ID: 912943810

View in Genome Browser
Species Human (GRCh38)
Location 1:114068168-114068190
Sequence GACAGCTTTTAGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912943810_912943812 11 Left 912943810 1:114068168-114068190 CCAGTAACAGGCTAAAAGCTGTC No data
Right 912943812 1:114068202-114068224 GAGTAGTTATCTGCAGAAGATGG 0: 178
1: 192
2: 102
3: 110
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912943810 Original CRISPR GACAGCTTTTAGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr