ID: 912936848

View in Genome Browser
Species Human (GRCh38)
Location 1:114011024-114011046
Sequence GCACCGCCTCCTGCTTCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912936838_912936848 3 Left 912936838 1:114010998-114011020 CCTCTCCCCACCCTTGCCGGCTC No data
Right 912936848 1:114011024-114011046 GCACCGCCTCCTGCTTCTCAGGG No data
912936841_912936848 -2 Left 912936841 1:114011003-114011025 CCCCACCCTTGCCGGCTCTGGGC No data
Right 912936848 1:114011024-114011046 GCACCGCCTCCTGCTTCTCAGGG No data
912936844_912936848 -7 Left 912936844 1:114011008-114011030 CCCTTGCCGGCTCTGGGCACCGC No data
Right 912936848 1:114011024-114011046 GCACCGCCTCCTGCTTCTCAGGG No data
912936834_912936848 28 Left 912936834 1:114010973-114010995 CCTACCATAGGCTGGACTCCTTT No data
Right 912936848 1:114011024-114011046 GCACCGCCTCCTGCTTCTCAGGG No data
912936836_912936848 10 Left 912936836 1:114010991-114011013 CCTTTTTCCTCTCCCCACCCTTG No data
Right 912936848 1:114011024-114011046 GCACCGCCTCCTGCTTCTCAGGG No data
912936835_912936848 24 Left 912936835 1:114010977-114010999 CCATAGGCTGGACTCCTTTTTCC No data
Right 912936848 1:114011024-114011046 GCACCGCCTCCTGCTTCTCAGGG No data
912936845_912936848 -8 Left 912936845 1:114011009-114011031 CCTTGCCGGCTCTGGGCACCGCC No data
Right 912936848 1:114011024-114011046 GCACCGCCTCCTGCTTCTCAGGG No data
912936843_912936848 -4 Left 912936843 1:114011005-114011027 CCACCCTTGCCGGCTCTGGGCAC No data
Right 912936848 1:114011024-114011046 GCACCGCCTCCTGCTTCTCAGGG No data
912936842_912936848 -3 Left 912936842 1:114011004-114011026 CCCACCCTTGCCGGCTCTGGGCA No data
Right 912936848 1:114011024-114011046 GCACCGCCTCCTGCTTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912936848 Original CRISPR GCACCGCCTCCTGCTTCTCA GGG Intergenic