ID: 912949549

View in Genome Browser
Species Human (GRCh38)
Location 1:114111393-114111415
Sequence TGGCACAGCCAGGATGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 324}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912949544_912949549 0 Left 912949544 1:114111370-114111392 CCCAAGGGCACACAGCTACTAAA 0: 1
1: 4
2: 120
3: 874
4: 2985
Right 912949549 1:114111393-114111415 TGGCACAGCCAGGATGTGGACGG 0: 1
1: 0
2: 0
3: 36
4: 324
912949545_912949549 -1 Left 912949545 1:114111371-114111393 CCAAGGGCACACAGCTACTAAAT No data
Right 912949549 1:114111393-114111415 TGGCACAGCCAGGATGTGGACGG 0: 1
1: 0
2: 0
3: 36
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912949549 Original CRISPR TGGCACAGCCAGGATGTGGA CGG Intronic
900309923 1:2028756-2028778 GGGCACAGCCAGGCTCTGGAAGG - Intronic
900385220 1:2407504-2407526 TAGGACAGCCAGGAAGTGGCTGG - Intronic
900615042 1:3561651-3561673 GGGCACACCCAGGATGCGGGCGG - Intronic
900893640 1:5467623-5467645 GTGCACAGCCAGAATGTGTATGG - Intergenic
901319284 1:8329919-8329941 TGGAACAGGCAGGAAGTGGAAGG + Intronic
901461348 1:9393626-9393648 AGGCAGAGCCAGGATCCGGAGGG + Intergenic
902190446 1:14759191-14759213 TGGCACAGCCAGGCTGAGATAGG - Intronic
902218096 1:14947317-14947339 CTGCACAGTGAGGATGTGGAGGG + Intronic
905385405 1:37600016-37600038 TAGCAGAGCCAGGGTGAGGAAGG + Intergenic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
906690873 1:47791969-47791991 TCCCACAGCCAGGATGAGGTGGG + Intronic
906793147 1:48676235-48676257 TGGCTCTGCCAGAAGGTGGAAGG - Intronic
907471775 1:54678994-54679016 TGGCACAGACTGGAGGAGGAGGG - Intronic
908445626 1:64196695-64196717 TGGCACAGGCAGCACGGGGAGGG + Intergenic
908584701 1:65554979-65555001 TGGCTCATCCAGGAAGTGCAAGG - Intronic
909481831 1:76134467-76134489 TGTCACTGCCATGCTGTGGAGGG + Intronic
911677364 1:100674756-100674778 TGGCAGAGCCACAAGGTGGAAGG + Intergenic
911793990 1:102053951-102053973 TGGCAAAGCCAGGTTGGGGCTGG - Intergenic
912155628 1:106915252-106915274 TGGTACAGGCAGGATGTGGGTGG - Intergenic
912488540 1:110048189-110048211 TGAGACACCCAGGATGAGGAGGG + Intronic
912652363 1:111450477-111450499 TCACACAGCCAGTAAGTGGAGGG - Intronic
912949549 1:114111393-114111415 TGGCACAGCCAGGATGTGGACGG + Intronic
914351844 1:146846775-146846797 TGGCACACCCAGGGTGGAGATGG - Intergenic
914878384 1:151529395-151529417 CGGCAGAGCCAGGAGGTGGCTGG + Exonic
914912969 1:151801709-151801731 TGCCACATCCAGGAGGTGGAAGG + Exonic
916030787 1:160875996-160876018 TGGTACAGATAGGATGGGGATGG - Intergenic
917226730 1:172791297-172791319 AGGCTCAGCCTGAATGTGGAAGG + Intergenic
917473741 1:175350186-175350208 CAGCTCAGCCTGGATGTGGAAGG + Intronic
918287711 1:183074498-183074520 TGGCACTGTCAGCATGTGAAAGG + Intronic
918687468 1:187436133-187436155 TTGCAGAGCCAGCATCTGGAAGG + Intergenic
919727205 1:200891966-200891988 CGGGCCAGCCTGGATGTGGAGGG + Intronic
919973932 1:202598847-202598869 TGGCCAAGACAGGATGTGGCTGG + Intronic
921714066 1:218400732-218400754 TGGCACTGCCAGCTTGTGGTGGG + Intronic
922565685 1:226600335-226600357 GGGCATGGCCAGGATATGGAGGG + Intronic
922706465 1:227793257-227793279 TGGCACAGCCCTGAGGTGGAGGG - Intergenic
922787279 1:228289261-228289283 GTGCACAGCCAGGAAGGGGAGGG + Intronic
923086002 1:230703981-230704003 AGGCACAGCAGGGATGGGGAGGG + Intronic
923121687 1:230998153-230998175 AGTCACAGCCAGACTGTGGATGG + Intronic
1062975366 10:1678766-1678788 TGGAACAGCCGAGATGTGGAAGG - Intronic
1063978893 10:11438002-11438024 TGCCACAGCCAGCATGTGGTCGG + Intergenic
1064324910 10:14340650-14340672 TGCCCCAGCAAGGATGTGGCCGG - Intronic
1065458673 10:25934056-25934078 GGGCCCTGCGAGGATGTGGATGG + Intergenic
1067932398 10:50575961-50575983 TAGCTCAGGCAGGATGTGAATGG - Intronic
1069534387 10:69242135-69242157 TGGGAAAGCCAGGCTGAGGAGGG - Intronic
1069848506 10:71390089-71390111 TCTCACAGCCAGGATGTGCTGGG + Intergenic
1069899499 10:71699259-71699281 TAGCTCAGCCAGGAGGTGGCTGG + Intronic
1070797948 10:79228028-79228050 GGGCACAGACAGGATGGGAATGG - Intronic
1070918897 10:80171813-80171835 TGGCAGTGGCAGGATCTGGATGG + Intronic
1070951308 10:80433460-80433482 TGGCCCAGCCAGGAGGAGAAAGG + Exonic
1071387210 10:85133469-85133491 TGGCTCAGTCAAGATGTGGATGG + Intergenic
1072657061 10:97337147-97337169 TCCCACACCCAGGATGTGGCAGG - Intergenic
1074635771 10:115315557-115315579 TGGAACAGCCTGGATGTGGCTGG + Exonic
1075083097 10:119396943-119396965 TGGCAGGGCCAAGATGGGGATGG + Intronic
1075785275 10:125045223-125045245 TGGCAGATCCAGGATCTGGGAGG - Intronic
1076486268 10:130820559-130820581 GTGCACAGCCAAGACGTGGATGG + Intergenic
1076603532 10:131674722-131674744 AGGCACAGGCATGATGTGGCAGG - Intergenic
1077358885 11:2131010-2131032 TGGCCCAGCCAGAGTGAGGAAGG - Intronic
1078845240 11:15114327-15114349 TGGCAGGTCCAAGATGTGGAGGG + Intronic
1079121933 11:17692156-17692178 TGGAACCTCCAGCATGTGGATGG - Intergenic
1079321785 11:19457490-19457512 GGGCAAAGCCAGATTGTGGAGGG + Intronic
1081784110 11:45734205-45734227 GGGCACAGCCAGGATGCAGCCGG + Intergenic
1081840729 11:46199597-46199619 TCACACAGCTAGGATGTGGAGGG - Intergenic
1082230260 11:49756306-49756328 TGTCACTGCCAGGGTGAGGAAGG + Intergenic
1083436873 11:62648796-62648818 TGGCACAGCCAGGCCCTGGGTGG + Exonic
1083707459 11:64526156-64526178 CGGCAAAGCCAGGATGTTGGGGG - Intergenic
1084001959 11:66300703-66300725 CTGCACAGCCAGGAAGAGGAGGG + Intergenic
1084567619 11:69940348-69940370 AGGCACAGCCAGGGAGGGGATGG - Intergenic
1084751221 11:71205435-71205457 GGGCACAGGCAGGAGCTGGAGGG - Intronic
1084857642 11:71999158-71999180 GGGAAAGGCCAGGATGTGGACGG + Exonic
1085508227 11:77072121-77072143 TGCCACAGCCAGGTTGTGGCTGG - Intronic
1086619793 11:88872649-88872671 TGTCACTGCCAGGGTGAGGAAGG - Intronic
1087561483 11:99796266-99796288 TGGCACAGTCAGGGAGTGGCAGG + Intronic
1089145724 11:116328608-116328630 TGTCACAGCCAGGCTGCAGAAGG - Intergenic
1089452015 11:118605512-118605534 GGGCAAAGCCTGGGTGTGGAAGG - Intergenic
1089650703 11:119910934-119910956 TGGCAAAGCCAGGATGATGAGGG - Intergenic
1090223846 11:125056507-125056529 TGGCACTGGCTGGGTGTGGAGGG + Intergenic
1090409578 11:126498610-126498632 TGTCACAGCCAGGAGGGGAAGGG + Intronic
1091893864 12:4084571-4084593 TGTCCCAGCCTGGAGGTGGAAGG - Intergenic
1092601708 12:10073318-10073340 TGGCAAGGCCTGGCTGTGGATGG - Exonic
1093369177 12:18345517-18345539 AGGCACAGACAGGATGTGGGAGG + Intronic
1094478754 12:30863341-30863363 TCACACAGTCAGGATGGGGAGGG + Intergenic
1094768098 12:33620773-33620795 TGCCAGAGCCAGAAAGTGGAAGG + Intergenic
1095788079 12:46132679-46132701 TTGCAGAGCCAGGATGTGATTGG + Intergenic
1096523615 12:52198088-52198110 GAGCCCAGGCAGGATGTGGAAGG + Intergenic
1096784185 12:54007958-54007980 TGCCCAGGCCAGGATGTGGATGG - Intronic
1097245454 12:57605206-57605228 AGGCACAGCCCGGATGGGCAAGG - Intronic
1097694277 12:62761842-62761864 TGACACAGCAAGGAGCTGGAAGG + Intronic
1097867042 12:64567567-64567589 TGACACAGCCATGAGGTGGAAGG + Intergenic
1098102545 12:67033697-67033719 TTGCACAGCTAGGATGGGGTGGG - Intergenic
1098103569 12:67045029-67045051 TGGCAGAGCCAAGATTTGAATGG + Intergenic
1101646962 12:106640254-106640276 TGGCAGAGGCAGGAAGTGGCTGG + Intronic
1102430046 12:112875975-112875997 TCACACAGCCAGGAAGTGAAGGG - Intronic
1103744913 12:123115970-123115992 GAGCACAGCCAGGCTTTGGAAGG + Intronic
1104946202 12:132415862-132415884 GGCCACAGCCAGGCTGGGGAGGG + Intergenic
1106300367 13:28458888-28458910 GTGCACAGCCAGGATGTAGAGGG + Intronic
1107425733 13:40291037-40291059 ATGCACAGAAAGGATGTGGAAGG + Intergenic
1107925018 13:45250621-45250643 TGCCACAGCCAGACTCTGGAAGG - Intronic
1108071592 13:46634501-46634523 AGGCACAGCCTGAATGAGGAAGG - Intronic
1110797941 13:79661423-79661445 TTTCACACCCAGGCTGTGGAGGG + Intergenic
1113341073 13:109426530-109426552 TGGGAAAGCCATGATGTGGGGGG - Intergenic
1119410641 14:74427912-74427934 GAGCACAGCCAGGGTGGGGAGGG - Intergenic
1121571676 14:94951199-94951221 TGGCTCAGTTAGGATGTGTAGGG - Intergenic
1121577756 14:95002143-95002165 TGACACAGCCAGAAAGTGGTGGG - Intergenic
1121806562 14:96831029-96831051 TCCCACAGCCAGGAAGTGCAAGG - Intronic
1121885402 14:97538463-97538485 TGGCAGAGGCGGGCTGTGGAGGG - Intergenic
1122298315 14:100717839-100717861 TGACACTGGCAGGATGGGGAAGG - Intergenic
1122389240 14:101369018-101369040 TGGCAGAGGCAGCATCTGGAGGG + Intergenic
1123893717 15:24807350-24807372 TGCCACAGCCAGGACTTTGATGG - Intergenic
1124723538 15:32134108-32134130 TGGGACAGGATGGATGTGGAGGG - Intronic
1124813610 15:32966370-32966392 TGGGACAGCCAGCATTTGGTAGG + Intronic
1125153405 15:36559898-36559920 TGGTAGAGCCAGGATCTGAATGG + Intergenic
1126326255 15:47480647-47480669 TGGCAGAAGCAGGGTGTGGAGGG - Intronic
1126749542 15:51862874-51862896 TGGCAGTGCCATGATGTGCAGGG - Exonic
1127831757 15:62757185-62757207 TGACCCAGCCAGGAAGTGGTGGG + Intronic
1128145439 15:65330154-65330176 TCACACAGCCAGCATGTGCATGG + Intronic
1129270495 15:74417007-74417029 TGGCAGAGCCCTGATGAGGAGGG + Intronic
1130982902 15:88825088-88825110 AGGCACAGCTAGAATGTGGCGGG + Intronic
1132611529 16:818964-818986 TGGTACAGCCAAGATGGTGAGGG - Intergenic
1132886214 16:2183353-2183375 TGGGGCAGCCTGCATGTGGAGGG + Intronic
1132980976 16:2738565-2738587 TGGGACAGCCTGGATGGGGGAGG + Intergenic
1133553623 16:6883674-6883696 TTGAACAGCCTGGATGTGGGAGG - Intronic
1133625426 16:7566508-7566530 TCACACAGCCAGGAGATGGAAGG - Intronic
1134073839 16:11276802-11276824 TGCCACAGCCACCATGTGGAAGG + Intronic
1134414992 16:14035282-14035304 AGGCACAGCCAGGAGGTGGCAGG + Intergenic
1135057756 16:19244721-19244743 TGGCAGAGCCATGAGATGGAAGG - Intronic
1135685449 16:24494956-24494978 TGGCAGAGCGAGGATTTGAACGG - Intergenic
1135737785 16:24946382-24946404 TCGTACAGCCAGGACCTGGATGG - Intronic
1136354630 16:29736224-29736246 TGGCTGAGCCAGGAGATGGAAGG - Intergenic
1136477047 16:30519998-30520020 TGAGACAGCCAGGCTGGGGAAGG + Intronic
1136929610 16:34407313-34407335 AGGCCCAGCCAGGATGTAGCCGG + Intergenic
1136974964 16:35004491-35004513 AGGCCCAGCCAGGATGTAGCCGG - Intergenic
1137249212 16:46730304-46730326 AGGCACAGCCTGGAGGTGGCCGG - Intronic
1137620827 16:49875794-49875816 TAGCTTAGCCAGCATGTGGAAGG - Intergenic
1138213780 16:55185135-55185157 GGGCACAGCAAGGAAGTGGCAGG + Intergenic
1138441813 16:57039905-57039927 TGGCACTGCCCAGCTGTGGAGGG - Intronic
1138457665 16:57130740-57130762 TGGCAGAGACAAGATGGGGAGGG + Intronic
1139850919 16:69951319-69951341 TGGCTGAGCCAGGCTGTGCACGG + Exonic
1139879901 16:70174231-70174253 TGGCTGAGCCAGGCTGTGCACGG + Exonic
1139955786 16:70692370-70692392 TGCCACAGACAGGGTGGGGAGGG + Intronic
1140372613 16:74421296-74421318 TGGCTGAGCCAGGCTGTGCACGG - Exonic
1140707216 16:77641892-77641914 GGGCACAGCCACCATGAGGATGG - Intergenic
1140734035 16:77881992-77882014 ATGCACAGCCAGGATGGGGATGG + Intronic
1140859646 16:79007731-79007753 CGGCAAAACCAGGATGTGAATGG + Intronic
1141929545 16:87192806-87192828 GGGCACAGCCAGGCACTGGAAGG + Intronic
1142003160 16:87675551-87675573 TGGCACAGCCGTGCTGTGGGAGG + Intronic
1142226634 16:88880849-88880871 GGGCCCAGCCAGGGTGGGGAGGG - Intronic
1144654612 17:17027643-17027665 TCACACAGCCAGGAAGTGGGGGG - Intergenic
1144654792 17:17028648-17028670 TTGCACAGGCAGTATGTGGTGGG - Intergenic
1144926851 17:18818746-18818768 TGCCAGAGCCAGGAGGAGGAGGG + Intergenic
1145018085 17:19411791-19411813 TGGATCCGCCAGGCTGTGGAGGG + Intronic
1147774832 17:42893300-42893322 TTGCTCAGCCTGGTTGTGGACGG - Intergenic
1147847855 17:43417812-43417834 TGGGAGAGCCAAGATGTGGGTGG + Intergenic
1147885295 17:43680165-43680187 GGGCACAGCCAGGAGGATGAGGG - Intergenic
1149585517 17:57783473-57783495 TCGCACAGCCAGGTCGGGGAGGG + Intergenic
1150814746 17:68384213-68384235 TGGCTCAACCAGGATGAGGGTGG + Intronic
1151126222 17:71847666-71847688 TGCCAAAGACAGCATGTGGATGG + Intergenic
1151206985 17:72515087-72515109 TCGCTCAGCCAGGATATGGCTGG + Intergenic
1152121598 17:78422230-78422252 TGGCCCAGCCAGGCTGGGGGAGG + Intronic
1153031658 18:718981-719003 AGGCACAGTCTGGATGTGGAGGG + Intergenic
1153232840 18:2956360-2956382 TGGCAGAGCCAGGAAATGGGTGG - Intronic
1153779137 18:8478846-8478868 AGGCATAGCCAGCAGGTGGAGGG + Intergenic
1153994949 18:10432671-10432693 TGGCACAGGGAGGATGAGGATGG - Intergenic
1155296933 18:24393390-24393412 AGTCACAGCCAGAATGTAGAAGG + Intronic
1155791042 18:29971324-29971346 TGGCACAGCCAGAAAGGAGATGG + Intergenic
1157067375 18:44367218-44367240 TGCCTCACCCAGGAAGTGGAAGG - Intergenic
1158511264 18:58092605-58092627 TTGCAGAGCCAGTATGTGAATGG - Intronic
1160427490 18:78788129-78788151 CTGCAGAGCCAGGAGGTGGATGG - Intergenic
1160681103 19:412039-412061 TGGCCAAGCCAGGCTGTGGTGGG - Intergenic
1161114500 19:2489141-2489163 TGGCACCGCCGGGCTCTGGAGGG - Intergenic
1162316371 19:9940839-9940861 TGGCAGAACCAGGATGTTGACGG - Intergenic
1162502208 19:11060336-11060358 TCACACAGCCAGTATGTGGCAGG + Intronic
1162746846 19:12803497-12803519 TGGCACAGCCTGGAAGTGTCAGG + Intronic
1164305772 19:24003179-24003201 AGGCCCAGCCAGCCTGTGGACGG - Intergenic
1164573587 19:29391976-29391998 TGGCAGAGCCACAATGTGGAAGG + Intergenic
1164646144 19:29859908-29859930 TAGCACTGTCAGGATGAGGATGG - Intergenic
1164767275 19:30781619-30781641 AAGCACAGCCAGGATGGAGATGG + Intergenic
1166046991 19:40235608-40235630 TGGCAGAGCCAGGATAGGAACGG - Intronic
1167620496 19:50557413-50557435 TGGCACAGCCAGGGACTGGACGG - Intronic
1168429617 19:56267937-56267959 GCACACAGCCAGGAGGTGGAGGG + Intronic
925870545 2:8266073-8266095 TAGCACAGCCAGCCTGGGGATGG - Intergenic
927047267 2:19291760-19291782 TGGCACCACCAGGAAATGGAGGG - Intergenic
928907334 2:36381409-36381431 TGGCAGAGCCAGGCTCAGGAAGG + Intronic
928986923 2:37191081-37191103 TTGCAGAGTCAGGATTTGGAGGG + Intronic
931638014 2:64358074-64358096 GGGAACAGCCAGGATGGGGTTGG - Intergenic
934123039 2:88858210-88858232 TGGAACAGTCAGAAGGTGGAGGG - Intergenic
934784733 2:96996689-96996711 TTGCACAGCCACGAGGTGCAGGG + Intronic
938118820 2:128619902-128619924 TGACACAGCCAGGATTTGAGTGG + Intergenic
938949209 2:136241688-136241710 TGGCTAAGCCAAGATTTGGACGG - Intergenic
939551195 2:143618016-143618038 TGTTACAGCCAAGGTGTGGAAGG + Intronic
940581487 2:155585209-155585231 TGGCACTCCCAGGCTGTGCATGG - Intergenic
946450821 2:219777564-219777586 TGGAGCAGACAGCATGTGGAAGG + Intergenic
947010466 2:225560674-225560696 TGGCACAAGCAGGAGCTGGAAGG + Intronic
947835132 2:233169836-233169858 TGGCACAGCCAGGATGCAAAGGG - Intronic
948084193 2:235232745-235232767 CCGCTCAGTCAGGATGTGGAGGG - Intergenic
948206486 2:236165173-236165195 GGGCACTGCCAGGGTGTGGCCGG - Intergenic
948244772 2:236471176-236471198 TCACACAGCCAGGAAGTGGCTGG + Intronic
1168862424 20:1055332-1055354 TGGCAGAGCAAGGCTGGGGAAGG - Intergenic
1169880615 20:10342338-10342360 GTGCACAGCCAGGCTGTGGTGGG - Intergenic
1169945049 20:10979162-10979184 TGGACCAGCCAGGATGTCCAAGG + Intergenic
1170314814 20:15031070-15031092 GTGCACAGCCAGGCTGTGGTGGG + Intronic
1170360841 20:15544399-15544421 TTGAACAGCTAGGATGAGGAGGG + Intronic
1170513264 20:17101373-17101395 TTGCACAGCCATGAAGTGAATGG + Intergenic
1171392719 20:24811760-24811782 TGGCACAGGCAGCATCAGGAGGG - Intergenic
1171394728 20:24824605-24824627 TGGCACAACCTGGATGAGGCCGG - Intergenic
1171984721 20:31651732-31651754 TCCTACAGCCAGGATGTGCATGG + Intergenic
1172138486 20:32704730-32704752 TGACACAGCCACTATGGGGAAGG - Intronic
1172639737 20:36433508-36433530 GGGCAAAGCCAGGCTGTGGGTGG + Intronic
1173189531 20:40865415-40865437 TAGAACAGGCAGGATGGGGATGG - Intergenic
1173222793 20:41143202-41143224 TGCCACAGCCTCGATGTGGTAGG + Intronic
1173599497 20:44283265-44283287 TGGCACCACCTGGAAGTGGATGG - Intergenic
1174030473 20:47620562-47620584 AGGCAGAGCAAGGATGAGGAAGG - Intronic
1175274425 20:57758294-57758316 TGGCATTAGCAGGATGTGGATGG + Intergenic
1175297932 20:57922024-57922046 AGGCACCTTCAGGATGTGGAGGG - Intergenic
1175380171 20:58557384-58557406 TGGAGCAGCCAGGAGCTGGAGGG + Intergenic
1178850437 21:36208408-36208430 TGGCACGGCCAGGGTGGAGATGG + Intronic
1179724646 21:43335381-43335403 GCCCACAGCCAGGAGGTGGACGG - Intergenic
1180226827 21:46398527-46398549 TGTCACAGCCAGTATGGGCAGGG + Intronic
1181633379 22:24163134-24163156 AGGCACTGCCAGGAAGTAGAAGG + Intronic
1181784334 22:25215748-25215770 TCACACAGCCAGGAAGTGGTAGG - Intergenic
1182088345 22:27576964-27576986 TCACACAGCCAGGAAGTGGTGGG - Intergenic
1182542759 22:31053862-31053884 TGCCACAGCCAGGATGATGCAGG + Intergenic
