ID: 912952928

View in Genome Browser
Species Human (GRCh38)
Location 1:114133038-114133060
Sequence CTGAGGGTATGCAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 645
Summary {0: 1, 1: 1, 2: 5, 3: 62, 4: 576}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912952928_912952933 -9 Left 912952928 1:114133038-114133060 CCTTCCTCCCTGCATACCCTCAG 0: 1
1: 1
2: 5
3: 62
4: 576
Right 912952933 1:114133052-114133074 TACCCTCAGTCCAGGCTCTCTGG No data
912952928_912952937 1 Left 912952928 1:114133038-114133060 CCTTCCTCCCTGCATACCCTCAG 0: 1
1: 1
2: 5
3: 62
4: 576
Right 912952937 1:114133062-114133084 CCAGGCTCTCTGGAAGTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912952928 Original CRISPR CTGAGGGTATGCAGGGAGGA AGG (reversed) Intronic
900183802 1:1324000-1324022 CTGAGGGTCTGCTGGGCTGAGGG + Intronic
900183844 1:1324112-1324134 CTGAGGGTCTGCGGGGCTGAGGG + Intronic
900183885 1:1324208-1324230 CTGAGGGTCTGCGGGGCTGAGGG + Intronic
900482646 1:2906681-2906703 CTCAGGGGAGGGAGGGAGGAAGG + Intergenic
900527745 1:3137362-3137384 ATGAGGCTTTGCAGGAAGGAGGG - Intronic
900951082 1:5858607-5858629 CTGAGGGTCTGAGGGGAGCAGGG - Intergenic
900954959 1:5881097-5881119 CTGAGGGTAGGCAGGAGTGAAGG - Intronic
901508386 1:9701005-9701027 CTGCGGAGAAGCAGGGAGGAAGG - Intronic
901633799 1:10660350-10660372 CTGAGGGTATCCTCGGAGGTGGG + Exonic
901773177 1:11541411-11541433 CTCAGGGAAGGCAGGGAGGGTGG - Intergenic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
902987779 1:20165897-20165919 CTCAGGGTTGGCAGTGAGGAGGG + Intronic
903007065 1:20305755-20305777 CTTATGGTAGGCAGGGAGGGTGG + Intronic
903324981 1:22564268-22564290 TTGAGGGGAGGCAGGAAGGAGGG + Intronic
903570636 1:24302124-24302146 CAGAGAGTATGCACTGAGGAAGG - Intergenic
904378759 1:30097367-30097389 CTCAGGGTGTGCAGGGTGGATGG + Intergenic
905078671 1:35297368-35297390 CTGAGGGTGAGATGGGAGGATGG + Intronic
905098653 1:35498568-35498590 CAGAGTGGAGGCAGGGAGGAAGG - Intronic
905283565 1:36864705-36864727 CTCAGGGGTTACAGGGAGGAAGG - Intronic
905596721 1:39214087-39214109 CTGAAGGCAGGGAGGGAGGAGGG - Intronic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
906672149 1:47664209-47664231 CTGAGAAGAAGCAGGGAGGATGG + Intergenic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907489837 1:54801693-54801715 CTGAGGACCTGCAGAGAGGATGG - Intergenic
911496323 1:98636210-98636232 CTGAGAGTAAGAAGGGAGGCTGG + Intergenic
911647520 1:100352410-100352432 CTGAGGGAGGGCGGGGAGGAAGG + Intronic
912058626 1:105636332-105636354 CTGAGGGACAGCAAGGAGGAGGG - Intergenic
912369752 1:109164776-109164798 CTCAGGCTGGGCAGGGAGGATGG + Intronic
912458352 1:109814757-109814779 CAGATGGTCTGCAAGGAGGAGGG - Intergenic
912823478 1:112885596-112885618 CTGAGGGTGAGCTGGGAAGAAGG - Intergenic
912949461 1:114110782-114110804 CTGAGGTAGTGCAGCGAGGATGG - Intronic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
913301872 1:117379633-117379655 CTAGGGGGAAGCAGGGAGGAGGG - Intronic
913940384 1:125098253-125098275 ATGAGGGAAGGAAGGGAGGATGG - Intergenic
914007313 1:143743614-143743636 CAGAGGGTATCCTGGGAAGATGG - Intergenic
914646129 1:149654096-149654118 CAGAGGGTATCCTGGGAAGATGG - Intergenic
915511816 1:156390799-156390821 GTGAGGAATTGCAGGGAGGAGGG - Intergenic
915626795 1:157118801-157118823 CTGAGGGGAGGCAGGGTTGAAGG + Intergenic
915637365 1:157195995-157196017 CTGGGGGTATGAAGGCAGCAGGG - Intergenic
916157997 1:161877204-161877226 CTGAGGATATGCAAGGAGCATGG + Intronic
916221100 1:162445869-162445891 CTGAGGATATTCAGTGAGTAAGG + Intergenic
916236379 1:162592871-162592893 TTGGGGGTCTGGAGGGAGGATGG + Intronic
916962994 1:169907907-169907929 CTGAGGGCATGTAGGTGGGAAGG - Intergenic
917109366 1:171529401-171529423 CTGTGGGTATGCAGGAAAGGTGG - Intronic
917135718 1:171786441-171786463 CTGAGGGTATAAATGGAAGAGGG + Intronic
917301545 1:173579886-173579908 TTGAGGGCAGGCAGGTAGGATGG - Intronic
917512776 1:175681892-175681914 ATGGGGGTCTGAAGGGAGGAAGG + Intronic
917709290 1:177668327-177668349 CTAAGGGGATACAGGGAGGTTGG + Intergenic
918564690 1:185914934-185914956 CTGAGGATATCCAGGGAAGCAGG + Intronic
918586335 1:186193204-186193226 CTGAGGATGAGAAGGGAGGAAGG + Intergenic
919800080 1:201348568-201348590 CTAAGGGCAGGCAGGAAGGAGGG + Intergenic
919933618 1:202237155-202237177 CTGAGAGAGTGCAGGGAGGCAGG - Intronic
919947416 1:202329807-202329829 TTGAGGGTATGCAATGAGGATGG + Intergenic
920199300 1:204249709-204249731 CTGAGACTTTGAAGGGAGGAGGG - Intronic
920441646 1:205984880-205984902 CTGGGAGGAGGCAGGGAGGAGGG - Intronic
920659820 1:207906338-207906360 CTGAGTGTTTGCAGGAAGCATGG - Intronic
920773765 1:208915307-208915329 ATGAAGGTCTGCAGGGAAGAAGG + Intergenic
920961828 1:210670475-210670497 CTGAAGGCCTCCAGGGAGGATGG + Intronic
921514252 1:216070137-216070159 CAGAGGGCATGCGGGGTGGACGG + Exonic
922212661 1:223497635-223497657 ATGGGGGTGTGCTGGGAGGAGGG + Intergenic
922285961 1:224170857-224170879 CAGAGGGTGTGCAGCAAGGATGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923750084 1:236739493-236739515 CGGAGGGCATGAAGGCAGGACGG - Exonic
1062833888 10:623709-623731 CTGAGGGGAGGAGGGGAGGAGGG + Intronic
1063264649 10:4434427-4434449 CTGGGGGTATGCAGGAGGGTGGG - Intergenic
1063379690 10:5576648-5576670 CTGTGTGTGTGCAGGGAGTAGGG - Intergenic
1064816823 10:19274816-19274838 CTGGGGGGAGGCAGGAAGGAAGG + Intronic
1064857976 10:19792955-19792977 ACGAGAGTATGGAGGGAGGATGG - Intergenic
1065628302 10:27653468-27653490 TGCAGGATATGCAGGGAGGAGGG - Intergenic
1067438104 10:46292889-46292911 CTGAGGGTCAGCCGGCAGGAAGG + Intronic
1067697529 10:48546826-48546848 TAGAGAGCATGCAGGGAGGAGGG + Intronic
1068895523 10:62195597-62195619 CAGAGGGAATGAAGGAAGGAAGG + Exonic
