ID: 912952119

View in Genome Browser
Species Human (GRCh38)
Location 1:114127413-114127435
Sequence GGCCAAGGCTCCTCTAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 143}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912952119_912952133 28 Left 912952119 1:114127413-114127435 CCTTCTCTAGAGGAGCCTTGGCC 0: 1
1: 0
2: 0
3: 10
4: 143
Right 912952133 1:114127464-114127486 CCTGTTGGCTTTAGAACCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 166
912952119_912952126 4 Left 912952119 1:114127413-114127435 CCTTCTCTAGAGGAGCCTTGGCC 0: 1
1: 0
2: 0
3: 10
4: 143
Right 912952126 1:114127440-114127462 GGGCAGTCCCAGAAAAGTCAAGG No data
912952119_912952130 26 Left 912952119 1:114127413-114127435 CCTTCTCTAGAGGAGCCTTGGCC 0: 1
1: 0
2: 0
3: 10
4: 143
Right 912952130 1:114127462-114127484 GTCCTGTTGGCTTTAGAACCTGG No data
912952119_912952131 27 Left 912952119 1:114127413-114127435 CCTTCTCTAGAGGAGCCTTGGCC 0: 1
1: 0
2: 0
3: 10
4: 143
Right 912952131 1:114127463-114127485 TCCTGTTGGCTTTAGAACCTGGG 0: 1
1: 0
2: 0
3: 16
4: 158
912952119_912952129 13 Left 912952119 1:114127413-114127435 CCTTCTCTAGAGGAGCCTTGGCC 0: 1
1: 0
2: 0
3: 10
4: 143
Right 912952129 1:114127449-114127471 CAGAAAAGTCAAGGTCCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912952119 Original CRISPR GGCCAAGGCTCCTCTAGAGA AGG (reversed) Intronic
900015404 1:145515-145537 GGCTCAGGCTGCTGTAGAGAAGG - Intergenic
900045669 1:504109-504131 GGCTCAGGCTGCTGTAGAGAAGG - Intergenic
900067869 1:745824-745846 GGCTCAGGCTGCTGTAGAGAAGG - Intergenic
901059320 1:6464889-6464911 GGCCAAGGCACATGGAGAGATGG + Intronic
903035503 1:20490218-20490240 AGCCCAGGCTCCCGTAGAGATGG + Intergenic
903218604 1:21856380-21856402 GGCAAGGGCTACTCTAGATAGGG - Intronic
903606365 1:24577883-24577905 GGCCATGGCTCCTTTAGGGGTGG + Intronic
904058168 1:27686016-27686038 GCCCAAGGCACCTCCAGAGGTGG + Intergenic
905494361 1:38372861-38372883 GGACAAGGCCCATCTAGAAATGG + Intergenic
905927013 1:41758355-41758377 GTCCAAATCTCCTCTGGAGAGGG + Intronic
907651396 1:56298311-56298333 GACCAAGACTTCTCTAGAAAGGG - Intergenic
910448186 1:87319951-87319973 GTCCTAGGCTCTGCTAGAGAGGG + Intergenic
912491692 1:110066023-110066045 GGCCAGGCCTCCACTGGAGATGG - Intronic
912698020 1:111855914-111855936 GGCCATAGCTCCTCTTGAGGGGG - Intronic
912722017 1:112028374-112028396 GGCCCAGGCTGCTCCAGAAAGGG + Intergenic
912952119 1:114127413-114127435 GGCCAAGGCTCCTCTAGAGAAGG - Intronic
913085861 1:115435970-115435992 GGCCAAGGCTCATATAAAAAGGG + Intergenic
915109757 1:153555737-153555759 GGCAAAGGCTCCTGTGGAAAAGG + Intergenic
915636934 1:157194124-157194146 GACTAAGGCTCATCTAGGGAGGG + Intergenic
922103234 1:222491203-222491225 GGCTCAGGCTGCTGTAGAGAAGG - Intergenic
922263555 1:223963715-223963737 GGCTCAGGCTGCTGTAGAGAAGG - Intergenic
924345396 1:243068710-243068732 GGCTCAGGCTGCTGTAGAGAAGG - Intergenic
1065039482 10:21676909-21676931 AGCCAAGCCTCTTCTAGATAAGG - Intronic
1066730939 10:38436099-38436121 GGCTCAGGCTGCTGTAGAGAAGG + Intergenic