1182681019 22:32080182-32080204 AGGCAGAGCCAGGAGGTGGGAGG - Intronic
1184100141 22:42337775-42337797 AGGCAGAGCCCAGATGTGGATGG - Intronic
1184341468 22:43888340-43888362 AGGAAGAGCCAGGATGTGGATGG + Intronic
1184444344 22:44538730-44538752 TCACACAGCCAGGAAGTGGCAGG + Intergenic
1184595699 22:45512654-45512676 AGGCACAGCCAGGGTGGGGCTGG + Intronic
1184770248 22:46592753-46592775 CGGCACCTCCAGGATGTGGCCGG + Intronic
1185085288 22:48737605-48737627 TGGCACAGCACGGAAGGGGAAGG + Intronic
1185376737 22:50486125-50486147 GGGCCCAGCGAGGATGGGGATGG - Exonic
949702645 3:6776773-6776795 TGGCACATCAAGGAAGTTGATGG + Intronic
949905579 3:8855875-8855897 TGGTACAGCTAGGATGGGGCAGG - Intronic
949928216 3:9058503-9058525 GGTGACAGCCAGGATGTGGAGGG + Intronic
950262595 3:11553639-11553661 CAGCCCAGCCAGGCTGTGGATGG - Intronic
950505041 3:13389332-13389354 TGGCACACGCTGGATGTTGAGGG - Intronic
950533184 3:13565007-13565029 TGGGGCAGGCAGGATGGGGAGGG - Intronic
952232712 3:31448240-31448262 TGCAACAGCCAGGATGGGGGAGG + Intergenic
953463567 3:43100946-43100968 TGGGGCAGCCAGGATGAGGAAGG + Intronic
953685315 3:45073569-45073591 TGTCACAGTCAGGATGGTGAAGG + Intergenic
955807626 3:62753904-62753926 TTGCACAGCCAGGAGGTGGTGGG - Intronic
955944661 3:64181346-64181368 TGGGACTGTCAGGATGCGGAAGG - Intronic
956230788 3:67014155-67014177 TGGCACAGCCAGAAAGAGGATGG - Intergenic
956566347 3:70642993-70643015 TGACACAGCCACAAGGTGGAGGG - Intergenic
959218575 3:103484109-103484131 TGCCACACCCAGGAAGTGCAAGG - Intergenic
961471890 3:127120302-127120324 TGGCACAGAGAAGCTGTGGAAGG + Intergenic
961992211 3:131204205-131204227 TGGCACACCCAGGAAGGGCATGG + Intronic
962047572 3:131776830-131776852 TGGCAGAGGGAGGATGAGGAAGG - Intronic
962483125 3:135815112-135815134 TGGCAGAGCCAGAAGGTAGATGG - Intergenic
963039790 3:141060477-141060499 TCACACAGCCAGGAAGTGGCAGG - Intronic
964904756 3:161706962-161706984 TGCCTCAGCCAGGAAGTGCAAGG + Intergenic
967299475 3:187998487-187998509 TCACACAGCCAGGATGGGGCAGG - Intergenic
967366162 3:188688517-188688539 TGGTACACAGAGGATGTGGAAGG + Intronic
967752031 3:193126147-193126169 TGGAAGTGCCAGGATGTAGAGGG - Intergenic
968083622 3:195863942-195863964 TGCCCCTGCCAAGATGTGGAAGG - Exonic
968524421 4:1048705-1048727 CGGCCCAGCCAAGATGGGGAAGG - Intergenic
969086464 4:4660158-4660180 TGACACAGCGAGGCTGGGGAGGG + Intergenic
969220580 4:5756016-5756038 TGTTAAAGCCAGGATGAGGAGGG - Intronic
969320783 4:6411234-6411256 TCACACAGCCAGGAAGTGGTGGG + Intronic
969532113 4:7735871-7735893 TGTCACAGCTAGGAGGTGGCAGG + Intronic
969545083 4:7820739-7820761 AGGCAGAGTGAGGATGTGGAGGG + Intronic
970389765 4:15596177-15596199 TGGAAAGGCCAGGATATGGAAGG - Exonic
970954062 4:21790076-21790098 AGGCAAAGCCATTATGTGGATGG + Intronic
972604809 4:40604207-40604229 TGGCAGAGCCAAGTTCTGGAGGG + Intronic
974772194 4:66431079-66431101 TGGCACTGGCAGGATGAGTAAGG + Intergenic
975183008 4:71368972-71368994 AGCCACAGCAAGGATGAGGATGG - Intronic
975254506 4:72216938-72216960 AGGCACAGCCAGGACTTGCAGGG - Intergenic
978497479 4:109375922-109375944 TGGAATAGACAGGATGTGAATGG + Intergenic
981240476 4:142470650-142470672 TACCACAGCCAGCATGTGGGAGG + Intronic
981785706 4:148477237-148477259 TGGCACAGCTAGGAAGAGAATGG - Intergenic