1069676864 10:70254938-70254960 CTGAGGGGGTCCAGGGAGGGCGG - Exonic
1069999834 10:72368071-72368093 CTGAGGTCATCCCGGGAGGAAGG + Exonic
1070381427 10:75883705-75883727 GTGAGGGAATGAAAGGAGGAGGG + Intronic
1071301723 10:84261236-84261258 CAGAGGAGAGGCAGGGAGGAAGG + Intergenic
1073053429 10:100684023-100684045 CTGGGGGGCTGCAGGGGGGAGGG + Intergenic
1074112390 10:110431775-110431797 CTGAGGGTTGGTAGGGATGAGGG + Intergenic
1074226272 10:111487622-111487644 GTGGGGGTTTGCAGGGAAGATGG - Intergenic
1075178407 10:120187197-120187219 CTGAGTGTAAGCATGGAGGTGGG + Intergenic
1075427874 10:122355974-122355996 CTGGGGTTGTGCAGGCAGGATGG + Intergenic
1075705452 10:124497603-124497625 CTGACGGCAGGCAGGCAGGAGGG - Intronic
1075730351 10:124631971-124631993 CAGAGGGTAGGTAGGAAGGAAGG + Intronic
1076002950 10:126926826-126926848 CAGAGGGTTTGGAGGGAGCATGG + Intronic
1076261860 10:129072832-129072854 CTGATGGTAGCCAAGGAGGAAGG + Intergenic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1077253240 11:1569988-1570010 CTGAGGGGAGGCAGGGATGAGGG - Intronic
1077343229 11:2035285-2035307 CTGAGGGAATGCAGGCGGGATGG - Intergenic
1077472490 11:2770553-2770575 CTGGGGGGATGCAGGTGGGAGGG - Intronic
1078197309 11:9146696-9146718 TTGTGGGTATGCAGGGAGGGAGG + Intronic
1078524326 11:12089154-12089176 AAGTGGGTATGCAGGGAGGCTGG - Intergenic
1080336445 11:31202906-31202928 CTGAGGGGATGGATGGAGGGTGG + Intronic
1080383354 11:31796467-31796489 CTGGGGGGATGGAGGGTGGATGG + Intronic
1081338062 11:41892121-41892143 CTGAGGATATACAGAGAGGTTGG - Intergenic
1081340564 11:41922181-41922203 CTAAGGGTTTGAAGGGAGAAGGG + Intergenic
1081567315 11:44268091-44268113 CAGACAGGATGCAGGGAGGAAGG - Intronic
1081868199 11:46371290-46371312 CTGAGGGTAGACAGGATGGATGG - Intronic
1082260912 11:50075821-50075843 CTGAGAGTATGCCAGGAGGCAGG + Intergenic
1082824402 11:57567509-57567531 CGGAGGGGATGGAGGGAGGAGGG + Intronic
1082834173 11:57639769-57639791 CTTAGGGAGTGCAGGGAGAAAGG - Intergenic
1083201990 11:61126226-61126248 CAGAGGTGATGCAGGGAGGTCGG - Intronic
1083319214 11:61834996-61835018 CTGGGGGCAGGCAGGGAGGAGGG - Intronic
1083891486 11:65597982-65598004 CTGGGGTGATGCAGGGAGGAGGG - Exonic
1084134603 11:67167347-67167369 CTGATGGTATGCAGGAAGGCAGG + Intronic
1084740931 11:71139147-71139169 CTGAGCGTCTGCTGGGAGGTGGG + Intronic
1085064757 11:73484077-73484099 CTGAAGATAAGGAGGGAGGAAGG - Intronic
1085462418 11:76702127-76702149 CTGGGGGTGTTCACGGAGGATGG - Intergenic
1086070592 11:82795051-82795073 CTGATGGTCTCCAGGCAGGAGGG - Intergenic
1086558665 11:88141867-88141889 ATGAGGGTAGGAAGGTAGGAGGG - Intronic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1087603042 11:100339915-100339937 CTGGGGGTAGGGAGGGTGGAGGG - Intronic
1088135312 11:106550056-106550078 CTGAGGGTAGGCAAAGAAGAGGG - Intergenic
1088391459 11:109319478-109319500 CTGAGGCACTGCAGGCAGGAAGG - Intergenic
1090076666 11:123584206-123584228 CGGAGGGTGGGCAGGGAGGAGGG - Intronic
1090093722 11:123723689-123723711 CTGAGCGTGAGCAGGGAGGTTGG - Intergenic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1090420632 11:126572744-126572766 CTCAGGGTGTGCAGGCAGCAGGG + Intronic
1090463090 11:126909416-126909438 CTGTGGGTATGCTGGGAGCTGGG - Intronic
1090633294 11:128669513-128669535 ATGCTGGAATGCAGGGAGGATGG - Intergenic
1090761468 11:129840408-129840430 ATGAGGAAGTGCAGGGAGGAGGG + Intronic
1091140031 11:133227104-133227126 CAGAGGGTGTGCAGGGGCGAAGG - Intronic
1091146573 11:133285213-133285235 CACAGGGTATGTGGGGAGGAGGG + Intronic
1202826215 11_KI270721v1_random:90474-90496 CTGAGGGAATGCAGGCGGGATGG - Intergenic
1091849277 12:3682191-3682213 CTGAGGGTGGGGAAGGAGGAAGG - Intronic
1092643823 12:10547586-10547608 CTGAGGGTTGGCAGGGATGTGGG - Intergenic
1092937662 12:13379123-13379145 CAGAGGAAATGCAGGGAGGTGGG - Intronic
1094379893 12:29831328-29831350 CTGAGGCTGTGCAGGGTGGCAGG + Intergenic
1095040669 12:37436649-37436671 AGGAGGGAATGCGGGGAGGAAGG + Intergenic
1095646252 12:44551589-44551611 CTGAGGGTAGGCACTGAAGAAGG - Intronic
1096358884 12:50966503-50966525 CTGAGGGTGTGGAGGTGGGAAGG - Intronic
1096618020 12:52845362-52845384 CTGAGGAAATGCAGGAAGGTCGG - Intronic
1096681085 12:53255674-53255696 CTGGTGGAATGCAGGGTGGAAGG + Intergenic
1096715301 12:53487429-53487451 CTGTGGGAATGAAGGAAGGAGGG + Intronic
1096716991 12:53497615-53497637 CTGAGGTGATGCTGGGAAGAAGG - Intronic
1096760301 12:53836237-53836259 GTGATGGAATGCAGGTAGGAAGG + Intergenic
1096861591 12:54532639-54532661 CTGAGGGCAGGCAGGGTGGGTGG - Intronic
1099492971 12:83308504-83308526 CTGAGGGAATGCAGTGAAAAGGG - Intergenic
1100190394 12:92184835-92184857 CTGAGGGTTGGCAGAGTGGAGGG - Intergenic
1100433442 12:94550950-94550972 CAGAGGGTGTGTAGGAAGGACGG + Intergenic
1100726517 12:97414569-97414591 CTGAGGTATTGGAGGGAGGAAGG - Intergenic
1101818420 12:108163680-108163702 GTGATGGAATGCAGGCAGGAAGG + Intronic
1101851219 12:108403953-108403975 CTGGGTGTATGCAGGGTGGAGGG - Intergenic
1102431531 12:112887939-112887961 CTGAGGATCTGATGGGAGGAGGG + Intronic
1102614199 12:114138768-114138790 CTGAGGGTGTGCAGAGAGCTAGG + Intergenic
1102989379 12:117303786-117303808 CTGAGTTTGTGCAGGGAGGATGG + Intronic
1103649355 12:122421664-122421686 GTGGGGCTGTGCAGGGAGGAGGG + Intronic
1104160184 12:126171491-126171513 CTGAGGCTATGCAGGGTGTTGGG + Intergenic
1104274965 12:127318308-127318330 CTGTGGGGATGCAGTGAGGATGG - Intergenic
1104581111 12:130011453-130011475 CTGAGTGTGTGCACGGAGGGTGG - Intergenic
1104607118 12:130198325-130198347 CTCATGCTCTGCAGGGAGGAGGG - Intergenic
1104759688 12:131289479-131289501 CTGAGGCTGTGCAGGGAGGAGGG - Intergenic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1104821025 12:131677734-131677756 CTGAGGCTGTGTAGGGAGGAGGG + Intergenic
