ID: 912945303

View in Genome Browser
Species Human (GRCh38)
Location 1:114079584-114079606
Sequence TCTGACAGGCTCCCCATGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912945296_912945303 3 Left 912945296 1:114079558-114079580 CCCCTCTTGGCTGTAGGTGCCTC No data
Right 912945303 1:114079584-114079606 TCTGACAGGCTCCCCATGATGGG No data
912945297_912945303 2 Left 912945297 1:114079559-114079581 CCCTCTTGGCTGTAGGTGCCTCC No data
Right 912945303 1:114079584-114079606 TCTGACAGGCTCCCCATGATGGG No data
912945298_912945303 1 Left 912945298 1:114079560-114079582 CCTCTTGGCTGTAGGTGCCTCCT No data
Right 912945303 1:114079584-114079606 TCTGACAGGCTCCCCATGATGGG No data
912945295_912945303 6 Left 912945295 1:114079555-114079577 CCTCCCCTCTTGGCTGTAGGTGC No data
Right 912945303 1:114079584-114079606 TCTGACAGGCTCCCCATGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912945303 Original CRISPR TCTGACAGGCTCCCCATGAT GGG Intergenic
No off target data available for this crispr