984623389 4:181978290-181978312 TGGCAGAACCAGGATGAGAAGGG + Intergenic
985826221 5:2193464-2193486 TGGCACTGCCAGGCTGCGGATGG + Intergenic
986286197 5:6360847-6360869 TGGCACCTTCAGGATGAGGATGG - Intergenic
986488330 5:8263371-8263393 TGTTAGAGCCAGGATGGGGATGG + Intergenic
987118986 5:14748668-14748690 TGGCACATGCAGGATGGTGAAGG + Intronic
988381311 5:30499788-30499810 TGCCACACCCAGGAAGTGCAAGG - Intergenic
992461332 5:76963225-76963247 TGGTATTGCCAGGATGTTGAGGG + Intronic
992713804 5:79488858-79488880 TCACACAGCCAAGATGAGGATGG + Intronic
992868870 5:80985746-80985768 CAGCACAGGAAGGATGTGGAGGG + Intronic
994040233 5:95250574-95250596 TTGCCCAGCTAGGATGTGGATGG - Intronic
996286260 5:121796732-121796754 TGGCACATCCAAAATCTGGAGGG + Intergenic
998064605 5:139147905-139147927 TGGCTTTGGCAGGATGTGGAAGG + Intronic
998092611 5:139380087-139380109 AGGCACAATCAGGAAGTGGATGG + Intronic
998177207 5:139909214-139909236 TGGCACAGCCTCAAAGTGGAAGG - Intronic
998203826 5:140145556-140145578 TGGCAGGGCCGGGATGTGGCTGG + Intergenic
998301281 5:141023301-141023323 TCTCACACCCAGGATGTGGTTGG + Intergenic
999252782 5:150192536-150192558 TGGCACAGTGAGGATGGGGCTGG - Intronic
999694987 5:154180743-154180765 TGGCAGTGCCAGGAGGAGGATGG + Intronic
1001751228 5:174133160-174133182 TGGCACAACCAGGACCTGGGAGG - Intronic
1002197907 5:177511174-177511196 TGGCACAGGCAGGCAGTGGGTGG + Intronic
1003032595 6:2615417-2615439 TGGCAGAGCCAGGATGTGCCTGG + Intergenic
1003961201 6:11210967-11210989 TGACATGGCCAGGATGGGGAGGG - Intronic
1003961338 6:11211891-11211913 TGACATGGCCAGGATGGGGAGGG + Intronic
1004947352 6:20630281-20630303 GGGCACACACAGGATGAGGAAGG - Intronic
1005200950 6:23343172-23343194 TGCCACAGGGAGGGTGTGGAGGG - Intergenic
1006621240 6:35365779-35365801 TGGCACATCCAGGCCGTGCATGG - Intronic
1006942634 6:37763072-37763094 TGGCAGAGTCAGGCTGGGGAGGG + Intergenic
1007378651 6:41472664-41472686 GGGCTCAGCCAGGAAGTGCAGGG + Intergenic
1010840276 6:80641691-80641713 TGGCACAGGCAGGCTCTGAATGG + Intergenic
1013343222 6:109235859-109235881 GGGCACAGACACGAGGTGGAAGG + Intergenic
1016182183 6:141160490-141160512 AGGCACAGCCAGAATATGGGAGG + Intergenic
1016486812 6:144549639-144549661 TGGGGGAGCCAGGATGAGGAAGG + Intronic
1016863868 6:148747394-148747416 TGGCACGGGCAGGCTGTGGGAGG + Exonic
1017628324 6:156370639-156370661 GGGGACAGCCAGGCTCTGGAGGG - Intergenic
1017814830 6:158009277-158009299 AGGCACAGCCAGGAAGAGGCGGG - Intronic
1018214539 6:161514291-161514313 TTGCACAGACAGGAGTTGGATGG + Intronic
1018861310 6:167712606-167712628 TGCCAGGGCTAGGATGTGGATGG + Intergenic
1019609405 7:1929386-1929408 TGGCCCAGCCTGGACGTGGCAGG + Intronic
1019726701 7:2606755-2606777 AGCCCCAGCCAGGAGGTGGAGGG + Intronic
1020126735 7:5536970-5536992 GGGCACAGCCAGGAGCTGAAGGG + Intronic
1027651425 7:80873269-80873291 AGGCACAGCCAGACTGTGCAGGG + Intronic
1028143062 7:87292333-87292355 TGGCACAGACAGTAATTGGATGG + Intergenic
1028294268 7:89108014-89108036 TGTCACAGCCAGGAAGTCAAAGG + Intronic
1029315250 7:99706336-99706358 TGGCACACCTAGGATGGGGAAGG - Intronic
1029320903 7:99759047-99759069 TGGCACACCTGGGATGGGGAAGG - Intronic
1030170825 7:106601124-106601146 TGGAACAGCCAGTATTTGGCTGG + Intergenic
1032788876 7:135227024-135227046 TGGCAGGGCGGGGATGTGGAGGG + Intergenic
