ID: 912943810 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:114068168-114068190 |
| Sequence | GACAGCTTTTAGCCTGTTAC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 912943810_912943812 | 11 | Left | 912943810 | 1:114068168-114068190 | CCAGTAACAGGCTAAAAGCTGTC | No data | ||
| Right | 912943812 | 1:114068202-114068224 | GAGTAGTTATCTGCAGAAGATGG | 0: 178 1: 192 2: 102 3: 110 4: 247 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 912943810 | Original CRISPR | GACAGCTTTTAGCCTGTTAC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||