1104919860 12:132285149-132285171 CTGAGGGAGGGCAGGCAGGAGGG - Intronic
1104940239 12:132391879-132391901 CAGAGGGTCTCCAGGGAGAACGG - Intergenic
1105847215 13:24303541-24303563 CTGAAGGCGTGCAGGCAGGAGGG - Exonic
1106410644 13:29508981-29509003 CAGAGTGCATGCAGGGCGGAGGG - Intergenic
1106605285 13:31223292-31223314 CTGGGGGAATGCAGAGGGGAAGG + Intronic
1107103034 13:36614475-36614497 CTGAAGGTGTGCAGTGAGGATGG - Intergenic
1107139710 13:36984741-36984763 CGGTGGGAAGGCAGGGAGGAGGG + Intronic
1107820970 13:44285387-44285409 GGCAGGGTAGGCAGGGAGGAGGG - Intergenic
1107821196 13:44287135-44287157 CTCAGGGTATTGAGGGTGGATGG + Intergenic
1108697049 13:52911631-52911653 TAGAGGGTATGCAGAGAAGAAGG + Intergenic
1109181531 13:59219961-59219983 CAGAGGGGAGGAAGGGAGGAAGG + Intergenic
1109710536 13:66152927-66152949 GTGAAAGTATGCAGAGAGGAGGG - Intergenic
1110702257 13:78562530-78562552 ATGATGGTTTGCAGGGAGGGAGG + Intergenic
1111166583 13:84465118-84465140 CTTAAGGTAAGCATGGAGGATGG + Intergenic
1111501437 13:89126063-89126085 CTGTGGGGAAGCAGAGAGGAAGG + Intergenic
1111931601 13:94518305-94518327 CTGAGGGTAAGCAGTGTGGAGGG - Intergenic
1112665787 13:101571601-101571623 GTGAGGGTAAGCAGGGTGCAAGG - Intronic
1112728360 13:102330744-102330766 ATGAGGCCATGAAGGGAGGAGGG - Intronic
1114237452 14:20835195-20835217 CTGAGGGTTTGAAGGGGGAAGGG + Intergenic
1114617734 14:24077131-24077153 CTGAGGGCAAGCAGAGAGGGTGG - Intronic
1114680960 14:24483047-24483069 GTGAGGTTAAGCTGGGAGGATGG + Intergenic
1114988815 14:28262948-28262970 TTGAGGGTTCGCAGGGAAGATGG - Intergenic
1115495623 14:34001539-34001561 CTGGGGCTTTCCAGGGAGGAAGG + Intronic
1115965583 14:38884101-38884123 ATGAGTGTGTGCATGGAGGAGGG + Intergenic
1116023162 14:39485547-39485569 CTAAGGGTCTGCAGGCAGAAAGG + Intergenic
1117582336 14:57164621-57164643 CTGAGGGCATGAAGAGAGGGTGG + Intergenic
1118384233 14:65242069-65242091 CTGGGGATATGCAGAGAGCAAGG - Intergenic
1118718923 14:68580092-68580114 CTCAGGGCAGGCAGGTAGGATGG - Intronic
1118837238 14:69485606-69485628 CTCAGGCTAAGGAGGGAGGAAGG + Intronic
1119170278 14:72529651-72529673 CTGTGGGATTGCAGGGAGGGGGG - Intronic
1119474336 14:74918526-74918548 CTGAGGGGCTGCAGGGTGGTCGG - Exonic
1120375942 14:83707267-83707289 CTAAGGATATGCATGTAGGAAGG - Intergenic
1120515447 14:85464834-85464856 CTGAGGCTAAGCAGGGAAGTGGG - Intergenic
1121092800 14:91194498-91194520 CTGAGGTTAGGGAGGGGGGATGG + Intronic
1121092952 14:91195509-91195531 CTGAAGGTATGCAGGGAGGTAGG + Intronic
1121526855 14:94625219-94625241 CTGAGGGGCTACAGAGAGGAAGG + Intergenic
1121556317 14:94840418-94840440 CTTGGGGTGTGCAGGGAGGTGGG + Intergenic
1121727926 14:96166493-96166515 CTGAGGACCTGCAGGGAGGGTGG + Intergenic
1122099249 14:99394252-99394274 TTGAGGGTAAGGAGGGAGGCAGG - Intergenic
1123146803 14:106141237-106141259 CTGAGTGGGAGCAGGGAGGAGGG - Intergenic
1123697199 15:22887381-22887403 CTGAGGAGAGGCTGGGAGGAGGG - Intronic
1124103292 15:26715055-26715077 CTGAGGGCATGCAGACAAGAGGG + Intronic
1124151256 15:27180518-27180540 CTGAGGGTATACGTGGAGCAGGG - Intronic
1124604919 15:31162727-31162749 GAGAGGGGATGCAGGGATGAGGG + Intergenic
1124841651 15:33247633-33247655 GTGAGGGTAAGCAGGGGGGCGGG + Intergenic
1124937327 15:34185657-34185679 CTGAGACAATGCAGGGAAGAAGG + Intronic
1125762399 15:42105498-42105520 CTGAGGACACCCAGGGAGGATGG + Intergenic
1125989433 15:44091855-44091877 CTGAGGGGAAGCAGGGAGAGAGG - Intronic
1127068586 15:55265794-55265816 CTGAAGGGATGCATGGAGGTAGG + Intronic
1127480191 15:59371536-59371558 CTAAGGTTATACAGGGAGGGAGG + Intronic
1127877725 15:63125075-63125097 CTTAGGGAGTCCAGGGAGGAAGG + Intronic
1127982920 15:64047169-64047191 GTGAGGGGGTGAAGGGAGGAAGG + Intronic
1128579535 15:68799248-68799270 CTGAGGGGCTGCTGGAAGGAAGG + Intronic
1128870909 15:71154621-71154643 CTGCGGGTAAGCAGGAAGGCTGG + Intronic
1129980554 15:79865643-79865665 CTGAGGGTAAGCAGGGATGAGGG - Intronic
1131343656 15:91626709-91626731 CTAAGGGGATGAAGAGAGGAGGG + Intergenic
1131361181 15:91792068-91792090 CAAAGGGGATGGAGGGAGGAGGG - Intergenic
1131446462 15:92502041-92502063 CTGAGGTTCTGCAGGGAGGAGGG - Intergenic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133393802 16:5430121-5430143 CTGGGGGGATACAGGGAGAAGGG + Intergenic
1134694608 16:16214330-16214352 CTGGGGGTCTTCAGGGAAGAAGG + Exonic
1134977228 16:18580307-18580329 CTGGGGGTCTTCAGGGAAGAAGG - Intergenic
1135016516 16:18928284-18928306 CGGAGGGTAGGGAGGGAGGGAGG + Intergenic
1136012685 16:27374312-27374334 CGGAAGTTCTGCAGGGAGGAAGG - Intergenic
1136333633 16:29597264-29597286 CGGAGGGTAGGGAGGGAGGGAGG + Intergenic
1136692263 16:32040311-32040333 CTGAGTGGGAGCAGGGAGGAGGG + Intergenic
1136792759 16:32983540-32983562 CTGAGTGGGAGCAGGGAGGAGGG + Intergenic
1136877096 16:33870514-33870536 CTGAGTGGGAGCAGGGAGGAGGG - Intergenic
1137552688 16:49451438-49451460 GTGAGAGTCTGCAGGCAGGAAGG - Intergenic
1138267906 16:55673254-55673276 CTGATGGAATGCACTGAGGAGGG - Intronic
1138482576 16:57313317-57313339 CAGAGGGTATGAGGGGAGGCTGG + Intergenic
1139139687 16:64246198-64246220 CTGAAAGTGTGGAGGGAGGAAGG + Intergenic
1139475084 16:67199098-67199120 CTGGGGGTAGGAAGGTAGGACGG - Exonic
1139513450 16:67440148-67440170 CTGAGGGGCTGCCTGGAGGATGG - Intronic
1139664382 16:68446624-68446646 GTGAGGGTTTGCATGGATGATGG - Intronic
1139851499 16:69953373-69953395 CTGAGTGGATGCAGGGAGGGGGG - Intronic
1139880475 16:70176285-70176307 CTGAGTGGATGCAGGGAGGGGGG - Intronic
1140134695 16:72195519-72195541 CTGAGCTCATGCAGGCAGGATGG - Intergenic
1140357522 16:74319168-74319190 TGGAGGGGATGCAGGGAGGGTGG - Intergenic
1140372035 16:74419232-74419254 CAGAGTGGATGCAGGGAGGGGGG + Intronic
1140893529 16:79305513-79305535 CTGAGGGTCTGCAAGGTGGATGG + Intergenic
