ID: 912929295

View in Genome Browser
Species Human (GRCh38)
Location 1:113942169-113942191
Sequence CTACTCAGGACAGGAGTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912929295_912929301 9 Left 912929295 1:113942169-113942191 CCTGCTACTCCTGTCCTGAGTAG 0: 1
1: 0
2: 0
3: 5
4: 129
Right 912929301 1:113942201-113942223 CAGGCACCTGCTACCACGCCCGG 0: 107
1: 3420
2: 19844
3: 55734
4: 103792
912929295_912929299 -10 Left 912929295 1:113942169-113942191 CCTGCTACTCCTGTCCTGAGTAG 0: 1
1: 0
2: 0
3: 5
4: 129
Right 912929299 1:113942182-113942204 TCCTGAGTAGCTGGGACTACAGG 0: 40895
1: 157395
2: 217955
3: 208005
4: 130380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912929295 Original CRISPR CTACTCAGGACAGGAGTAGC AGG (reversed) Intronic
902582517 1:17417262-17417284 GTTCTCAGGACTGGAGCAGCCGG - Intronic
905309543 1:37039830-37039852 TGACTGAGGACAGGAGGAGCAGG - Intergenic
907518941 1:55010725-55010747 TGACTCAGGACAGGAGTTCCTGG + Exonic
907786822 1:57620684-57620706 CTTCTCAGGCCAGCAGCAGCAGG + Intronic
910925991 1:92398747-92398769 CTGCACAGGAGAGGAGTGGCTGG - Exonic
911050685 1:93668431-93668453 GTGCTGAGGACAGGAGCAGCTGG - Intronic
911599246 1:99830468-99830490 CAAATCAGGCCTGGAGTAGCTGG - Intergenic
912929295 1:113942169-113942191 CTACTCAGGACAGGAGTAGCAGG - Intronic
913399446 1:118413103-118413125 CTACTCAGGAGTGGAATTGCTGG + Intergenic
915473986 1:156141754-156141776 CGCCTCAGGCCAGGAGTTGCTGG - Intergenic
917722329 1:177797502-177797524 CTAGTCAGGAAAGCAGCAGCAGG + Intergenic
917741297 1:177964218-177964240 CAACTCTGGACAGGAGTGGCCGG - Exonic
924797452 1:247302255-247302277 CAGCTCAGGACAGGAGAAGTTGG + Intronic
1066007454 10:31158723-31158745 CTACTCGGGAAATAAGTAGCTGG - Intergenic
1068379894 10:56238485-56238507 TTATTCAGGAAAGGAGTGGCTGG + Intergenic
1069578134 10:69545087-69545109 CTCCACAGGACAGGAGAAGCAGG - Intergenic
1073566696 10:104541334-104541356 CTACTCTGGAAGGGAGTAGTGGG - Intergenic
1075684583 10:124354598-124354620 CCACTGAGGACAGGTGAAGCTGG + Intergenic
1076898977 10:133327854-133327876 GGACTCAGGACAGGAGGAGAAGG - Intronic
1076986416 11:239562-239584 CTACCCAGGACAGAAGTGTCTGG - Intronic
1077007454 11:365016-365038 CGACTCAGGACAAGGGGAGCTGG - Intergenic
1077352484 11:2099361-2099383 CTACTCAGGGCTGCAGGAGCTGG - Intergenic
1080037079 11:27721283-27721305 CTACTCAGGCCAGGGGAATCGGG - Intronic
1080400379 11:31929717-31929739 GCAGTCAGAACAGGAGTAGCTGG + Intronic
1081607296 11:44535429-44535451 CCAGTGAGGACAGGAGAAGCCGG + Intergenic
1087290868 11:96318945-96318967 CTACACAGGATATGAGTACCAGG - Intronic
1087306897 11:96499524-96499546 GTAATCAGGACAGGAGGAGAAGG - Intronic
1088754699 11:112876205-112876227 CTAATCAGGGCTGGGGTAGCGGG + Intergenic
1092246082 12:6865060-6865082 AGACTCAGGACAGGAGTTTCAGG - Intronic
1092346847 12:7722477-7722499 CTCCTCAGCTCAGGAGTAGCTGG - Intergenic
1093832519 12:23780902-23780924 CTACTCTAGACATGAGGAGCTGG + Intronic
1098083991 12:66821713-66821735 CTACTTAAGAAAGGAGTTGCTGG - Intergenic
1098770888 12:74551697-74551719 CTACTCTGGATAGGAGGAACTGG + Intergenic
1105776550 13:23667468-23667490 CCACTGAGGACAGGAGGAGCAGG - Intronic
1107450286 13:40502253-40502275 CTGGTAAGGAGAGGAGTAGCAGG + Intergenic
1111514164 13:89306018-89306040 CTTCTAAGGATAGGAGAAGCAGG + Intergenic
1113447441 13:110380031-110380053 CCTCTCAGAACAGGACTAGCTGG - Intronic
1115108601 14:29791849-29791871 ATACTCAGGATTGGAATAGCTGG + Intronic