1033224276 7:139548343-139548365 TGGCAAAGCCAGGATTTGTTGGG + Intergenic
1033732234 7:144191274-144191296 AGGCAGAGCCAGGTTGTGCAGGG - Intronic
1033743085 7:144289859-144289881 AGGCAGAGCCAGGTTGTGCAGGG - Intergenic
1033750813 7:144359740-144359762 AGGCAGAGCCAGGTTGTGCAGGG + Intronic
1033975223 7:147092907-147092929 TGGCACGTCCATGCTGTGGAAGG + Intronic
1034432185 7:151046584-151046606 TCCCACAGCCTGGATGTGGCTGG - Intronic
1034476054 7:151282754-151282776 TGGCTCAGCCAGGGAGGGGAAGG - Intergenic
1034491603 7:151395964-151395986 TGGCACAGCCAAGGTGTGGCAGG - Exonic
1035080195 7:156209383-156209405 CGGCACAGCCAGGCTGGCGAGGG - Intergenic
1035291803 7:157844099-157844121 TTCCACACCCACGATGTGGAGGG - Intronic
1036112150 8:5915090-5915112 GGGCATAGCCATGATATGGAAGG - Intergenic
1036293750 8:7518212-7518234 GGGCAAAGCCAGGAGGAGGAAGG + Intergenic
1036328811 8:7802783-7802805 GGGCAAAGCCAGGAGGAGGAAGG - Intergenic
1037626053 8:20607902-20607924 TGCCTCACCCAGGATGTGCAAGG - Intergenic
1037747582 8:21659240-21659262 TGGGAGTGCCAGGATGGGGAGGG - Intergenic
1039908970 8:41809209-41809231 TGGCTAAGCCAGCATGTGTAAGG - Intronic
1040098963 8:43480252-43480274 TGCCTCAGCCAGGAAGTGCAAGG + Intergenic
1044251234 8:90006024-90006046 TGCCACTGCCAGGATGAAGATGG + Intronic
1046492944 8:114976819-114976841 AGCCACAGCCTGGGTGTGGAAGG + Intergenic
1047180122 8:122579454-122579476 TGGCTGAGCCAGGAGATGGAAGG + Intergenic
1049553839 8:143272651-143272673 GGGCACAGCCAGCAGGTGGCAGG + Intronic
1050106613 9:2172564-2172586 TGGGACAGCCTGGATGAGGCTGG + Intronic
1055389327 9:75801913-75801935 TCTCTCAGACAGGATGTGGAGGG + Intergenic
1057271870 9:93656112-93656134 TGGCACAGCCCGCCTGTGGGTGG + Intronic
1057625698 9:96674463-96674485 TGGCACAGTCAGCATGTGTTGGG + Intergenic
1057796539 9:98161864-98161886 GTGCACAGACAGGCTGTGGAGGG - Intronic
1057965126 9:99495801-99495823 TCGCACAGCCAGTATAAGGAAGG + Intergenic
1059426271 9:114222768-114222790 TCACACAGCCAGGATGTGGTGGG - Intronic
1059833879 9:118128747-118128769 GGGCAAAGCCAGGTTGGGGATGG - Intergenic
1060973488 9:127752216-127752238 AGGCACAGCCAGGATTGGGCTGG - Intronic
1061489224 9:130936010-130936032 GGACACAGCCAGCCTGTGGAAGG + Intronic
1061906309 9:133701090-133701112 TGGTCCAGCCAGGCTGTGCAGGG + Intronic
1061957210 9:133969934-133969956 TGGCACACCCAGGATGAAGCCGG + Intronic
1061964207 9:134004070-134004092 TGGCACATCCAGGATGGGAGAGG + Intergenic
1062173450 9:135148092-135148114 TGGCACGGCCACGCTGTGGAAGG - Intergenic
1203745712 Un_GL000218v1:39815-39837 GGTCACAGCGAGGAGGTGGACGG + Intergenic
1203564400 Un_KI270744v1:79665-79687 GGTCACAGCGAGGAGGTGGACGG - Intergenic
1186980611 X:14954182-14954204 TGGCAGAGCCATAAGGTGGAAGG + Intergenic
1187073677 X:15913375-15913397 TGGCAGGGCAAGCATGTGGATGG - Intergenic
1187252234 X:17609079-17609101 TGGCACAGCCACGATATCCAGGG - Intronic
1187908262 X:24087259-24087281 TGGCACAGCCTGGCTGGGCATGG - Intergenic
1189316714 X:40062018-40062040 CGGCCCAGCCCCGATGTGGAGGG + Intronic
1189653177 X:43211633-43211655 ATGCACTGGCAGGATGTGGAAGG - Intergenic
1195387172 X:104324344-104324366 GGGCACAGTAAGGATGTGGGAGG - Intergenic
1197208353 X:123809374-123809396 TGGTACAGAAAGGATATGGATGG - Intergenic
1197329997 X:125141904-125141926 TCACACAGCTAGGAAGTGGAGGG - Intergenic