1141060069 16:80858728-80858750 CTTAGAGTATGCAGAAAGGAGGG - Intergenic
1141137006 16:81473022-81473044 CTGAGGGTATGCAGAGGAGATGG - Intronic
1141489540 16:84362884-84362906 CTGTGGGTACGGCGGGAGGACGG - Intergenic
1141665211 16:85462348-85462370 CTGAGGGTAGGGAGGGTGGAGGG - Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1142074244 16:88108223-88108245 CTGTGGGGATGCGGGGAGGGGGG + Intronic
1203095016 16_KI270728v1_random:1245228-1245250 CTGAGTGGGAGCAGGGAGGAGGG + Intergenic
1143020924 17:3916842-3916864 CTGGGGGTCTGCAGCGAGCAAGG + Intergenic
1143320174 17:6063248-6063270 CTAAGGAAAGGCAGGGAGGAGGG - Intronic
1144776764 17:17788733-17788755 CTGAGGGGAGGCAGGGAGAGAGG - Intronic
1145277353 17:21440536-21440558 GTGAGGGTGAGCTGGGAGGAAGG + Intergenic
1145304965 17:21668960-21668982 CTGGGGGTCTGCAGGGAGGTCGG + Intergenic
1145315191 17:21726431-21726453 GTGAGGGTGAGCTGGGAGGAAGG + Intergenic
1145713622 17:26998367-26998389 GTGAGGGTGAGCTGGGAGGAAGG + Intergenic
1145972077 17:28962125-28962147 CAGAGGGTATGCGGGGAGAGGGG - Intronic
1146674495 17:34763961-34763983 CCGAGGGCATGATGGGAGGATGG + Intergenic
1146798374 17:35798937-35798959 CTGTGTGGATGCTGGGAGGATGG + Intronic
1146821170 17:35984524-35984546 CTGAGGGCATGGAGGAGGGAAGG + Intronic
1148820621 17:50357447-50357469 CAGAGGACATGCAGGGAGCAGGG + Intronic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1149962669 17:61129147-61129169 CTGAGGGTATGGAGTAAGAAAGG + Intronic
1150091735 17:62332438-62332460 CTGGGGGTGGGCTGGGAGGAAGG + Intergenic
1150502770 17:65667048-65667070 CTGGAAGTATGCAGGGAGGGTGG + Intronic
1150963551 17:69940876-69940898 CTGAGGCTGTGCAGGGAAGCAGG - Intergenic
1151336785 17:73444578-73444600 ATGAGGTGATTCAGGGAGGATGG - Intronic
1151427929 17:74043266-74043288 GGGAGGGGAGGCAGGGAGGAAGG + Intergenic
1151966957 17:77436552-77436574 CTGAGGGTCTGCGTGGAGGAGGG - Intronic
1152182013 17:78828427-78828449 CTGAGGGAGAGCTGGGAGGAGGG - Intronic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1152581247 17:81166379-81166401 CGGAGGGGAGGCATGGAGGAGGG + Intergenic
1152942930 17:83181956-83181978 CTGGGGGGGTGCAGGGGGGATGG + Intergenic
1153339753 18:3961603-3961625 GTGAGGTTTTGCTGGGAGGAGGG - Intronic
1154501753 18:15000916-15000938 CTGGGGGTGGGCAGGGCGGAGGG + Intergenic
1156198467 18:34803131-34803153 CTGGGGGTATGCAGGGATTTAGG - Intronic
1157126502 18:44961119-44961141 CAGAGGGAATGAAGGAAGGAGGG + Intronic
1157430299 18:47619342-47619364 TTGAGGGGAGGCAGGGAGGGTGG - Intergenic
1157660961 18:49443346-49443368 CTGAGAGTATAAAGGGATGAGGG - Intronic
1157728728 18:49985738-49985760 CTTAGGGTTTTCAGGGAAGAGGG - Intronic
1157751978 18:50187384-50187406 CTGAGGTGATGCAGTGAGAAAGG + Intronic
1158202979 18:54960362-54960384 CTGAGAGGATGCAGTGGGGAAGG - Intergenic
1159142901 18:64418916-64418938 CTTAGGGTGTACAGGGAGCATGG + Intergenic
1159969212 18:74628397-74628419 CTGCGGGTAGGCAGGCAGAATGG - Intronic
1160153969 18:76418898-76418920 CAGAGGGTCTGCAGGGCAGATGG + Intronic
1160460077 18:79032308-79032330 CTGAGAACATGCAGGGAGGAAGG - Intergenic
1160812615 19:1019490-1019512 CTGGGGGGCTGCAGGGAGGAAGG + Intronic
1160872195 19:1282533-1282555 AGGAGGGTGTGAAGGGAGGAGGG + Intergenic
1160872219 19:1282593-1282615 GTGAAGGTGTGAAGGGAGGAGGG + Intergenic
1160872237 19:1282636-1282658 AGGAGGGTGTGAAGGGAGGAGGG + Intergenic
1160872247 19:1282663-1282685 AGGAGGGTGTGAAGGGAGGAGGG + Intergenic
1160895524 19:1400293-1400315 CTGGGGGTCTGCTTGGAGGAGGG + Intronic
1161089661 19:2353493-2353515 TTGAGGGTCTGCAGAGAGGCCGG - Exonic
1161220458 19:3115864-3115886 CTGAGGCTGTGAGGGGAGGAGGG + Intronic
1161410324 19:4113383-4113405 CTGAGGGTGTGCAAGGGGAAAGG + Intronic
1162015918 19:7846427-7846449 CCGAGGGTGGGCAGGCAGGATGG + Intronic
1162171182 19:8790248-8790270 CTGAGGGGAGGGAGGGAGGGAGG + Intergenic
1162755783 19:12858750-12858772 CTGCGGGGCTGCAGGGAAGATGG + Intronic
1163102747 19:15107808-15107830 CTGAGGGCCTGGAGGGTGGAGGG + Intronic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1163648127 19:18501831-18501853 CTGCGGGTGGGCAGGAAGGAGGG + Intronic
1163748011 19:19059427-19059449 CTGGGAGTCTCCAGGGAGGAGGG - Intronic
1164670614 19:30070151-30070173 CTGAGGCCAAGCTGGGAGGAGGG - Intergenic
1164706429 19:30323457-30323479 CTAAGTGTATGCAGGGAGAGGGG + Intronic
1164754994 19:30682678-30682700 CTGAGGGGAGGCAGAGAGGGAGG - Intronic
1165086468 19:33351526-33351548 CTGAGGATGGGCAGGGAGCAGGG + Intergenic
1165258777 19:34596246-34596268 CTGTGGCTGAGCAGGGAGGATGG + Exonic
1165293297 19:34906096-34906118 CAGAGAAGATGCAGGGAGGAAGG + Intergenic
1165385010 19:35505218-35505240 GGAAGGGTAGGCAGGGAGGAAGG + Intronic
1165891911 19:39117728-39117750 CTGAAGATCTGGAGGGAGGAAGG - Intergenic
1166145153 19:40829182-40829204 TTGAGGGTAAGATGGGAGGAGGG - Intronic
1166147616 19:40848380-40848402 CTGCGGGTATGGCGGGAGAAGGG + Intronic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166198909 19:41223603-41223625 CTGGGGGTCTCCAGGGTGGAGGG + Intronic
1166561824 19:43737683-43737705 CTGAGGGTGGGCAGGATGGAAGG + Intronic
1168272465 19:55257826-55257848 CTGAGGGCAGGCAGGGAGCCTGG - Intronic
1168296489 19:55379504-55379526 ATGGGGGCATGCAGGGATGAAGG - Intronic
1168427861 19:56253312-56253334 CAGAAGGTGGGCAGGGAGGAGGG + Intronic
925021601 2:574002-574024 CGGTGGGTTTTCAGGGAGGAGGG - Intergenic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
925276465 2:2651668-2651690 CTGTGGGAAAGCAGGGAGGCAGG + Intergenic
925472774 2:4180718-4180740 CTGAGGGCATCCAGTGAAGAAGG - Intergenic
925858938 2:8156601-8156623 CTGAGTGTGGGCAGGGAGCAGGG + Intergenic
926339697 2:11894846-11894868 CTGAGGGTAAGGAGGTGGGAAGG + Intergenic
