ID: 912930477

View in Genome Browser
Species Human (GRCh38)
Location 1:113954738-113954760
Sequence CACAGTGGGTACCCCAAATT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912930477 Original CRISPR CACAGTGGGTACCCCAAATT AGG (reversed) Exonic
902850728 1:19154143-19154165 CACAGTGGAGACTCCAAATGAGG - Intronic
905337977 1:37258349-37258371 CACAGTGGCTACACCTACTTTGG + Intergenic
905360048 1:37412882-37412904 CACAGTGGGGCCCACAAATCTGG + Intergenic
906960587 1:50417289-50417311 CACAGTGTGTACCCCAGCTTGGG - Intergenic
911969813 1:104417769-104417791 CACAGTGCCTAGCCTAAATTTGG + Intergenic
912930477 1:113954738-113954760 CACAGTGGGTACCCCAAATTAGG - Exonic
913538931 1:119800459-119800481 CACACTGGGCACCTCACATTCGG + Intronic
916408884 1:164525241-164525263 CACAGGGTGAACCCCAAAATTGG - Intergenic
919752923 1:201049293-201049315 CAAAATGGGTACCCCAAAATAGG + Intronic
920813964 1:209313733-209313755 CAGAGTAGGTACCCCAAAACTGG + Intergenic
923738043 1:236630514-236630536 CAAAATGGGTACCCCAAAGTTGG + Intergenic
924792583 1:247266459-247266481 CCCAGTGGGCACCCCAATTCCGG - Intergenic
1064090435 10:12378583-12378605 CACACTGGGTCCCACAAATCAGG + Intronic
1064520701 10:16198006-16198028 CACAGAGTGAACCCCAAAATTGG + Intergenic
1067849382 10:49745130-49745152 CACAGTGGGTACTGCAATGTGGG - Intronic
1068663227 10:59646145-59646167 CACAGTGGGTTGGCCAACTTGGG + Intergenic
1070657256 10:78279927-78279949 GGCAGGGGGTACCCCACATTGGG - Intergenic
1072705793 10:97679887-97679909 CACAATGGGTACCCCAGCCTCGG - Exonic
1073735781 10:106344383-106344405 CAAAGTGGCTACCACACATTAGG + Intergenic
1077863878 11:6207237-6207259 CACAGTGGTTATCCTAAAATAGG - Intronic
1081647226 11:44798554-44798576 CACTCTGGGGGCCCCAAATTTGG + Intronic
1081791316 11:45788435-45788457 CACAATGGGTAGTACAAATTTGG + Intergenic
1085034425 11:73291608-73291630 CAGAGTGGGAACCCAAAGTTTGG - Intronic
1088284698 11:108175306-108175328 CCCAGTGGGTGCCTGAAATTGGG - Intronic
1089356091 11:117854935-117854957 CAAAGTGGCTTCCCCAAATGAGG + Intronic
1089808666 11:121114335-121114357 CACATTGGGCACCCAAAGTTTGG + Intronic
1090967288 11:131610079-131610101 CACAGTGGGTAGCCCTAAATAGG + Intronic
1093414521 12:18905018-18905040 CACAGTGTGTCCCACTAATTAGG + Intergenic
1094871572 12:34601894-34601916 CACAGTGGGCAGCCCAAAGAGGG + Intergenic
1096185356 12:49576885-49576907 CTCAGTGACTACCCTAAATTGGG - Intronic
1100138814 12:91590767-91590789 TAGAGTGGGTACCACAAATAAGG + Intergenic
1101533827 12:105599332-105599354 CATAGAGGGCACCCCAAACTGGG - Intergenic
1101809672 12:108096757-108096779 CACAGAGGGTTGCCAAAATTAGG + Intergenic
1102497451 12:113329474-113329496 CAAGGTGGGTCCCCCAAATCTGG + Intronic
1111982375 13:95030386-95030408 CTCACTGGGAACCTCAAATTAGG + Intronic
1112616042 13:101006572-101006594 CACAGTAGTTACCCCAAAATAGG - Intergenic
1114304092 14:21405088-21405110 CTCAGTCCGCACCCCAAATTAGG + Intronic
1115833134 14:37364111-37364133 CACAGTGGGTAAGCCAAAGCAGG - Intronic
1120170775 14:81245860-81245882 CACAGTGGGTCAGCCAACTTGGG + Intergenic
1120350002 14:83342876-83342898 CACAGTGGGTACGCCCAATCAGG + Intergenic
1125861026 15:43000440-43000462 CACAGTGGCTCCCCCAAAATAGG - Intronic
1130272819 15:82461215-82461237 CACAGTGGGTTCCCCACAGGGGG - Intergenic