1120728083 14:87968979-87969001 GTTCTAAGGACAGGAGTAGTGGG - Intronic
1125924638 15:43552606-43552628 CTACTCAGGGGGTGAGTAGCTGG + Intronic
1128216279 15:65936446-65936468 CTACTGTGGACAGGAGCAGAAGG + Intronic
1129871229 15:78943041-78943063 CAACTCAGGACAAGAGTTGGAGG + Intronic
1132048872 15:98590491-98590513 CTACTGAGACCAGGAGAAGCAGG - Intergenic
1135119599 16:19754152-19754174 CTACCCAGGTCAGGAGCTGCAGG + Intronic
1137881461 16:52053237-52053259 CCACCCAGGACAGTAGTAGGAGG - Intronic
1139852115 16:69957274-69957296 CACCTCAGGTCCGGAGTAGCTGG + Intronic
1139881086 16:70180178-70180200 CACCTCAGGTCCGGAGTAGCTGG + Intronic
1140371419 16:74415340-74415362 CACCTCAGGTCCGGAGTAGCTGG - Intronic
1143235540 17:5396644-5396666 ATACTCAGGACTGGACTATCAGG + Intronic
1144282856 17:13744061-13744083 CTAGTCAGGACTGGGGGAGCTGG + Intergenic
1147442616 17:40456615-40456637 CTCCAGAGCACAGGAGTAGCAGG - Exonic
1149558803 17:57593703-57593725 CTAATTAGGACAAGTGTAGCAGG - Intronic
1151352686 17:73541112-73541134 CCACTTTGGCCAGGAGTAGCGGG - Intronic
1151636452 17:75352157-75352179 CTACACAGCTCAGGAGGAGCAGG + Intronic
1152543560 17:80989453-80989475 CTACGAAGGAGAGCAGTAGCAGG - Intergenic
1152659600 17:81536102-81536124 CTCCTCAGGACAGCAGGAGATGG - Intronic
1153799251 18:8655175-8655197 CTGCTGAGGACAGGAGTGGGGGG + Intergenic
1160629121 18:80233070-80233092 CTCCTCAGGAGATGAGCAGCTGG - Intronic
1161898147 19:7098104-7098126 GTACACAGGACAGGAATATCAGG - Intergenic
1162172770 19:8804487-8804509 CTACACAGGACAGGAATCTCAGG + Intergenic
1162331013 19:10029819-10029841 TCAATCGGGACAGGAGTAGCAGG - Intergenic
1162541718 19:11300528-11300550 CTGTTCTCGACAGGAGTAGCAGG - Intronic
1164076557 19:21824224-21824246 CTAATCAGGACAGGTGATGCAGG - Intronic
1164284609 19:23802342-23802364 CTAATCAGGACAGGAGATCCAGG + Intronic
926937916 2:18104508-18104530 CCTGTGAGGACAGGAGTAGCGGG - Intronic
927507448 2:23623615-23623637 CCCCACAGGGCAGGAGTAGCTGG - Intronic
931234989 2:60405751-60405773 CTACTTGGGGCAGGAGGAGCAGG + Intergenic
931669948 2:64638134-64638156 ACACTGAGGACAGGATTAGCAGG - Intronic
933969534 2:87458940-87458962 TCACTCAGGACAGGAGAATCAGG + Intergenic
935705928 2:105857504-105857526 CTACTCAGCACAGGCCTAGAGGG - Intronic
936324253 2:111491557-111491579 TCACTCAGGACAGGAGAATCAGG - Intergenic
942224011 2:173798755-173798777 CTCCCCAGGGCTGGAGTAGCTGG + Intergenic
945587249 2:211681372-211681394 ATACCCAGGAGAGGAGTGGCTGG + Intronic
945974926 2:216263021-216263043 GTGCTGAGGACAGGAGTAGGGGG + Intronic
947429950 2:230018863-230018885 CTACTCAGGACAGGAGGCTGAGG - Intergenic
947631489 2:231656266-231656288 CTACTCTGGAAAGGAGACGCAGG + Intergenic
948106961 2:235421973-235421995 CCTCTCAGGACAGGAGTTGGGGG - Intergenic
1169726187 20:8735371-8735393 CCATTCTGGACAGGAGCAGCAGG - Intronic
1173174791 20:40756304-40756326 CTACTCACGATAGCAGTGGCTGG + Intergenic
1174852328 20:54007182-54007204 CCAATCAGGACAGGAGCTGCGGG - Intronic
1179298095 21:40081277-40081299 CTCCACAGGACAGGAATAGAAGG - Intronic
1179910413 21:44444452-44444474 CCACTCAGGACCGCAGGAGCCGG + Intergenic
1182121009 22:27786749-27786771 CTCCTCAGGACAGGAAGAGGAGG - Intronic
1184068274 22:42132570-42132592 CCACTGAGGACAGGAGGACCGGG + Intergenic
1184423136 22:44393260-44393282 CTACTCAGGTCAAGACTGGCCGG + Intergenic
1184778493 22:46635111-46635133 TTCCCCAGGACAGGAGTGGCTGG - Intronic