926587149 2:14699366-14699388 CTGAGTGCATGGAGGAAGGAGGG - Intergenic
926985956 2:18623634-18623656 CTGAGGTTATGCAGCTAGTAAGG - Intergenic
928401018 2:30978884-30978906 CTCAGGGTAAGCATAGAGGATGG + Intronic
929170397 2:38926685-38926707 CTGGGGTTCTGCAGGGAGGAAGG + Intronic
929580381 2:43078558-43078580 CCAGGGGTATCCAGGGAGGAGGG - Intergenic
929826081 2:45310532-45310554 CTGAGGATACTCAGAGAGGATGG - Intergenic
929826116 2:45310679-45310701 CTGAGGATATTCGGAGAGGATGG - Intergenic
929826133 2:45310753-45310775 CTCAGGATACGCAGAGAGGATGG - Intergenic
929826244 2:45311242-45311264 CTGAGGGGATTCGGGGAGAATGG - Intergenic
930055200 2:47246525-47246547 CTGGGGATATGCAGTGAGGAAGG - Intergenic
931574977 2:63709347-63709369 CTGAGGGTAAGAATGGAGGAGGG - Intronic
931744342 2:65278858-65278880 CTGAGTGTAGGAAGGAAGGAAGG + Intergenic
932484542 2:72075696-72075718 CTGAGGGAATGCGGAGAGGTGGG - Intergenic
934163334 2:89272617-89272639 CTCAGGGCACGCAGGGAGGGTGG + Intergenic
934565028 2:95334207-95334229 CAGAGTGTATGCAGGAAGCACGG - Intronic
934571721 2:95376806-95376828 CTGAGGGCTGGCAGTGAGGATGG - Intronic
934902097 2:98167576-98167598 CTGAGGGTCTGGAGGGACCAAGG + Intronic
935448337 2:103180315-103180337 CAGAGGGGAAGCCGGGAGGAGGG + Intergenic
935578674 2:104736682-104736704 GGGAGGCTATGCTGGGAGGATGG + Intergenic
935595490 2:104874160-104874182 CTGCGGGTCTCCTGGGAGGAAGG + Intergenic
935854018 2:107255879-107255901 CTGGGGGTTTGCCGGGGGGAAGG - Intergenic
936525235 2:113236766-113236788 CTCAGGGTCTGCAGGAAGGTCGG - Intronic
937184744 2:120029827-120029849 CTGAGTGTATGCATGCAGGCAGG - Intronic
937793329 2:125986367-125986389 CGGAGGGAATGAAGGAAGGAAGG + Intergenic
937825599 2:126365442-126365464 GTGAGGGCATGCAGGGTGTAAGG + Intergenic
938159665 2:128973856-128973878 CTGGTGGCAGGCAGGGAGGAGGG - Intergenic
939496906 2:142935794-142935816 CTGAGGGTATGAAGGGGGAAGGG + Intronic
939733849 2:145819312-145819334 AGGAGGGGATGGAGGGAGGAAGG - Intergenic
940290921 2:152076942-152076964 CAGAGAGTAAGCAGGGAGGGGGG + Intronic
942855793 2:180545976-180545998 TTGAAGGTATGGAGTGAGGAAGG + Intergenic
943927149 2:193799657-193799679 TTGTGTCTATGCAGGGAGGAGGG - Intergenic
944049997 2:195456953-195456975 CATAGTGCATGCAGGGAGGAGGG - Intergenic
944797241 2:203199812-203199834 GGGAGGGAATGGAGGGAGGAAGG - Intronic
946077832 2:217090076-217090098 TGGAGGGTAGGGAGGGAGGACGG + Intergenic
946379020 2:219332076-219332098 CTGAGGGAAAGCAGGATGGAGGG - Intronic
946570497 2:221018990-221019012 ATGATGGTGTGCAGGGAGGGAGG + Intergenic
947489172 2:230579084-230579106 CTCATGGTGTGGAGGGAGGAAGG - Intergenic
948115361 2:235491407-235491429 CGGAGGCTGTGCAGGGAGGATGG - Intergenic
948571900 2:238922927-238922949 CTGAGTGCCAGCAGGGAGGATGG - Intergenic
948741434 2:240049027-240049049 CTCTGGGTCAGCAGGGAGGAGGG + Intergenic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1168954030 20:1821661-1821683 GTGAATGTCTGCAGGGAGGAAGG - Intergenic
1169178340 20:3539534-3539556 CTGAGCATAAGCAGGGAGGTGGG + Intronic
1169304617 20:4477679-4477701 CTGAGGCTGTGGAGGAAGGAGGG + Intergenic
1169468228 20:5860143-5860165 CTGCGGGTAAGAAGGTAGGAAGG + Intronic
1169514046 20:6297038-6297060 CTAAGGGTATTCAGGGTGGCTGG - Intergenic
1169903174 20:10573261-10573283 CTGAAGGTTTGTATGGAGGAAGG - Intronic
1170326180 20:15156780-15156802 CTGAGGGTCTGCTAAGAGGAAGG - Intronic
1171173913 20:23037026-23037048 CAGAGCGTCTGCAGAGAGGAAGG - Intergenic
1171456659 20:25276289-25276311 CAGAGGGTAAGGAGGGAGGTGGG + Intronic
1171522482 20:25786431-25786453 CTGGGGGCCTGCAGGGAGGTCGG + Intronic
1171535213 20:25881259-25881281 AGGAGGGAATGCTGGGAGGAAGG + Intergenic
1171554345 20:26069452-26069474 CTGGGGGCCTGCAGGGAGGTCGG - Intergenic
1171572643 20:26268637-26268659 AGGAGGGAATGCTGGGAGGAAGG - Intergenic
1171727603 20:28639572-28639594 CTGAGGTTTTGTAGGGAGGAAGG - Intergenic
1171805834 20:29679631-29679653 AGGAGGGAATGCTGGGAGGAAGG - Intergenic
1171838228 20:30176804-30176826 AGGAGGGAATGCTGGGAGGAAGG + Intergenic
1171933951 20:31256126-31256148 CTCAGATTCTGCAGGGAGGATGG - Intergenic
1171982799 20:31639114-31639136 CTGGAGTTAGGCAGGGAGGAAGG - Intronic
1172488188 20:35312543-35312565 CTGTGAGAGTGCAGGGAGGATGG + Intronic
1172946447 20:38693177-38693199 CTGGGGGCCTGCTGGGAGGAGGG - Intergenic
1173026867 20:39315741-39315763 CTGAGAGGGTGCAGGGAGGTAGG - Intergenic
1173155281 20:40603252-40603274 ATGAGGGAAGGGAGGGAGGAGGG + Intergenic
1173502077 20:43561288-43561310 CTGAGGGCAGTCAGGAAGGAGGG + Intronic
1173983312 20:47241544-47241566 GTGAGGGCAGGCAGGGAGGAGGG + Intronic
1174262773 20:49308698-49308720 TGGAGGGGATGCAGGTAGGAAGG - Intergenic
1174564148 20:51452627-51452649 ATGAGGTTGGGCAGGGAGGACGG - Intronic
1175058962 20:56224334-56224356 CTAAGGATATGCAAGGGGGAAGG + Intergenic
1175216891 20:57395902-57395924 CTGAGGGCATGGAGGGAGGTGGG + Intronic
1175222492 20:57425472-57425494 CTGAGGAACTGCAGGGAGGCCGG + Intergenic
1175293334 20:57892821-57892843 CGGAGGGTGTGCAGGGATGGAGG - Intergenic
1175751266 20:61499579-61499601 CTGAGGTCACACAGGGAGGAGGG + Intronic
1175903591 20:62369338-62369360 CTGAGCGTATGGAGGGCGGGGGG + Intergenic
1175958463 20:62623191-62623213 CGGAGGCTGTGGAGGGAGGACGG - Intergenic
1176290825 21:5043725-5043747 CTGGGAGAATGCAGTGAGGAAGG + Intergenic
1176314130 21:5225878-5225900 CTGAGGTTTGGTAGGGAGGAAGG - Intergenic
1176656285 21:9591409-9591431 CTGGGGATCTGCAGGGAGGTCGG + Intergenic
1177271745 21:18857690-18857712 CTGAAGGTGTGCTGGTAGGATGG + Intergenic
1178047302 21:28709833-28709855 CAGAGAATATGCATGGAGGATGG + Intergenic
1178485988 21:33020396-33020418 CTGATGGCTAGCAGGGAGGAGGG + Intergenic
1179603908 21:42499648-42499670 GTGCGGCTCTGCAGGGAGGAGGG + Intronic
1179866430 21:44219916-44219938 CTGGGAGAATGCAGTGAGGAAGG - Intergenic