1067563055 10:47317429-47317451 AGCCAAGGCTCCTCCAGGGCAGG - Intergenic
1068536112 10:58243400-58243422 GGTCCAGGCTCCGCAAGAGAGGG - Intronic
1072547079 10:96448103-96448125 TGCCAGGTCTCCTGTAGAGAAGG + Intronic
1073463122 10:103677911-103677933 GGCCAAGCCTGGACTAGAGAGGG - Intronic
1074307826 10:112295557-112295579 AGCAAAGCCTCCTGTAGAGATGG + Intronic
1076874277 10:133208233-133208255 CCCCAAGGACCCTCTAGAGAGGG + Intronic
1076874295 10:133208279-133208301 CCCCAAGGACCCTCTAGAGAGGG + Intronic
1076874312 10:133208324-133208346 CCCCAAGGACCCTCTAGAGAGGG + Intronic
1076874330 10:133208370-133208392 CCCCAAGGACCCTCTAGAGAGGG + Intronic
1076874347 10:133208415-133208437 CCCCAAGGACCCTCTAGAGAGGG + Intronic
1076874365 10:133208461-133208483 CCCCAAGGACCCTCTAGAGAGGG + Intronic
1076874382 10:133208506-133208528 CCCCAAGGACCCTCTAGAGAGGG + Intronic
1076874400 10:133208552-133208574 CCCCAAGGACCCTCTAGAGAGGG + Intronic
1076971995 11:140583-140605 GGCTCAGGCTGCTGTAGAGAAGG - Intergenic
1077535764 11:3123180-3123202 GGCCACGGTTCTTCTACAGATGG + Intronic
1077905804 11:6532634-6532656 GGGCAAGGCCCCTTCAGAGAAGG - Intronic
1079035378 11:17015193-17015215 GGCCACCGCTCTTCCAGAGATGG - Intergenic
1079349412 11:19679978-19680000 GGCCAAGGCACCTGGAGTGAGGG + Intronic
1079391460 11:20025436-20025458 CTTCAAGGCTCCTCTGGAGAGGG - Intronic
1090970160 11:131635214-131635236 GCCTAAGGCTCTTCTTGAGAAGG - Intronic
1098962528 12:76753701-76753723 TGCCAAGGCTCCTGTTGAGGAGG - Intergenic
1103928074 12:124434628-124434650 GGTGAAGGCTCCTCTCGGGAGGG - Intronic
1103955840 12:124576386-124576408 GGCCAGGGCTGCTTTAGAGTTGG - Intergenic
1107702523 13:43062255-43062277 GGCCACAGCTCCTGTTGAGAAGG - Intronic
1109126845 13:58528590-58528612 CGCCAAGGCTGCTCTGGCGATGG - Intergenic
1109198756 13:59408311-59408333 GGCAAAGGCTGCTCTAGGAAAGG + Intergenic
1112569951 13:100585211-100585233 CGCCAAGGCTGCTCTAGACTTGG + Intronic
1113499530 13:110762114-110762136 TGCCCAGTCTCCTCTAGGGATGG - Intergenic
1122357268 14:101131185-101131207 GGACAGGGCTCCTCTAGATAGGG - Intergenic
1122804127 14:104248099-104248121 GCCCAGGGCACCTCTGGAGAGGG + Intergenic
1123712660 15:23000573-23000595 GGGAAAGGATCCTCTACAGACGG + Exonic
1126508242 15:49433745-49433767 GGCCACAGCTCCTCTAGAATTGG - Intronic
1128065739 15:64763403-64763425 GGCCAAGTGTCCTCTAGATGGGG - Intronic
1129174559 15:73830589-73830611 GCCAAAGGCAACTCTAGAGAAGG - Intergenic
1130330465 15:82918337-82918359 TGCCAGGGATCCTCTAGAGCAGG + Intronic
1131309236 15:91272784-91272806 CGCCAAGGCTCCTTTGGGGAGGG + Intronic
1132194271 15:99898535-99898557 GGCCCAAGCTCCTCTCAAGATGG + Intergenic
1134785445 16:16938182-16938204 GATCAAGGCTCCTGGAGAGAGGG - Intergenic
1141134518 16:81456910-81456932 TGCCACGGCTCCTCCGGAGATGG - Intronic
1141443608 16:84044711-84044733 AGAGAAGGCTCCTCCAGAGAAGG + Intergenic
1142163295 16:88570522-88570544 GGCCACGGCTCCCCTGGAGTCGG - Exonic
1142448251 16:90156940-90156962 GGCTCAGGCTGCTGTAGAGAAGG + Intergenic
1142459233 17:78385-78407 GGCTCAGGCTGCTGTAGAGAAGG - Intergenic
1143309128 17:5973780-5973802 GCCCAAGGCACCTCGAGAGAAGG + Intronic
1144645747 17:16972314-16972336 GGCCCAGGCTCTTCTAGATCTGG + Intergenic
1147565801 17:41535900-41535922 GAGCAAGGCTCCCCAAGAGACGG - Intergenic
1149455863 17:56787810-56787832 GGGCATGGCTACTATAGAGAGGG - Intergenic
1151009650 17:70479814-70479836 GTTCAAGGCTCCTAAAGAGATGG - Intergenic
1160648953 19:210891-210913 GGCTCAGGCTGCTGTAGAGAAGG - Intergenic
1161129787 19:2581174-2581196 GGCGAAGGCACTTCTAGTGAGGG - Intronic
1161170918 19:2812145-2812167 CGCCAAGCCTTCTCCAGAGAAGG - Intronic
1161299788 19:3537159-3537181 GGCCAGGGCTCGTGTAGAAATGG + Intronic
1162786874 19:13040537-13040559 GGCCAGGGCTCCTGAGGAGAGGG - Intronic
1164738862 19:30561973-30561995 GGTCATGGCTCCTGTGGAGAGGG + Intronic
1165229742 19:34379435-34379457 GGCCTTGGTTCCTCTAGTGATGG + Intronic
1168121289 19:54253929-54253951 GGTTCAGGCTCCTCTGGAGATGG - Intronic
1168181489 19:54665247-54665269 GGTTAAGGCTCCTCTGGAGGTGG + Intronic
925348156 2:3184596-3184618 GGACAAGCCTCCTGTATAGATGG - Intergenic
932907505 2:75769423-75769445 GTTCAAGGCTCCTCTATATAGGG - Intergenic
934051236 2:88212685-88212707 GGCCACAGCACCTCTAGAGGAGG + Intergenic
935600300 2:104915604-104915626 GGCCCAGTCTCCACTAGAGGAGG - Intergenic
935723348 2:105999130-105999152 ATCCAAGGCTCCTGGAGAGAAGG + Intergenic
936980711 2:118262710-118262732 TGCAAAGGCTCCTCTATAGATGG - Intergenic
944317668 2:198300774-198300796 TGCCAGGGCTCCTGAAGAGAAGG + Intronic
944964569 2:204915328-204915350 GGAGAAGGCTTCTCTAGGGAGGG - Intronic
946125321 2:217557625-217557647 GGGCAAGGCTCTCCTAGAGAGGG + Intronic
948897364 2:240933670-240933692 GGAGAAGGCTGCTCTGGAGATGG + Intronic
948930171 2:241126972-241126994 AGCCACGGCTCATCTAGAGTAGG + Exonic
948988923 2:241541979-241542001 GGCCAAGCCTGCTCTGCAGAGGG - Intergenic
1172823311 20:37758290-37758312 TGCCTAGGCTCCTCAAAAGATGG - Intronic
1174035881 20:47667978-47668000 GCCCAAGGCTCTGCTGGAGAGGG - Intronic
1176390063 21:6158762-6158784 GGCCAAGGGGCTTCTAGAGAAGG + Intergenic
1179567844 21:42260295-42260317 GGCCAGGGCTCCTCTCGAGGGGG + Intronic
1179733403 21:43379478-43379500 GGCCAAGGGGCTTCTAGAGAAGG - Intergenic
1182622003 22:31623507-31623529 GGCCAAGGCAGCTTTTGAGAAGG - Intronic
950685333 3:14613554-14613576 GGACAAGGATCCTGGAGAGAAGG + Intergenic
950839928 3:15958172-15958194 GGCCAAGGCTGCTCCACAGAGGG + Intergenic
952886697 3:38016787-38016809 GGCCAAGGCCACAGTAGAGAGGG + Intronic
954379737 3:50213196-50213218 GACCCAGGCTCCTCTACAGCCGG + Intronic
958871502 3:99564240-99564262 GAACAAGGCTATTCTAGAGATGG - Intergenic
966492638 3:180545394-180545416 TGCCAAGGCTGATATAGAGAAGG + Intergenic
968368896 3:198209236-198209258 GGCTCAGGCTGCTGTAGAGAAGG + Intergenic
968630076 4:1645741-1645763 GGGCATGGCTCCTGGAGAGAAGG + Intronic
969526019 4:7704460-7704482 GGCCACGGCACCTCTTGAGCCGG + Intronic
979257321 4:118618968-118618990 GGCTCAGGCTGCTGTAGAGAAGG + Intergenic
979331030 4:119421580-119421602 GGCTCAGGCTGCTGTAGAGAAGG - Intergenic
979731494 4:124028430-124028452 TGCCAAGTCTCCTCTAGATGGGG + Intergenic
