ID: 912952723

View in Genome Browser
Species Human (GRCh38)
Location 1:114131561-114131583
Sequence CCTTGTGTATGAGGGGCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912952714_912952723 -10 Left 912952714 1:114131548-114131570 CCCCAGGTGTGTGCCTTGTGTAT 0: 1
1: 0
2: 0
3: 10
4: 169
Right 912952723 1:114131561-114131583 CCTTGTGTATGAGGGGCTTGGGG No data
912952713_912952723 5 Left 912952713 1:114131533-114131555 CCTGAACTGGTCTGTCCCCAGGT No data
Right 912952723 1:114131561-114131583 CCTTGTGTATGAGGGGCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912952723 Original CRISPR CCTTGTGTATGAGGGGCTTG GGG Intronic
No off target data available for this crispr