
1009563437 6:65277540-65277562 GCATGATTGAGTTCAGGTAAGGG - Intronic
1010639466 6:78305911-78305933 TCATCAGTCTGTTCAGGGTTTGG + Intergenic
1016157171 6:140824940-140824962 GTATCATTCTGTTCATGTTCTGG - Intergenic
1016272483 6:142304083-142304105 GCCTGATTCTTTTTAGGTATTGG + Intronic
1017479257 6:154833258-154833280 GGATCATTCTGTACTGGTATAGG - Exonic
1017728708 6:157295490-157295512 GAATGATTCTGTTCATGTCTTGG - Intronic
1019609033 7:1927254-1927276 GCTACATTGTGTTCATGTATCGG + Intronic
1019778237 7:2925052-2925074 GCTTCATTCTGTTCTTGAATTGG + Intronic
1021418280 7:20415681-20415703 GCATCATTCTGTTTAGTAGTAGG + Exonic
1028115769 7:86996012-86996034 GCTTCATTGTGTTAAGGTTTTGG - Intronic
1028902719 7:96119023-96119045 GCCTTATTCTGTTCAGGGATAGG - Intergenic
1030157188 7:106467194-106467216 GCTTCACGCTGTTAAGGTATAGG - Intergenic
1035078624 7:156198223-156198245 GCTTTATTCTGTTCCGGTGTTGG - Intergenic
1046022514 8:108682132-108682154 GGTTCATTATGCTCAGGTATTGG + Intronic
1046037645 8:108863306-108863328 GCATCATTATCTTCATGTATGGG - Intergenic
1048396491 8:134019003-134019025 CCATCCTTCTATTCAGGGATGGG + Intergenic
1050268613 9:3917917-3917939 CAATCATTCTTTTCAGTTATAGG - Intronic
1052086924 9:24279225-24279247 GTATCTTTCTGTTCAGGTCGAGG + Intergenic
1058625700 9:106930857-106930879 TCATCTTTCTGTTCAGGGAAAGG + Intronic
1061919201 9:133772931-133772953 CCATCATTCAGCTTAGGTATAGG - Intronic
1186834911 X:13428157-13428179 TCATCATTTTGTTCATGTACAGG + Intergenic
1187404851 X:18994036-18994058 GCAATAATCTGTTCAGATATTGG + Intronic
1194159192 X:90430014-90430036 ACATCATTCTGTTTTGGTCTGGG + Intergenic
1194226855 X:91271599-91271621 TTATCAGTCTGTTCAGGTTTTGG + Intergenic
1194942134 X:100023749-100023771 TTATCAGTCTGTTCAGGTTTTGG - Intergenic
1196942822 X:120794434-120794456 GCCTGATTCTGATGAGGTATGGG - Intergenic
1197472580 X:126881718-126881740 GGGGCATTCTGTACAGGTATTGG + Intergenic
1199143915 X:144342894-144342916 GCATTGGTCTGTTCAGGTTTTGG + Intergenic
1199815446 X:151393076-151393098 ACACCGTGCTGTTCAGGTATAGG + Intergenic
1200505498 Y:4006982-4007004 ACATCATTCTGTTTTGGTCTGGG + Intergenic