1130465169 15:84188568-84188590 CACAGTGGGTTCCCCACAGGGGG - Intergenic
1130487519 15:84406234-84406256 CACAGTGGGTTCCCCACAGGGGG + Intergenic
1130499096 15:84484968-84484990 CACAGTGGGTTCCCCACAGGGGG + Intergenic
1130574908 15:85083069-85083091 CACAGGGGGAACCCCAACATGGG - Intronic
1130587460 15:85193181-85193203 CACAGTGGGTTCCCCACAGGGGG - Intergenic
1131074723 15:89487778-89487800 CACAGTGTCTACCCCATAGTAGG + Intronic
1132117448 15:99147827-99147849 CTCTGTGGGAACTCCAAATTTGG + Intronic
1137630565 16:49940836-49940858 CACAGTGGGTTCCCCAGGTGTGG - Intergenic
1139967903 16:70755809-70755831 CTCAGTGTCTACCCCAAAATGGG - Intronic
1141812864 16:86387744-86387766 CACAATAGTTACCACAAATTGGG + Intergenic
1143902165 17:10182563-10182585 CACAGGGTGAACCCCAAAATTGG - Intronic
1143910909 17:10248019-10248041 CACAGAGAGTACCGCAAAGTCGG + Intergenic
1146140701 17:30365487-30365509 CACACTGGCTACCAGAAATTGGG + Intergenic
1150610590 17:66730251-66730273 CACAGGGTGAACCCCAAAATTGG + Intronic
1151515432 17:74591671-74591693 CACAGTGGATATACCACATTTGG - Intronic
1153066304 18:1049045-1049067 AACAGTGGATACCACAGATTGGG - Intergenic
1153493530 18:5674068-5674090 CACAGGGAGAACCCCAAAATTGG - Intergenic
1154269142 18:12904381-12904403 CACAGAGTGAACCCAAAATTGGG - Intronic
1155105905 18:22666222-22666244 GACAGTGGGGACTCCAAAATAGG + Intergenic
1163611057 19:18301802-18301824 CACAGTCAGGACCCCAAAATTGG - Intergenic
1165366450 19:35370382-35370404 GACAGTGGGGACTCCAAAGTGGG + Intergenic
1165773677 19:38392388-38392410 CACACCGGGTACACAAAATTGGG + Intronic
929134880 2:38614068-38614090 CACAGTGGGTAACACAAATGAGG + Intergenic
930771389 2:55133792-55133814 CACAGGGTGAACCCCAAAATTGG + Intergenic
931121167 2:59221762-59221784 CACAGGGTGAACCCCAAAATTGG + Intergenic
932466593 2:71928088-71928110 CACACTGCCTACCCCAAATCTGG + Intergenic
933066809 2:77808138-77808160 CCCAGTGGGTACCCCAAGTCCGG - Intergenic
936967690 2:118143064-118143086 GACACTGGGGACTCCAAATTGGG - Intergenic
942958865 2:181805980-181806002 GACAGTGGCTGCCCCAAGTTTGG + Intergenic
942993565 2:182232817-182232839 CTCAGTGGGAACCCCCAAGTTGG - Intronic
943432170 2:187817402-187817424 CACAGTGGCTTGCCCACATTGGG - Intergenic
1169521262 20:6375656-6375678 CACACTGGGAACTCCAAAATAGG + Intergenic
1170147286 20:13190133-13190155 CACAGTGGGGACTCCAAAAGAGG + Intergenic
1173544634 20:43885574-43885596 CACAGTGGGTTCAACAAATATGG - Intergenic
1175009418 20:55720122-55720144 CACAGTGTGAACCCTAAAATTGG + Intergenic
1178053299 21:28771194-28771216 CACAGTGGTGACCTCAAACTGGG - Intergenic
1179487343 21:41718875-41718897 CACAGTGGCTCCCCCAAACTTGG + Intergenic
1180938201 22:19639741-19639763 CACAGTGGGTGACCCAGGTTGGG - Intergenic
951712944 3:25603583-25603605 CAATGTGGGTTCCCCAGATTTGG + Intronic
955968397 3:64412561-64412583 CACAGTAGGGACCACAAAGTAGG + Intronic
956086489 3:65616526-65616548 CACAGTAGGTACCCAAAAGCTGG + Intronic
960431819 3:117578704-117578726 TACAGTGTGTATCCAAAATTGGG - Intergenic
960882052 3:122355130-122355152 CTGAGTGGTTACCACAAATTAGG - Intergenic
961243173 3:125429899-125429921 CACAATGGCTACCTCACATTTGG - Intergenic
963286242 3:143437147-143437169 CACAGTGGGTGCCCCATAGCAGG + Intronic