1179896110 21:44364638-44364660 CTCAGGGTGTGCTGGGAGAATGG + Intronic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1180195930 21:46194391-46194413 CTGAGTGAATGTAGAGAGGAGGG - Intronic
1180391942 22:12291997-12292019 CTGAGGTTTGGTAGGGAGGAAGG - Intergenic
1180407802 22:12572759-12572781 CTGAGGTTTGGTAGGGAGGAAGG + Intergenic
1181079014 22:20401499-20401521 CTGAAGGGAGGCAGGCAGGAGGG - Intronic
1181266041 22:21631507-21631529 CCGAGGGTCTGCAGGTGGGAAGG + Intergenic
1181484736 22:23223601-23223623 CAGGGGGTACTCAGGGAGGAGGG + Intronic
1181745536 22:24952957-24952979 CTCCGGGTCTGCAGGGAGGGAGG + Intronic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182622926 22:31627644-31627666 TTGAGGGGAGGCAGAGAGGAGGG + Intronic
1182711789 22:32327833-32327855 CAGAGGGTGTGCAGGGAGGCCGG - Intergenic
1183026361 22:35068407-35068429 CTGTGTGTCTGCAGGCAGGAAGG + Intronic
1183509570 22:38227011-38227033 CGGAGGGGATGGAGGGACGAAGG + Intronic
1183665768 22:39244926-39244948 CTGCGGGTGCGCAGGGAGGCAGG + Intergenic
1183725486 22:39586912-39586934 CAGAAAGTATGCAGGCAGGAAGG - Intronic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
1184654775 22:45935552-45935574 CAGAGGGCATTCGGGGAGGAGGG - Intronic
1184802278 22:46768752-46768774 CAGAGGGTATGCAGGCAGCTGGG + Intronic
1184835651 22:47019553-47019575 GTGTGGGTGTGCAGGGAGGGAGG + Intronic
1185376400 22:50484453-50484475 CTGAGAGGCTGCAGGGTGGAGGG + Exonic
949906780 3:8864414-8864436 CTGGGGGTATTCACGAAGGAGGG + Intronic
950113843 3:10438027-10438049 CTGAGGCTCTGCAGGGAGCCAGG + Intronic
950327204 3:12121953-12121975 CTGAGGTTTTGCAGAGAAGAAGG - Intronic
950494241 3:13324235-13324257 CTGAGGGTGGACAGGGAGGAAGG - Intronic
950566297 3:13771769-13771791 TTGAGGGAAGGCGGGGAGGAAGG + Intergenic
950694083 3:14684109-14684131 CCTAGGGTATGCAGGGGTGAGGG - Intronic
951200184 3:19867950-19867972 CTGAGAGTAAGAAAGGAGGAGGG - Intergenic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952408580 3:33026749-33026771 CTGAGAGGATGGAGGGAGGATGG + Intronic
953699895 3:45187421-45187443 CCCAGGGTCTGCAGGGAGGCAGG + Intergenic
953972699 3:47359518-47359540 CTGAGGGTGTGCAGGGCAGCAGG - Intergenic
954415268 3:50390394-50390416 CTGAGGGTATGAAGAGAACAGGG + Intronic
954538049 3:51376036-51376058 CTGAGGGTAGGCCCTGAGGAAGG - Intronic
954706414 3:52483155-52483177 CAGGGGGTAGGCAGGCAGGAAGG - Intronic
954715017 3:52522648-52522670 CTGAGGGAATGAAGCAAGGACGG - Exonic
954735993 3:52706735-52706757 CTGAGGGTTGGGAGGGAGGCGGG - Intronic
955353905 3:58214861-58214883 CTTAGAGTTTGCGGGGAGGAAGG + Intergenic
955389790 3:58513118-58513140 CTGGGGGTCAGTAGGGAGGAGGG - Intronic
956168809 3:66416754-66416776 CAGAGGAGATTCAGGGAGGATGG - Intronic
957153416 3:76516286-76516308 GTGTGGGTATGGAGGTAGGATGG - Intronic
958477695 3:94605633-94605655 CAGAGGTTAAGAAGGGAGGAAGG - Intergenic
958800011 3:98744348-98744370 CTCAGGGGATGCAGAGAAGAGGG - Intronic
961012694 3:123447135-123447157 CTGTGGGAATGCAGTGAGGAAGG - Intronic
961958118 3:130825374-130825396 AGGAGGGAAGGCAGGGAGGAGGG + Intergenic
962345041 3:134612454-134612476 CTGAGGGGATGCAAGGCTGAGGG + Intronic
963052254 3:141152233-141152255 CTGTGGGAATGCAGGGAGCCTGG - Intergenic
964007051 3:151843536-151843558 CTGAAGGTATACAGAGAGAAGGG + Intergenic
964088253 3:152844526-152844548 CTGAGAGTATGGAAGGAGTATGG + Intergenic
965716582 3:171611284-171611306 ATGAGTGTCTGCAGGGAGCAAGG + Intronic
966130586 3:176633687-176633709 CTGTGGGAATGCAGGAAGGTGGG + Intergenic
968534043 4:1112873-1112895 GTGGGGGGCTGCAGGGAGGAAGG - Intronic
968649336 4:1754200-1754222 CTGGGGGCATGTGGGGAGGAGGG + Intergenic
968707264 4:2085567-2085589 CAGAGGGTTGGCAGGGAGCAGGG + Intronic
969526974 4:7708813-7708835 CTGAGGGAGTGGTGGGAGGATGG + Intronic
970123806 4:12787147-12787169 CAGAGGGTAAGGAGGGAGGATGG - Intergenic
972189609 4:36574453-36574475 CTGAGGGTAGACAGGGTGGCTGG - Intergenic
972929616 4:44055582-44055604 CTGAAGGCAGGCTGGGAGGAAGG + Intergenic
972976607 4:44643668-44643690 CTGAGGCTATGAAGGGAAGAGGG - Intronic
975035681 4:69677320-69677342 GTGAGGGGCTGGAGGGAGGAAGG + Intergenic
975820241 4:78263423-78263445 GTGAGCGTATGCAGGGAGGGAGG - Intronic
975895365 4:79083793-79083815 CAGATGGGATGGAGGGAGGACGG - Intergenic
976300207 4:83509354-83509376 CTGAGGGTTTGAAGGGGGAAGGG + Intronic
977668192 4:99665315-99665337 CTGAAGGCATACAGAGAGGATGG - Intergenic
978051641 4:104207815-104207837 CATAGGGTATGGAGGCAGGAGGG - Intergenic
978099801 4:104824198-104824220 CAGAGGGTAGGGAGGGAGGAGGG + Intergenic
978206898 4:106090321-106090343 CTGAGGCTGTGCAGGGAAGTGGG + Intronic
979041995 4:115810133-115810155 GTGAGGGTCTGCGGGGAGGGTGG + Intergenic
979781326 4:124654346-124654368 ATGATGGTAGGCAGGGAGTAGGG - Intergenic
979841241 4:125443393-125443415 CTGAGGGAATGTAGTGAAGACGG - Intronic
981289414 4:143056778-143056800 GTGAGGGGATGCTGGGGGGAAGG + Intergenic
981609424 4:146577674-146577696 ATGAGAGTAAGCAGGTAGGAGGG + Intergenic
983926636 4:173409883-173409905 TTAAGAGTATGCAGGGAGGCTGG - Intergenic
984898454 4:184563301-184563323 AGGAGGGAATTCAGGGAGGAAGG - Intergenic
985110291 4:186541062-186541084 CTGAGGGAATGGAGGCAGGGTGG - Intronic
985432984 4:189899474-189899496 CTGAGGTTTGGTAGGGAGGAAGG + Intergenic
985821566 5:2164120-2164142 CTGAGGGTTTGCAAGGTGCATGG - Intergenic
985836335 5:2274828-2274850 CCGGGGGTCAGCAGGGAGGAGGG + Intergenic
985875465 5:2591045-2591067 CTGAGGCTCTGCAGACAGGAGGG + Intergenic
985968949 5:3360347-3360369 CAGTGGGTATTTAGGGAGGAAGG - Intergenic
986462808 5:7990493-7990515 CTCAGGGCTGGCAGGGAGGAAGG - Intergenic
986479861 5:8175995-8176017 CTGAGGGCATGGTGGGAGGTGGG + Intergenic
986631861 5:9781836-9781858 GTGAGGATAGGCAGGGATGATGG - Intergenic
