ID: 912937597

View in Genome Browser
Species Human (GRCh38)
Location 1:114017429-114017451
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912937594_912937597 15 Left 912937594 1:114017391-114017413 CCTGAATGTGGGTGTGTAATACA No data
Right 912937597 1:114017429-114017451 GTGTCTAAATTGCTGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr