ID: 912941697

View in Genome Browser
Species Human (GRCh38)
Location 1:114050844-114050866
Sequence CAGGTAATTAGCAGAAATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912941693_912941697 20 Left 912941693 1:114050801-114050823 CCTCATGGTGCTGTCTATTGAGT No data
Right 912941697 1:114050844-114050866 CAGGTAATTAGCAGAAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912941697 Original CRISPR CAGGTAATTAGCAGAAATGT AGG Intergenic
No off target data available for this crispr