ID: 912948644

View in Genome Browser
Species Human (GRCh38)
Location 1:114105493-114105515
Sequence TACCCCCAGCTTCCCAGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 221}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912948633_912948644 28 Left 912948633 1:114105442-114105464 CCCGAAAAAAGTCACCCCCCAAA 0: 1
1: 0
2: 0
3: 15
4: 189
Right 912948644 1:114105493-114105515 TACCCCCAGCTTCCCAGGAAGGG 0: 1
1: 0
2: 1
3: 16
4: 221
912948632_912948644 29 Left 912948632 1:114105441-114105463 CCCCGAAAAAAGTCACCCCCCAA 0: 1
1: 0
2: 0
3: 8
4: 99
Right 912948644 1:114105493-114105515 TACCCCCAGCTTCCCAGGAAGGG 0: 1
1: 0
2: 1
3: 16
4: 221
912948640_912948644 10 Left 912948640 1:114105460-114105482 CCAAATCAAATTCTAGGAACAGC No data
Right 912948644 1:114105493-114105515 TACCCCCAGCTTCCCAGGAAGGG 0: 1
1: 0
2: 1
3: 16
4: 221
912948637_912948644 13 Left 912948637 1:114105457-114105479 CCCCCAAATCAAATTCTAGGAAC No data
Right 912948644 1:114105493-114105515 TACCCCCAGCTTCCCAGGAAGGG 0: 1
1: 0
2: 1
3: 16
4: 221
912948639_912948644 11 Left 912948639 1:114105459-114105481 CCCAAATCAAATTCTAGGAACAG No data
Right 912948644 1:114105493-114105515 TACCCCCAGCTTCCCAGGAAGGG 0: 1
1: 0
2: 1
3: 16
4: 221
912948636_912948644 14 Left 912948636 1:114105456-114105478 CCCCCCAAATCAAATTCTAGGAA No data
Right 912948644 1:114105493-114105515 TACCCCCAGCTTCCCAGGAAGGG 0: 1
1: 0
2: 1
3: 16
4: 221
912948631_912948644 30 Left 912948631 1:114105440-114105462 CCCCCGAAAAAAGTCACCCCCCA No data
Right 912948644 1:114105493-114105515 TACCCCCAGCTTCCCAGGAAGGG 0: 1
1: 0
2: 1
3: 16
4: 221
912948638_912948644 12 Left 912948638 1:114105458-114105480 CCCCAAATCAAATTCTAGGAACA No data
Right 912948644 1:114105493-114105515 TACCCCCAGCTTCCCAGGAAGGG 0: 1
1: 0
2: 1
3: 16
4: 221
912948634_912948644 27 Left 912948634 1:114105443-114105465 CCGAAAAAAGTCACCCCCCAAAT 0: 1
1: 0
2: 0
3: 21
4: 192
Right 912948644 1:114105493-114105515 TACCCCCAGCTTCCCAGGAAGGG 0: 1
1: 0
2: 1
3: 16
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912948644 Original CRISPR TACCCCCAGCTTCCCAGGAA GGG Intronic
900076993 1:825954-825976 CAGCACCAGCTTCACAGGAATGG + Intergenic
900436624 1:2634114-2634136 CACTCCCAGCTCCCCAGAAAGGG - Intergenic
903959548 1:27047968-27047990 GACCACATGCTTCCCAGGAAAGG - Intergenic
904598014 1:31658829-31658851 TCCCCCCAGCTTCCTCTGAATGG + Intronic
905305442 1:37014652-37014674 TATCTCTAGCTTCCCAGCAAAGG - Intronic
906197375 1:43937260-43937282 AACCCCCTGCTGCCCAGGAAAGG - Intergenic
907547329 1:55273511-55273533 TACCCCCAGTGTGCCAGCAAAGG - Intergenic
907936540 1:59046958-59046980 AAGCCCCAGCTTCCCAGAACCGG - Intergenic