989509777 5:42272093-42272115 CTGAGGATATGCAGCTAGTAAGG + Intergenic
990097036 5:52129006-52129028 CCAAGGGTTTGCAGGGAAGAAGG + Intergenic
990241455 5:53820207-53820229 CTGAGGGGAGGAAGGGAGGGAGG + Intergenic
990497533 5:56363487-56363509 TTGTGTGTGTGCAGGGAGGAGGG - Intergenic
991497548 5:67242346-67242368 CTGATGGCATGTTGGGAGGATGG + Intergenic
992816671 5:80447638-80447660 CCTTGGGTAGGCAGGGAGGAGGG - Intronic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993861868 5:93145987-93146009 CTGAGTGTATGCAGGGGAGCTGG - Intergenic
994180961 5:96765531-96765553 CTGAGGGGATTCTGGGAGGTAGG + Intronic
995564596 5:113420764-113420786 ATGATAGTAGGCAGGGAGGACGG + Intronic
995603417 5:113823984-113824006 CTGAGGGGATGCAATGAGGCTGG - Intergenic
995751072 5:115453799-115453821 CTGAGGCTGGGCAGGGTGGAAGG - Intergenic
997260789 5:132464275-132464297 CTGAGGGTGCCCAGGGAGCAGGG + Exonic
997598411 5:135122604-135122626 ATGAGGCTAAGCAGAGAGGAAGG - Intronic
997778643 5:136634747-136634769 CTGTGGGTATTCAGGATGGAGGG + Intergenic
997844684 5:137275960-137275982 CTCAGGGGAGGCAGGGAGGCTGG - Intronic
998351249 5:141503103-141503125 CAGAGGGTATGAAGAGAGGCAGG - Intronic
998638895 5:143987406-143987428 CGGAAGGAATGCAGGCAGGAAGG - Intergenic
998989085 5:147795252-147795274 CTGAAGGTGTGGATGGAGGAGGG - Intergenic
999254235 5:150200929-150200951 CTGGGTGTGTGAAGGGAGGAGGG + Intronic
999426057 5:151488533-151488555 CAGAGGGGAGGCAGGTAGGAAGG - Exonic
1001296049 5:170499846-170499868 CTAAGGTTGTTCAGGGAGGAAGG - Intronic
1001933145 5:175687180-175687202 TTGAGGGCATGGAGGGCGGAGGG + Intergenic
1002066101 5:176652485-176652507 CTAAAGGTTTGCATGGAGGATGG + Intronic
1002123336 5:177022720-177022742 GTGAGGGTTTGCGGGGAAGATGG + Exonic
1002584332 5:180232571-180232593 GTGGGGGTTTTCAGGGAGGAGGG - Intergenic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1003719807 6:8688824-8688846 AGGAGGGAATGCAGGCAGGAGGG - Intergenic
1004125143 6:12865949-12865971 CTTAGGGTGGGGAGGGAGGAGGG - Intronic
1004495566 6:16159773-16159795 CTGAGGGTCAGCAAGAAGGATGG + Intergenic
1005488531 6:26324161-26324183 CTGGGGGAAGGAAGGGAGGAAGG + Intergenic
1006083709 6:31581772-31581794 CTGAGGGTCTGAAGCGGGGAAGG + Intronic
1006093035 6:31639423-31639445 CTGAAGGGATCCAGGGAAGAGGG + Intronic
1006340220 6:33442725-33442747 AAGAGGGCAGGCAGGGAGGATGG - Intronic
1006903417 6:37517244-37517266 CTGAGGGCAGTCGGGGAGGAGGG + Intergenic
1006920849 6:37626178-37626200 AGGAGGGCCTGCAGGGAGGAGGG - Intergenic
1007574488 6:42916208-42916230 CTGATGGGCTGCAGGGAGGCAGG + Intronic
1007825413 6:44596191-44596213 CTAAGGATATGGAGGGAGGAAGG - Intergenic
1008286294 6:49655268-49655290 CAGAGGCTCTGCAAGGAGGAAGG - Intergenic
1008288397 6:49682761-49682783 ATGAGGGAAGGGAGGGAGGAAGG - Intergenic
1010046118 6:71445908-71445930 CTCACTGTTTGCAGGGAGGATGG - Intergenic
1012690110 6:102299895-102299917 CTCAGGGTCTGCAAGGATGAAGG - Intergenic
1013456253 6:110332075-110332097 CAGAGGGTAGGCTGGGAGGCAGG + Intronic
1015385101 6:132613369-132613391 ATGAGGAAAAGCAGGGAGGAAGG - Intergenic
1015440004 6:133237054-133237076 CTGAGTGTAAGCATGGAAGAAGG + Intergenic
1015570833 6:134619708-134619730 GTGAGGAGATGCAGGGAGGATGG + Intergenic
1015899801 6:138052939-138052961 CAGAAGGCATGCAGGCAGGAAGG + Intergenic
1016292157 6:142537961-142537983 CTGAGGCTTTGAAGGGAGAAGGG - Intergenic
1017011196 6:150064855-150064877 CTGGGGGTAGGAAGGGAGAAGGG + Intronic
1018101638 6:160445805-160445827 CTGAGGGTCTGCAGGGTGATGGG + Intronic
1018847161 6:167563657-167563679 ATGAGGGAATGCATGGATGAAGG - Intergenic
1019092723 6:169553020-169553042 GTGTGTGTATGCAGGGAGGTGGG + Intronic
1019092736 6:169553088-169553110 GTGTGTGTATGCAGGGAGGTGGG + Intronic
1019103488 6:169650389-169650411 ATGAGGGGATGGAGGGATGACGG - Intronic
1019143935 6:169964824-169964846 CTGAGGGTGAGCAGGGGTGAGGG + Intergenic
1019374381 7:681577-681599 CTGGAGGTCTGCTGGGAGGAGGG + Intronic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1019501094 7:1365094-1365116 CAGAGGGGATGCAGTGGGGAGGG - Intergenic
1019571827 7:1716434-1716456 CTAAGGCTCTGGAGGGAGGATGG - Intronic
1019577186 7:1743255-1743277 CTGAGGGTCTCCAGGCAGGACGG - Intronic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1019772935 7:2895051-2895073 ATCTGGGTCTGCAGGGAGGAGGG + Intergenic
1021102799 7:16602954-16602976 CTGAAGGTATACAGGAAGCATGG - Intronic
1022003181 7:26245070-26245092 CTGAGGGTTTGAAGGGAGAAGGG - Intergenic
1022052790 7:26695161-26695183 CTGAGGGTATTTAGTGAGAAAGG - Intronic
1024254292 7:47528288-47528310 CTGGGGGTCTGCAGGGAAGGAGG + Intronic
1024373344 7:48610852-48610874 CTGAGGTTATGCAGGGCAGTGGG + Intronic
1025212573 7:57028687-57028709 CTGGGGGTGGGCAGGAAGGAGGG - Intergenic
1025235814 7:57234272-57234294 CTGGGGGGACGCAGGCAGGAGGG + Intergenic
1025286720 7:57668283-57668305 AGGAGGGAATGCGGGGAGGAAGG + Intergenic
1025299349 7:57805739-57805761 AGGAGGGAATGCAGGGAGGAAGG - Intergenic
1025659380 7:63548140-63548162 CTGGGGGTGGGCAGGAAGGAGGG + Intergenic
1025819217 7:64947284-64947306 CGGAGGGTTTGCGGGGCGGAGGG + Intergenic
1028415790 7:90579208-90579230 ATGAGGGAATACAGGGAGGGAGG + Intronic
1028520849 7:91729045-91729067 CAGAGGGAAGGAAGGGAGGAAGG + Intronic
1029459112 7:100685327-100685349 CCGAAGGTAGGAAGGGAGGATGG - Exonic
1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG + Intronic
1029788406 7:102816758-102816780 ATGTGGGGAGGCAGGGAGGATGG - Intronic
1031468969 7:122146686-122146708 CTGAGTGTATGCAGGGATAAAGG + Intergenic
1032068821 7:128791605-128791627 CTGGGGGTCTGGAAGGAGGAGGG - Intronic
1032447733 7:131999136-131999158 CCGAGGCTATGGAGGAAGGAGGG - Intergenic
1032689005 7:134263941-134263963 CTGAGGGATTGGAGGGAGGGTGG - Exonic