985719782 5:1482770-1482792 GGCTAAGCCTCCTCCAGAGGTGG + Intronic
988710893 5:33773703-33773725 GGGCTAGGCTCCTGGAGAGAAGG - Intronic
990496935 5:56357692-56357714 GGCCCAGACACCTCAAGAGATGG - Intergenic
1002391484 5:178916092-178916114 GGCCAAGGATGCTCTGGTGAAGG + Intronic
1002728173 5:181314801-181314823 GGCTCAGGCTGCTGTAGAGAAGG + Intergenic
1008511170 6:52277102-52277124 GGCCGGGGCTCCTCTGGAGTGGG - Exonic
1017805214 6:157939936-157939958 GACGAAGACTCCTCTAGAGTTGG + Intronic
1023399301 7:39780237-39780259 GGCTCAGGCTTCTGTAGAGAAGG + Intergenic
1024072243 7:45796050-45796072 GGCTCAGGCTGCTGTAGAGAAGG + Intergenic
1024651149 7:51404471-51404493 GGCTCAGGCTTCTGTAGAGAAGG - Intergenic
1029681937 7:102117541-102117563 GGCCACGGCTCCCCTCGAGGGGG - Intronic
1030072973 7:105713460-105713482 GGCCCAGGCTACTGCAGAGAGGG + Intronic
1030118317 7:106080889-106080911 AGCCAAGGCACTCCTAGAGAAGG - Intergenic
1032049631 7:128639739-128639761 GGCTCAGGCTGCTGTAGAGAAGG + Intergenic
1032566820 7:132955058-132955080 GGCTAAGGCCCATTTAGAGAAGG - Intronic
1034080989 7:148277545-148277567 AGCCAAGCCTCATGTAGAGAGGG - Intronic
1034503870 7:151469838-151469860 GGCGAAGGGTTCTATAGAGAAGG + Intronic
1036691811 8:10949117-10949139 GGCCCAGGCTCCTCCAGCCAGGG - Intronic
1042857810 8:73285571-73285593 GGCCAGGGCTCGTCCTGAGACGG + Intergenic
1044380561 8:91528244-91528266 AGCGAAGGCTGATCTAGAGACGG - Intergenic
1045256717 8:100531203-100531225 GACCAATGCTTTTCTAGAGATGG + Intronic
1049162195 8:141104756-141104778 GGCCAAGGCCCAGCGAGAGAGGG + Intergenic
1049771348 8:144383493-144383515 GGCCAAGGCTGAACTAGGGAAGG - Intronic
1052362316 9:27573953-27573975 CGCCAACGCTCCTCCAGAGCGGG - Intergenic
1052727545 9:32247342-32247364 GGCCAAGGCTCTGCTAGAACAGG - Intergenic
1052988487 9:34504786-34504808 GCCCAAGGCTGCTCTAAAGAAGG - Intronic
1057927812 9:99168485-99168507 GGCCAAGGCCGCACAAGAGATGG - Intergenic
1058194151 9:101953387-101953409 GCCCAAGGGCCCTCTGGAGATGG - Intergenic
1060526829 9:124325593-124325615 AGCCACGGCTCAGCTAGAGACGG - Intronic
1060656332 9:125374963-125374985 CCCCAAGGCTCCTCCAGAGAGGG - Intergenic
1062753237 9:138271942-138271964 GGCTCAGGCTGCTGTAGAGAAGG + Intergenic
1203575750 Un_KI270745v1:6719-6741 GGCTCAGGCTGCTGTAGAGAAGG + Intergenic
1186374333 X:8982042-8982064 AGCCAAAGCTCCTCTTAAGAAGG - Intergenic
1189302669 X:39963750-39963772 GGCCAGAGCACCTCTAGAAAGGG + Intergenic
1190819730 X:53962084-53962106 GGCCAAGGCTTCTCTCTACATGG - Intronic
1192340477 X:70259619-70259641 GGCCATGGCCCCCCTGGAGATGG + Exonic
1192765324 X:74133978-74134000 GGGCAAGGCTCCTTTAGTGGAGG - Intergenic
1195301664 X:103535937-103535959 TGCCCAGGGTCCTCTAGGGAGGG + Intergenic
1198976798 X:142344666-142344688 TGCCAAGGCTGATGTAGAGAAGG - Intergenic
1201789894 Y:17827688-17827710 GGCCATGGATCCACTTGAGAAGG - Intergenic
1201811660 Y:18078301-18078323 GGCCATGGATCCACTTGAGAAGG + Intergenic
1202351541 Y:23997439-23997461 GGCCATGGATCCACTTGAGAAGG - Intergenic
1202519238 Y:25672680-25672702 GGCCATGGATCCACTTGAGAAGG + Intergenic