908067972 1:60427838-60427860 TACCCCCTACTGCTCAGGAAAGG - Intergenic
909458192 1:75874440-75874462 TACTCCCAGCTACTCAGGAAAGG - Intronic
912948644 1:114105493-114105515 TACCCCCAGCTTCCCAGGAAGGG + Intronic
914228952 1:145747031-145747053 TACTCCCAGCTTCTCAGGCCAGG - Intronic
914705419 1:150166173-150166195 CACCACCTGCTGCCCAGGAAAGG + Intergenic
915883593 1:159700267-159700289 TGAACCCAGCTTCCCAGCAAAGG + Intergenic
916206756 1:162322392-162322414 TTCCCCAAGCTTCCCAGGGGTGG - Intronic
917134076 1:171771672-171771694 AACCCCAAGGTTCTCAGGAATGG - Intergenic
917450918 1:175146724-175146746 TAACCCCAGCTGCCCAGCAGAGG + Intronic
918387596 1:184025767-184025789 TACCACGAGCTTCCTAGAAAAGG + Intronic
918652008 1:186976932-186976954 TATAACCAGCTTACCAGGAAGGG + Intronic
920437715 1:205958786-205958808 GCCCTGCAGCTTCCCAGGAAAGG + Intergenic
922913228 1:229234638-229234660 TACACCCAGCAGCCCTGGAATGG - Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
923939162 1:238800890-238800912 TACTCCCAGCTACTCAGGCAGGG + Intergenic
1064205617 10:13321215-13321237 TAGCCCCAGCCTCCCAAAAACGG - Intronic
1065178897 10:23105450-23105472 TACCCCCTGCTTTCCAGGGTAGG + Intronic
1065708790 10:28495500-28495522 GAGCCCCTGCCTCCCAGGAAGGG + Intergenic
1066525047 10:36268517-36268539 TTCCAGCAGCTTCCCAAGAAAGG - Intergenic
1069566350 10:69465963-69465985 TAGCACCAGCTTCCCAGGGCAGG + Intronic
1069691826 10:70358717-70358739 TAGCCCCACCTCCCCAGAAAGGG + Intronic
1071524229 10:86348950-86348972 TAGCCCCTGCTCACCAGGAAGGG + Intronic
1071600874 10:86958214-86958236 TGTCCCCAGCTTCCTAGGTAGGG - Intronic
1071991610 10:91105331-91105353 AGCCCCCAGTTTCCCAGAAATGG + Intergenic
1074095267 10:110305858-110305880 AACTCCCAACCTCCCAGGAAAGG - Intergenic
1074579443 10:114704681-114704703 ACCCCACAGCCTCCCAGGAAGGG - Intergenic
1074906161 10:117865692-117865714 TCCCCCCAGCTTCCCAGAGTTGG + Intergenic
1075244051 10:120804713-120804735 TTCCTCCAGCTTCCCAGGCATGG + Intergenic
1075782398 10:125026038-125026060 TCCCCCCAGGTCCCCAGGCAGGG + Intronic
1076887660 10:133269961-133269983 TACCCCCAGGTTTGCTGGAAAGG - Exonic
1076893362 10:133296036-133296058 CACACTCAGCATCCCAGGAAAGG - Intronic
1077386587 11:2272100-2272122 TGCCCCCAGGCTCCCAGGAGGGG - Intergenic
1081408453 11:42725973-42725995 TACCTCCAGTTTACCTGGAAAGG + Intergenic
1081749418 11:45499255-45499277 TTCCCCCACCATCCCAGGTATGG + Intergenic
1083041521 11:59691962-59691984 TAGCCCCAGCTACTCAGGATGGG - Intergenic
1083200432 11:61118166-61118188 GACCCCCAGATTTCCAGGCAAGG + Exonic
1083811162 11:65107759-65107781 TAGCCCCAGAGCCCCAGGAAAGG - Intronic
1085305177 11:75481770-75481792 TGCCCCCGCCTCCCCAGGAAGGG + Intronic
1089319306 11:117614040-117614062 TCCTCCCACCTTTCCAGGAAAGG - Intronic