1184778621 22:46635433-46635455 CCTCCCAGGACAGGAGTGGCCGG - Intronic
1184778659 22:46635525-46635547 CCTCCCAGGACAGGAGTGGCCGG - Intronic
1184778678 22:46635571-46635593 CCTCCCAGGACAGGAGTGGCCGG - Intronic
955039079 3:55297483-55297505 GTACTTAGGAGAGGACTAGCTGG - Intergenic
955412783 3:58666791-58666813 CTGCGCAGGGCAGGAGCAGCTGG - Exonic
959969367 3:112391728-112391750 CTACTCAGGAGAGGCCTGGCTGG + Intergenic
960302274 3:116017924-116017946 CTACTTGGGACAGGGGTAGGTGG + Intronic
963298585 3:143574496-143574518 CCCCTCAGGAAAGGTGTAGCAGG + Intronic
964632393 3:158825800-158825822 CTACTCAGCCCAGGGGTGGCAGG - Intronic
967086202 3:186097406-186097428 CTATTCAGGCCTGGAGTAGAGGG + Intronic
967267596 3:187704466-187704488 CTTCCCAGGACTGGAGTAGGTGG - Intronic
977328564 4:95607637-95607659 CTTCTCAGGGCAGCAGTAGACGG - Intergenic
978615458 4:110589453-110589475 TTACTCAGTACAGGAGTGCCAGG + Intergenic
980463855 4:133150203-133150225 CTACACGGTACAGGAGGAGCAGG + Exonic
983300833 4:165923542-165923564 CTACTCAGGACAGGAGGCTGAGG - Intronic
986836264 5:11641422-11641444 CTTCTCAGAACAGGAGTAAAAGG + Intronic
989030935 5:37117744-37117766 CTTCTGAGCCCAGGAGTAGCAGG + Intronic
997610592 5:135213099-135213121 CTGCTCAGGACTGGGGGAGCTGG - Intronic
999124757 5:149238967-149238989 CCACTCAGGGCAGAAGTGGCAGG - Intronic
1001154352 5:169260190-169260212 CTACTCAGGAAAGGGGTAAGAGG + Intronic
1002979502 6:2122056-2122078 CTACTAAGGTCAGGAACAGCTGG - Intronic
1007882468 6:45182686-45182708 CTACACAGGACAGGAATGGAAGG + Intronic
1013582672 6:111551708-111551730 CTTCTCAGGAGAGGAGAAACAGG - Intergenic
1014175362 6:118325891-118325913 CAATTCAGGACAGGAGTTGCAGG - Intergenic
1014699725 6:124669591-124669613 CTACTCAGGCCAGCATTATCTGG + Intronic
1015397560 6:132752144-132752166 CCACTGAGGAAAGTAGTAGCTGG + Intronic
1016138272 6:140574208-140574230 TTACTCAGGTCAGGAGGAACTGG + Intergenic
1017524518 6:155230945-155230967 CAACTCAGGTCCTGAGTAGCTGG + Intronic
1019420813 7:949925-949947 GTACCCAGGACTGGAGTTGCTGG - Intronic
1022888159 7:34667644-34667666 CTTCTAAAGACAGGAGTAGGTGG + Intronic
1028377832 7:90165919-90165941 CTTCTCAGTACTGGAGGAGCTGG - Intergenic
1033556744 7:142494764-142494786 CTTCTCAGAGCAGGAGTAGAGGG - Intergenic
1037611267 8:20478248-20478270 CTTATCAGGACAGCAGTCGCTGG - Intergenic
1037650716 8:20835983-20836005 CTACTCAAGACCAGAGTTGCTGG - Intergenic
1044204118 8:89471773-89471795 CAAAACAGGACAGGAGCAGCAGG - Intergenic
1045156505 8:99479910-99479932 CTACTTAGGAGTGGAATAGCTGG + Intronic
1047799630 8:128295128-128295150 CTACTCAGGACTGAGGTAGGAGG + Intergenic
1048758068 8:137760809-137760831 ATGCTCAGGACATGAGTAGATGG - Intergenic
1048967643 8:139625941-139625963 CTGTTCAGAACAGGAGAAGCTGG - Intronic
1050606419 9:7305956-7305978 CAGCACAGGAAAGGAGTAGCTGG - Intergenic
1051077217 9:13253427-13253449 ATCCTCAGTACAGGAGTATCAGG - Intronic
1052974644 9:34401663-34401685 CACCTCAGCAGAGGAGTAGCCGG + Exonic
1056132928 9:83603133-83603155 CTACTCAGGCAAGGAATAGTGGG - Intergenic
1058329574 9:103742610-103742632 CAACTCAGGATAGGAGTTCCAGG - Intergenic
1186712644 X:12216228-12216250 CAGCTCAGGACTGGAGCAGCCGG + Intronic
1189876990 X:45446807-45446829 CTACCCATTTCAGGAGTAGCTGG + Intergenic
1197944012 X:131818916-131818938 CTAATCAGGACAGGAAAAGAGGG - Intergenic
1201781770 Y:17730911-17730933 CACCTGAGGACAGGAGTTGCAGG + Intergenic
1201819783 Y:18175079-18175101 CACCTGAGGACAGGAGTTGCAGG - Intergenic