ID: 912953803

View in Genome Browser
Species Human (GRCh38)
Location 1:114138491-114138513
Sequence CTATACGGCAGGCAGCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912953797_912953803 21 Left 912953797 1:114138447-114138469 CCACTTCATCACCATCATCACCA 0: 1
1: 8
2: 70
3: 414
4: 1610
Right 912953803 1:114138491-114138513 CTATACGGCAGGCAGCAGAGTGG No data
912953796_912953803 22 Left 912953796 1:114138446-114138468 CCCACTTCATCACCATCATCACC 0: 1
1: 6
2: 161
3: 1128
4: 4537
Right 912953803 1:114138491-114138513 CTATACGGCAGGCAGCAGAGTGG No data
912953798_912953803 10 Left 912953798 1:114138458-114138480 CCATCATCACCATCACCATTTGT 0: 1
1: 3
2: 20
3: 171
4: 1131
Right 912953803 1:114138491-114138513 CTATACGGCAGGCAGCAGAGTGG No data
912953800_912953803 -5 Left 912953800 1:114138473-114138495 CCATTTGTTAAGCATTTGCTATA 0: 1
1: 0
2: 8
3: 68
4: 519
Right 912953803 1:114138491-114138513 CTATACGGCAGGCAGCAGAGTGG No data
912953799_912953803 1 Left 912953799 1:114138467-114138489 CCATCACCATTTGTTAAGCATTT 0: 1
1: 0
2: 4
3: 42
4: 385
Right 912953803 1:114138491-114138513 CTATACGGCAGGCAGCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912953803 Original CRISPR CTATACGGCAGGCAGCAGAG TGG Intronic
No off target data available for this crispr