1089352991 11:117831938-117831960 CACCACCAGCTTCCCAGAATGGG + Intronic
1092246181 12:6865736-6865758 AACCCCCTGCCTCCCTGGAATGG + Intronic
1094686804 12:32725339-32725361 TACCTTCTGCTTCCCTGGAAAGG - Intronic
1096104043 12:48986451-48986473 TACCCTCAGCATCCCAAGAATGG - Intergenic
1096470120 12:51870292-51870314 CACCCACAGCTTCCCTGCAAAGG + Intergenic
1096935631 12:55270818-55270840 TGCCCCCAACTTACAAGGAAAGG - Intergenic
1097246474 12:57610296-57610318 TACCCCCTCCTGCCCAGGGAGGG - Exonic
1098894910 12:76047692-76047714 TACCTTCTGCTTCCCTGGAAAGG - Exonic
1102901020 12:116636972-116636994 TACCCCCAGCTTGCCACCATAGG - Intergenic
1102942879 12:116959500-116959522 ACCCCCCAGCTTGCTAGGAAGGG + Intronic
1103252849 12:119515774-119515796 GACCTCCAGCTTCCCTAGAAAGG - Intronic
1105625655 13:22110353-22110375 GACACACAGCCTCCCAGGAAGGG - Intergenic
1105944198 13:25175787-25175809 CAGCCTCAGCTTCCCAGGCAAGG - Intergenic
1106138587 13:26992476-26992498 AACCCACACCTGCCCAGGAAAGG + Intergenic
1106534211 13:30624496-30624518 TAGCCCCAGCTACCCGGGAGGGG + Intronic
1107652747 13:42560930-42560952 TACTGCCAGCCTTCCAGGAAAGG - Intergenic
1108082618 13:46752418-46752440 TCCCCCCATCTTCCCAAGAGTGG - Intronic
1108436119 13:50403217-50403239 TATCACCAGCTTCCCAGCAAAGG - Intronic
1109358116 13:61259222-61259244 GACCCCCTGCTCCCCAGTAAAGG - Intergenic
1112655353 13:101446600-101446622 TTCTATCAGCTTCCCAGGAAGGG + Intergenic
1113014567 13:105814028-105814050 TGCCCCAAGCTTCCCATTAAGGG + Intergenic
1117456630 14:55904164-55904186 TATCCCCAGCCTTCCAGGATCGG - Intergenic
1118154491 14:63225326-63225348 TGCCTCCAGCTTTCCAGGAGAGG + Intronic
1118169182 14:63369332-63369354 CACCCCCAGTCTCCCAGTAATGG + Intergenic
1118810859 14:69272241-69272263 TAATCCCAGCTACTCAGGAAGGG + Intronic
1118943536 14:70361056-70361078 TACCTCCAGAAACCCAGGAACGG + Intronic
1121122419 14:91384385-91384407 TACCTTCCGCTTCCCTGGAAAGG - Intronic
1121678886 14:95776433-95776455 TACTCACACCTTCCCAAGAAAGG + Intergenic
1121924370 14:97914524-97914546 AACCCCCATCTTCTCAGGAAGGG - Intergenic
1123114848 14:105890049-105890071 GAGCCCAGGCTTCCCAGGAACGG + Intergenic
1127165425 15:56240958-56240980 TACCCCCTGCTCCACAAGAATGG - Intronic
1127825663 15:62700568-62700590 TCCCCTCATCTTACCAGGAAAGG + Intronic
1128529319 15:68432948-68432970 TTCCCCCACTTTCTCAGGAAAGG + Intergenic
1129943531 15:79519244-79519266 TAACCGGAGCTCCCCAGGAAAGG + Intergenic
1130052905 15:80498618-80498640 TCCCCCGAGTCTCCCAGGAATGG + Intronic
1130320707 15:82838349-82838371 TACCCCCTACTTCCCAGCAGTGG - Intronic
1130746050 15:86655025-86655047 TACTCACAGCTTGCCAGAAAAGG + Intronic
1131669280 15:94601954-94601976 ATCCCACAGCATCCCAGGAACGG - Intergenic