1033174783 7:139113964-139113986 CTGAGGCTCTGCAGGGAGGAAGG + Intergenic
1033586816 7:142780388-142780410 CTCAGGAGATGCAGGGAGGAAGG - Intergenic
1034457297 7:151177673-151177695 TGGAGGGTATTCAGGGAGAAGGG + Intronic
1034584422 7:152076552-152076574 CTGGGGGTTTGGAGGGAGGCTGG + Intronic
1037281850 8:17250056-17250078 GTGAGGGTCTTCAGGGCGGAAGG + Intronic
1037498485 8:19463342-19463364 CTGTGGGTATGGTGGGTGGATGG - Intronic
1037645567 8:20789793-20789815 CTGCGGGGATTCAGGAAGGAGGG - Intergenic
1037908282 8:22728151-22728173 CTCATGGGATGCTGGGAGGATGG + Intronic
1038177486 8:25194452-25194474 CGGAGGGAAGGCAGGGAGGATGG - Intronic
1038349042 8:26760004-26760026 CTGAGAGTCCCCAGGGAGGAAGG + Intronic
1038491929 8:27977628-27977650 CTGGGGGTTTTTAGGGAGGAAGG - Intronic
1039352950 8:36782297-36782319 ATGAGGGAAGGGAGGGAGGAAGG - Intergenic
1039360389 8:36870423-36870445 CTGAGAGTAAAAAGGGAGGAAGG - Intronic
1039408836 8:37335098-37335120 GTGAGCGTAAGCACGGAGGAGGG + Intergenic
1040015495 8:42696028-42696050 TTGTGGGAATGCAAGGAGGAAGG - Intergenic
1041682192 8:60605072-60605094 CTGAGGCTGTGCAGGGTGGTGGG - Intronic
1041721888 8:60983612-60983634 GTGAGGTTTTGCAGGGAGAAGGG + Intergenic
1044028888 8:87210535-87210557 CTGAGGCTATGCAGGGCAGCAGG - Intronic
1044392562 8:91669143-91669165 CTGGGCGTGTGGAGGGAGGAAGG - Intergenic
1044551071 8:93512989-93513011 CAGAGGGTGGGAAGGGAGGAGGG + Intergenic
1045535927 8:103027839-103027861 CTGTGTGTGTGCAGGGAGGGTGG - Intronic
1047210332 8:122835354-122835376 CTGAGGGTTTGAAGGGGGAAGGG + Intronic
1047343479 8:124005033-124005055 CTGAGCAGATGCAGGTAGGAAGG - Intronic
1047525267 8:125627590-125627612 CCTAGGGCTTGCAGGGAGGAGGG - Intergenic
1047722832 8:127657676-127657698 CAGAGGGAAGGCAGGGAAGAAGG + Intergenic
1047802184 8:128321485-128321507 GTGAGGGTGTGCAGGGGTGAGGG + Intergenic
1048001145 8:130380441-130380463 CTGAGGGTTTGCAGGGTGCAGGG + Intronic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048717148 8:137282805-137282827 CTGAGGGTTTGAAGGGGGAAGGG - Intergenic
1049174999 8:141186816-141186838 ATGATGGTCTGCAGGCAGGAGGG - Intronic
1049254125 8:141604908-141604930 CAGAGGGTCTGGAGTGAGGAGGG + Intergenic
1049442568 8:142616061-142616083 CAGAGGGTTGGCAGGGAGGGGGG - Intergenic
1049807108 8:144546074-144546096 CTGAGGGTGAGGCGGGAGGAAGG + Intronic
1050099186 9:2100086-2100108 CTGCAGGGATCCAGGGAGGAGGG + Intronic
1050396643 9:5204886-5204908 CGGAAGATATGCAGGGAAGACGG + Intergenic
1050412629 9:5382571-5382593 CTGAGGTAATGGAGGAAGGAGGG + Intronic
1051507522 9:17842820-17842842 GTGAGTGTATGCTGGGAGGGAGG - Intergenic
1051662081 9:19435092-19435114 CTAAGGGTAGGCAGGAATGATGG - Intronic
1053198155 9:36136031-36136053 CTGAGGAAAGGCAGGGAGGTGGG + Intergenic
1053215986 9:36270944-36270966 GCGAGGGAATGCAGGCAGGAAGG - Intronic
1053722141 9:40957526-40957548 CTGAGGTTTTGTAGGGAGGAAGG + Intergenic
1053794233 9:41710288-41710310 AGGAGGGAATGCGGGGAGGAAGG + Intergenic
1054343832 9:63894468-63894490 CTGAGGTTTTGTAGGGAGGAAGG - Intergenic
1054470718 9:65535651-65535673 AGGAGGGAATGCGGGGAGGAAGG - Intergenic
1055357066 9:75448550-75448572 TTGAGGTTATGAAGGGAGAAAGG + Intergenic
1055382968 9:75729227-75729249 CTGAGGTTATGCATGAATGAAGG - Intergenic
1056021248 9:82440640-82440662 CTGAGGCTGTGCAGGGAAGCTGG - Intergenic
1056243207 9:84669572-84669594 CTGGGGGCGAGCAGGGAGGAGGG - Intronic
1056374569 9:85994316-85994338 GTGAGGGTTTGTGGGGAGGAGGG - Intronic
1056932827 9:90892942-90892964 CTGAGGTTGTGCAGGGAGCCAGG - Intronic
1057124230 9:92603597-92603619 CTGAGTGTAGGCAGGAAGGTGGG - Intronic
1057141092 9:92727255-92727277 CTGAGGGTATGCAGTGATTAGGG - Intronic
1057972679 9:99572577-99572599 CTGAGGGTTTTCAGCCAGGAAGG + Intergenic
1058833169 9:108837507-108837529 CTGAGGGTAGAGAGGGAGGCTGG - Intergenic
1059341234 9:113598676-113598698 GTAAGGGGAGGCAGGGAGGAGGG - Intergenic
1059429218 9:114240197-114240219 CTGAGGGGAAGCAGAGAGCAGGG - Intronic
1061872897 9:133530098-133530120 CTGTGTGTGTGCTGGGAGGACGG + Intergenic
1062146455 9:134992288-134992310 CGGAGGGTCTCCAGGAAGGAGGG + Intergenic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062448649 9:136606394-136606416 CTGGGCGTCTGCAGGGCGGAGGG - Intergenic
1062498736 9:136843432-136843454 CTGGGGGTGGGCAGGGCGGAGGG - Intronic
1062567758 9:137170829-137170851 GTGAGGGCCTGCAGGGAGGACGG + Intronic
1203453035 Un_GL000219v1:138451-138473 CTGAGGTTTGGTAGGGAGGAAGG - Intergenic
1203634001 Un_KI270750v1:94891-94913 CTGGGGATCTGCAGGGAGGTCGG + Intergenic
1186559482 X:10595658-10595680 CTGAGGGTATGGGGGAAGGGAGG + Intronic
1186923169 X:14303912-14303934 CTGAGGGTATGCTATGAGGCTGG + Intergenic
1187577745 X:20576297-20576319 CTGAGCATATTCAAGGAGGAGGG + Intergenic
1188966450 X:36559331-36559353 CTGAGGGTGTGGGGAGAGGAGGG - Intergenic
1189179107 X:38986767-38986789 CAGAGGGGCTGCAGGGAGGAGGG - Intergenic
1191690811 X:63936074-63936096 CAGAGGGCAGGCAGGCAGGAAGG - Intergenic
1192156943 X:68753692-68753714 CTGGGGGCCTGCAAGGAGGAGGG + Intergenic
1192424999 X:71067800-71067822 CTGAAGGAAGGGAGGGAGGATGG - Intronic
1193412100 X:81177025-81177047 ATAAGGGTAGCCAGGGAGGAAGG + Intronic
1193516985 X:82478261-82478283 CTGAGGATCTGGAGGGAGGCAGG - Intergenic
1195934620 X:110113023-110113045 CAGAGGGGAGGGAGGGAGGAAGG - Intronic
1197816006 X:130499427-130499449 GAGAGGGTAGGAAGGGAGGAAGG - Intergenic
1198076474 X:133198067-133198089 ATGAGGATATGCAGGAAGAAGGG + Intergenic
1199507156 X:148576568-148576590 CTTAGGGCATGCAAGGAGAACGG + Intronic
1199871718 X:151904388-151904410 CTGATGGTGGGGAGGGAGGAAGG - Intergenic
1200096903 X:153668808-153668830 CTGAGGGCTGGCAGGGAGCAAGG + Intergenic
1202086446 Y:21141686-21141708 CTAAGGGTTTGGAGGCAGGAGGG - Intergenic