ID: 912952126

View in Genome Browser
Species Human (GRCh38)
Location 1:114127440-114127462
Sequence GGGCAGTCCCAGAAAAGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912952119_912952126 4 Left 912952119 1:114127413-114127435 CCTTCTCTAGAGGAGCCTTGGCC 0: 1
1: 0
2: 0
3: 10
4: 143
Right 912952126 1:114127440-114127462 GGGCAGTCCCAGAAAAGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912952126 Original CRISPR GGGCAGTCCCAGAAAAGTCA AGG Intronic
No off target data available for this crispr