1132661675 16:1064302-1064324 AGCCCCCAGCTTCCCAGGGCGGG - Intergenic
1132744046 16:1429409-1429431 GACCCCCAGCTTCCAGGGAAGGG - Intergenic
1133203168 16:4217055-4217077 TCCCTCCAGCTTCCCTGGATTGG - Intronic
1135648875 16:24188037-24188059 AACCCCCAGCTGTCCAGGCAGGG - Intronic
1138328542 16:56193979-56194001 CACTCCCACCTTCCCACGAAAGG - Intronic
1138387270 16:56644189-56644211 AGCCCCCAGATTCCCAGGGAAGG - Intronic
1138540075 16:57682589-57682611 TACCACCAGCTCCCCAGGGTGGG + Intronic
1140457772 16:75114790-75114812 TGCCCTCAGGGTCCCAGGAAAGG + Intronic
1142891642 17:2947794-2947816 TTTCCCCAGCTTTCCAGAAACGG + Intronic
1143674456 17:8421797-8421819 TACCCTCACCCTCCCAGGAGAGG + Intronic
1143855261 17:9843544-9843566 TCCCCATGGCTTCCCAGGAAAGG + Intronic
1144029116 17:11304081-11304103 TACCCAAAGCTTCCCAGGAAAGG - Intronic
1146075371 17:29723893-29723915 TACACCCAACTTCTCAGAAAAGG - Intronic
1146373654 17:32280549-32280571 TGCTCCCAGCTTCGCAGCAAGGG + Intronic
1146901742 17:36593208-36593230 TACCGCAAGCTAGCCAGGAAGGG + Intronic
1147287177 17:39411500-39411522 TAATCCCAGCTACTCAGGAAGGG + Intronic
1147650343 17:42058442-42058464 TAGCCTCAGCCTCCCTGGAATGG + Intronic
1148204159 17:45769161-45769183 TTCCCCCTGTCTCCCAGGAAAGG - Intergenic
1148242656 17:46010696-46010718 TATTCTCAGCTTCCCAGGCAGGG - Intronic
1148868580 17:50642323-50642345 TACCCCCTGCCTCCTAGGGAGGG + Intronic
1149989777 17:61376462-61376484 TTACCCCAGATACCCAGGAAGGG + Intronic
1153567228 18:6430529-6430551 CAACCCCACCTACCCAGGAAGGG - Intergenic
1155062692 18:22242621-22242643 CACCCCCAGATTCCCAGGTTCGG - Intergenic
1155240513 18:23859830-23859852 TACCCCCAACCTCTGAGGAAGGG - Intronic
1157398019 18:47359598-47359620 TAATCCCAGCTACTCAGGAATGG - Intergenic
1157599544 18:48885659-48885681 AACCCCCAGCCTCCCAAGATGGG + Intergenic
1157710997 18:49849698-49849720 TACCCCCACCATCCCAGGCCGGG - Intronic
1158131180 18:54153971-54153993 TACCTCCAGTTTCCAAGGCAGGG - Exonic
1161271647 19:3392882-3392904 TGCCCCGAGTTGCCCAGGAAGGG + Intronic
1161358872 19:3834869-3834891 TTCCCCCAGCTGCCCCGGCAGGG - Exonic
1161590894 19:5128709-5128731 TGCTCCCAGCCTCCCAGGGAGGG + Intronic
1161874630 19:6898467-6898489 TGCCCTCAGGTTCCCAGGGATGG + Intronic
1163025733 19:14510732-14510754 TCCCCGCAGCATCTCAGGAAAGG + Intergenic
1163152037 19:15421357-15421379 TAATCCCTCCTTCCCAGGAAGGG + Exonic
1164592972 19:29516270-29516292 CAGCCCCAGCTCCCCAGGCACGG + Intergenic
1164899213 19:31904046-31904068 TAACACCAGCTTCCCTGGAGAGG + Intergenic
1166480695 19:43170593-43170615 TTCCCACAGGCTCCCAGGAAGGG + Intronic
1167559034 19:50214457-50214479 TGCCCCAAGGGTCCCAGGAAAGG - Intronic