964242937 3:154616960-154616982 CACAGTGGTTAGGCCAACTTGGG - Intergenic
966600870 3:181773878-181773900 AACATTGGGCACCTCAAATTGGG - Intergenic
967149795 3:186637963-186637985 AACTGTGGCTACTCCAAATTGGG + Intronic
975412149 4:74066149-74066171 CACAGGGAGAACCCCAAAATTGG + Intergenic
979232352 4:118359742-118359764 CACAGGGTGAACCCCAAAATTGG - Intergenic
984816165 4:183838723-183838745 CACAATGGGTGCCCCAAGTGGGG - Intergenic
985872517 5:2568707-2568729 CACAGTGGGAACCCAAATGTGGG + Intergenic
988493054 5:31721246-31721268 CACAGTGAGTATGCCAGATTAGG + Intronic
990662316 5:58029847-58029869 CAGAGTGAGTACCCTAAAGTCGG + Intergenic
992173339 5:74125257-74125279 CAGAGTGGGTGCCACAAATCTGG - Intergenic
992757564 5:79922798-79922820 CACAGTGAGTACCTGAAATAGGG - Intergenic
993120258 5:83765991-83766013 CACAGGGAGAACCCCAAAATTGG - Intergenic
996836084 5:127794115-127794137 CAGTGTGAGTAACCCAAATTAGG + Intergenic
997233171 5:132258079-132258101 CACAGTGGCTCCCCCAGATGAGG - Intronic
999695151 5:154182286-154182308 CACAGTACCTACCCCAAAATAGG - Intronic
1001837876 5:174847264-174847286 CACATTGGGTACCCCACAGATGG - Intergenic
1013338696 6:109191883-109191905 CCCAGTGGGGACCCCATATAGGG - Intergenic
1017445860 6:154506676-154506698 CCCAGTGGGTTAACCAAATTGGG - Intronic
1022571008 7:31454287-31454309 CACAGTGGGTGGCCCATATCAGG - Intergenic
1023567940 7:41542129-41542151 CACAGTGGTTCCCCCAAAGATGG + Intergenic
1023731039 7:43192792-43192814 CACAGGGCGAACCCCAAAATTGG + Intronic
1024517921 7:50275702-50275724 CACAGTGTCTAGCACAAATTTGG + Intergenic
1025250317 7:57347455-57347477 CACAGTGGCAACCCCAAGTAGGG + Intergenic
1028192262 7:87867028-87867050 CCCAGTGGGTACCCCAAGTCTGG - Intronic
1034058650 7:148065452-148065474 AACACTGGGGATCCCAAATTTGG - Intronic
1038168571 8:25108028-25108050 CACCTTGGAAACCCCAAATTTGG + Intergenic
1043295335 8:78654629-78654651 CCCAGTGTGTACCCCAAGTCCGG - Intergenic
1043736854 8:83758943-83758965 AACAGTGGTTACCCGAAACTGGG + Intergenic
1045564249 8:103298241-103298263 CAGAGTTGGTACCCCAAACTAGG + Intergenic
1046181893 8:110660427-110660449 GACACTGGGGACCCCAAAATGGG + Intergenic
1046895927 8:119473362-119473384 CACATTGGGTACCCAGATTTTGG + Intergenic
1047159802 8:122365272-122365294 CACAGTGTATACCCCAAACTGGG + Intergenic
1048297684 8:133226716-133226738 CTCAGAGGGTTTCCCAAATTGGG + Intronic
1048762382 8:137809467-137809489 CTCAGAGGGTAGCCAAAATTTGG - Intergenic
1053423802 9:37997972-37997994 CACAGTGGGTACCACAAGCCAGG - Intronic
1055273078 9:74583517-74583539 CAAATTAGGTAACCCAAATTAGG + Intronic
1059981252 9:119774486-119774508 CACAGTGGGGACACCCAACTTGG + Intergenic
1061399937 9:130362837-130362859 CCCAGGGGGAAGCCCAAATTAGG - Intronic
1197394911 X:125915412-125915434 GACTGTGGGGACTCCAAATTGGG + Intergenic
1199172382 X:144746322-144746344 CCCAGTGGATACACCAAAATTGG + Intergenic
1202174576 Y:22085606-22085628 CCCAGTGGGTACCCCGAATCTGG - Intronic
1202216784 Y:22500776-22500798 CCCAGTGTGTACCCCGAATCTGG + Intronic
1202326403 Y:23695294-23695316 CCCAGTGTGTACCCCGAATCTGG - Intergenic
1202370065 Y:24190135-24190157 CACAGTGGGTTCCCCACAGTTGG + Intergenic
1202500719 Y:25479982-25480004 CACAGTGGGTTCCCCACAGTTGG - Intergenic
1202544369 Y:25974760-25974782 CCCAGTGGGTACCCCGAATCTGG + Intergenic