1168099187 19:54132014-54132036 TACGCCCAGGTGCCCAGGACTGG + Intergenic
1168134090 19:54338790-54338812 CACCCCCAGCTGCCCAGGGGTGG + Intronic
925156338 2:1651363-1651385 TGGCCCCAGTTTCCCAGGACTGG + Intronic
925347028 2:3178708-3178730 CATCCTTAGCTTCCCAGGAATGG - Intergenic
927184557 2:20473096-20473118 TGAGCCCAGCTTCCCATGAAGGG + Intergenic
927433968 2:23051465-23051487 TAACCCCTGTCTCCCAGGAAGGG - Intergenic
927575733 2:24200606-24200628 TGTCCCCAGCAGCCCAGGAACGG - Intronic
937472507 2:122186320-122186342 AACTCCCAGCATCCCAGGACAGG - Intergenic
937958652 2:127438183-127438205 TACCCACAGCCTCCCCGGCATGG - Intronic
939845744 2:147244360-147244382 CATCCCCAGGTTCCCAGTAATGG + Intergenic
941403601 2:165061691-165061713 TACCCCCAGCCTGCAAGCAATGG - Intergenic
942988202 2:182166478-182166500 TACCAACAGCCTCCCGGGAAGGG + Intronic
945251483 2:207769197-207769219 AACCCTCAGCTTCCCGGAAAAGG + Intronic
948129197 2:235587886-235587908 TCCCTGCAGCTTCCCATGAACGG + Intronic
948463536 2:238141551-238141573 TCCTCCCTGCTTCCCAGGGATGG - Intronic
948814345 2:240502285-240502307 CACCCCCAGGCTCCCAGGACTGG + Intronic
948816480 2:240512886-240512908 TACCCCCTCCTCCCCAGGAAGGG + Exonic
1170604261 20:17863934-17863956 TGCCCCCACCTTCTTAGGAAGGG + Intergenic
1173264485 20:41466835-41466857 TACTCCCAGCCTCCCAGGGATGG + Intronic
1173675943 20:44835804-44835826 CACCACCTGCTTCCCAGGAAGGG + Intergenic
1176058756 20:63162582-63162604 TAGCCCCTGCCTGCCAGGAAGGG + Intergenic
1180231678 21:46430246-46430268 TCCCGCCAGTGTCCCAGGAAGGG - Intronic
1182532093 22:30968696-30968718 TACTCCCGGCTTCCAAGGACCGG + Intergenic
1183250876 22:36729559-36729581 TAGCTCCAGCTTCCCAGGCTTGG + Intergenic
1184951135 22:47843336-47843358 TACCTCCAGCCTCCAAGGCAGGG + Intergenic
1185105729 22:48868729-48868751 GGCCCGCAGCTTCCCAGGAAAGG + Intergenic
1185176837 22:49332651-49332673 CAACCCCAGCTTCACAGGATGGG - Intergenic
1185288308 22:50012014-50012036 TGTACCCAGCATCCCAGGAAGGG - Intronic
949414671 3:3800970-3800992 GAGCCCCAGCTTGCCAGGCAGGG - Intronic
952388766 3:32861960-32861982 TATCCACTGCTTCCCAGGATTGG + Intronic
954112820 3:48444915-48444937 TACCTCCTGCTGCCCAGGACTGG + Intergenic
955347016 3:58168689-58168711 CACAACCAGCTCCCCAGGAAGGG - Intronic
955410666 3:58653507-58653529 CACCCCCAGACTACCAGGAAGGG - Intronic
955773020 3:62405191-62405213 TACCCCCAGCCTCCTGGGATTGG + Intronic
960738568 3:120807450-120807472 TACCTTCTGCTTCCCTGGAAAGG + Intergenic
960884717 3:122382925-122382947 TACCCAGAGCTTCCCAGACAAGG + Intronic
961592627 3:127992047-127992069 TTTACCCAGTTTCCCAGGAAGGG - Intergenic
968511668 4:998335-998357 CACCCCCAGCTCCACAGCAAAGG - Intronic
969015189 4:4099222-4099244 AGCCCCCAACTTACCAGGAAGGG - Intergenic
969033054 4:4228571-4228593 GATCCCCAGCTTCCCAGTGAGGG - Intergenic
980911169 4:138995942-138995964 TACCCACATCTTCCCAGGTGTGG + Intergenic
982727454 4:158920581-158920603 TACCCTCAGCTTACTAGGATGGG + Intronic
986495907 5:8341111-8341133 TAACACTAGCTTCCCAGCAATGG + Intergenic
992547090 5:77823618-77823640 TTTCCCCAACTTCCCAGGTAAGG + Intronic
993622362 5:90183745-90183767 TAAACCCAGCTTCCAAGGGATGG + Intergenic
993898314 5:93565293-93565315 TACCCCCAACTTCACAGGTGAGG + Intergenic
997240535 5:132303506-132303528 TCCCATCAGCTTCCAAGGAAGGG + Intronic
997847495 5:137301187-137301209 CTCCTCCACCTTCCCAGGAAAGG + Intronic
998411876 5:141917381-141917403 TTCCCCAAGCCACCCAGGAAAGG - Intergenic
999226301 5:150027670-150027692 TAATCCCAGCTACTCAGGAAAGG - Intronic
1002288271 5:178180139-178180161 CGCCCCCAACCTCCCAGGAAGGG - Intergenic
1004233260 6:13851546-13851568 TACTCCCAGATTCCTAGAAATGG - Intergenic
1005755304 6:28920745-28920767 TACCCCCAGCCTCCCAGGCCAGG - Intronic
1006792928 6:36715555-36715577 TACCACCAGCTTCCCAGCTCTGG + Exonic
1007134294 6:39506822-39506844 TACCCTCATCTTCACAGGAAGGG + Intronic
1008085045 6:47235604-47235626 TACACTCAGCTTCACAGGGAAGG + Intronic
1010348496 6:74841859-74841881 TTCCCACAGCTTCTCAGGCATGG - Intergenic
1010364982 6:75040536-75040558 TCCCCGCTTCTTCCCAGGAAGGG + Intergenic
1010451420 6:76008141-76008163 TAATCCCAGCTTCACAGAAAAGG + Intronic
1010688560 6:78880040-78880062 TACACTCAACTGCCCAGGAATGG - Intronic
1011584646 6:88911256-88911278 TACCCCCAGCCTCAAAGTAAAGG + Intronic
1014650067 6:124025360-124025382 TACCCCCAGCTCTAGAGGAATGG + Intronic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1017983476 6:159422595-159422617 TGCCTCCTGCTTCCCAGCAATGG - Intergenic
1018279681 6:162172258-162172280 GACCCCAAGCTACCCAGGGATGG + Intronic
1022172642 7:27844459-27844481 TACCTCCTGCTTTCCAGGAATGG - Intronic
1023310442 7:38881192-38881214 TCCCCCCAGCTTCCAGGGGAGGG - Intronic
1025733156 7:64124311-64124333 TGCCCCCAGATTTCCAGGGATGG + Intronic
1031016639 7:116582676-116582698 GACCCCCTCCTTCCTAGGAATGG - Intergenic
1032005864 7:128301600-128301622 TACCCACGACTACCCAGGAAAGG + Exonic
1032520251 7:132538359-132538381 CATCACCAGCTTCACAGGAAGGG + Intronic
1034222277 7:149455717-149455739 GCCCCCTGGCTTCCCAGGAAGGG - Exonic
1034468596 7:151244076-151244098 CACCCCCTGCTTTCCAGAAAAGG - Intronic
1034760735 7:153669469-153669491 AACCCCGTGCCTCCCAGGAATGG - Intergenic
1034936844 7:155205430-155205452 TCCCCCGAGCTTCCCAGTGACGG + Intergenic
1034964703 7:155383977-155383999 AACCCCCTGCTTCCCAGGAGGGG + Intronic
1035516175 8:233922-233944 AAGCACCAGCTTCACAGGAATGG - Intronic
1036446169 8:8823082-8823104 TATCCCCAGATTCCAAGGATGGG - Intronic
1036783347 8:11666358-11666380 TAGTCCCAGCTACTCAGGAAGGG + Intergenic
1037604116 8:20423029-20423051 GACCCTCCGCCTCCCAGGAAGGG + Intergenic
1037793353 8:21967905-21967927 TCCCCCCAGGGTCCCATGAAAGG + Intronic
1038367891 8:26955321-26955343 TTCCCCCAGATTTGCAGGAAGGG + Intergenic
1038699553 8:29837007-29837029 TACCTCCAGCTGCCCAGCATGGG + Intergenic
1040063007 8:43120614-43120636 TACCCCCAGCTACTCAGGGGAGG - Intronic
1040409708 8:47141850-47141872 CACCCCCAGCTTTCCAGCCATGG + Intergenic
1041598731 8:59689692-59689714 TAATCCCAGCTACTCAGGAAAGG + Intergenic
1042962357 8:74317480-74317502 TACCGCCATCTTAACAGGAATGG + Intronic
1043914754 8:85908761-85908783 AGCCCACAGCTTCCCAGGTAAGG - Intergenic
1044501745 8:92965949-92965971 GACCCCGAGCTTCCCGGGCAGGG + Intronic
1046103759 8:109644037-109644059 TTCCACCGGCTTACCAGGAAGGG + Intronic
1049783958 8:144441711-144441733 TACCCCTAGCCTCCCAGGGTGGG - Intronic
1051269747 9:15343958-15343980 CCACCCCAGCTTCCCAAGAATGG + Intergenic
1051610863 9:18960212-18960234 TACCCCACGCGTCCCAGGGATGG - Intronic
1052535230 9:29737831-29737853 TAGCCCCAGCTACTCAGGAGAGG + Intergenic
1057465738 9:95312796-95312818 TACCCACTTCTTCCCAGAAATGG + Intronic
1059311613 9:113392123-113392145 TATCACCAGCCTCCCAGGAGTGG - Exonic
1060266131 9:122112384-122112406 TACCCACAGCTGCCCTGGGAGGG + Intergenic
1060426458 9:123510715-123510737 TACCCACTGCTTCCAAGGATAGG + Intronic
1060535881 9:124387656-124387678 TGCTCCCAGCTTTTCAGGAAAGG + Intronic
1060832512 9:126725475-126725497 TAATCCCAGCTACTCAGGAAAGG - Intergenic
1061041290 9:128142266-128142288 TACCCTGAGCTACACAGGAAGGG + Intergenic
1061041814 9:128144956-128144978 AGCCCCCAGCACCCCAGGAAAGG - Intergenic
1061619865 9:131804932-131804954 CAGCCCTAGCTTCCCAGGCATGG + Intergenic
1061747716 9:132752657-132752679 TTCCCCCAGCTCTCCTGGAATGG + Intronic
1061861513 9:133470866-133470888 TGCCCCCAGCATCCCAGACAAGG + Intergenic
1062393142 9:136341998-136342020 CACCCCCAATTTCCCAGGAGAGG - Intronic
1188737109 X:33730636-33730658 TACTTCCAGTTTCCCAGGAAGGG - Intergenic
1189497491 X:41522154-41522176 TCCCAGCAGCCTCCCAGGAAAGG - Intronic
1191782861 X:64887000-64887022 TACCTCCATCTCCCCAGAAATGG + Intergenic
1195325667 X:103756323-103756345 CACCCCCAGCCTCCTAGGAGGGG - Intergenic
1195573207 X:106420046-106420068 GACCACCCTCTTCCCAGGAAAGG + Intergenic
1197645336 X:129011033-129011055 GAGGCCCAGCTCCCCAGGAAAGG + Intergenic
1198438052 X:136636333-136636355 CACCCCCACCCTCCCAGGCAGGG + Intergenic
1200052423 X:153442061-153442083 AACAACCAGCTTTCCAGGAAAGG - Intergenic
1200157144 X:153982972-153982994 AGCCCGCAGCTTCTCAGGAAAGG - Exonic
1201951853 Y:19573911-19573933 TATCCCAAGCTTTCCAGGGAGGG + Intergenic