ID: 912955091

View in Genome Browser
Species Human (GRCh38)
Location 1:114149845-114149867
Sequence CAGTGCTCCTAGAAGAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 303}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912955090_912955091 -1 Left 912955090 1:114149823-114149845 CCTCGGGGAGCAAGAAAGAGTTC 0: 1
1: 0
2: 0
3: 6
4: 109
Right 912955091 1:114149845-114149867 CAGTGCTCCTAGAAGAAAGAAGG 0: 1
1: 0
2: 1
3: 35
4: 303
912955089_912955091 6 Left 912955089 1:114149816-114149838 CCTGGGTCCTCGGGGAGCAAGAA 0: 1
1: 0
2: 3
3: 19
4: 135
Right 912955091 1:114149845-114149867 CAGTGCTCCTAGAAGAAAGAAGG 0: 1
1: 0
2: 1
3: 35
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912955091 Original CRISPR CAGTGCTCCTAGAAGAAAGA AGG Intronic
900739208 1:4320437-4320459 CTGTGCTCCTAGAGAAAAGTTGG + Intergenic
900812465 1:4817387-4817409 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
900987175 1:6080028-6080050 CACCCCTCCTGGAAGAAAGATGG + Intronic
901421976 1:9157280-9157302 CATTGCTCCTAAAACAAAGGCGG - Intergenic
901499764 1:9644745-9644767 CAGCAATCCTAGAAGAAAAATGG + Intergenic
902754638 1:18541005-18541027 CAGAGCTCGAAGAAGGAAGAAGG + Intergenic
904466478 1:30711043-30711065 CAGTGCTCTTTGAAAAAAGGGGG - Intergenic
905486806 1:38304238-38304260 CAGTGTTCCTAAACAAAAGAAGG - Intergenic
905969098 1:42127403-42127425 CAGTGCTCCCAGCAGCAAGCAGG - Intergenic
906200628 1:43957962-43957984 CAGAGCTCCTGGAGGAAGGAGGG - Exonic
906784202 1:48600008-48600030 GAGTGGTCAGAGAAGAAAGAAGG + Intronic
906865262 1:49411328-49411350 CAGTGTGCCTAGAACAAAGTAGG - Intronic
906990029 1:50727775-50727797 CAGTGCAGCTAGAATAAAGCAGG + Intronic
907451437 1:54548103-54548125 CAGGGCTCCTAGGAGAAGGGGGG + Intronic
907978039 1:59452753-59452775 GGGTGCTCTAAGAAGAAAGAAGG - Intronic
909196244 1:72628167-72628189 CAGTGCTCCCAGAGAATAGAAGG - Intergenic
909759942 1:79273672-79273694 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
911642979 1:100308457-100308479 CAGTGCATCTAGAATAAAGCAGG - Intergenic
912955091 1:114149845-114149867 CAGTGCTCCTAGAAGAAAGAAGG + Intronic
918253540 1:182726306-182726328 CTCTACTCCTAGAGGAAAGAGGG - Intergenic
918586539 1:186194685-186194707 CAGTGCACTTAGAAGCAAGCAGG - Intergenic
919669857 1:200328844-200328866 CCGTGTTCCTGGAAGTAAGAAGG - Intergenic
920326740 1:205170835-205170857 CTGTGCTCCAAGCAGGAAGAAGG - Intronic
921205787 1:212847436-212847458 CATTGCTCCTAGAAAGAATACGG - Intronic
1063014050 10:2057225-2057247 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
1063032300 10:2247772-2247794 CAGTGCTCCTGGAGGAGCGAAGG - Intergenic
1063167255 10:3474482-3474504 CAGGGCTCAGTGAAGAAAGAGGG - Intergenic
1063924076 10:10960186-10960208 CAGTGCTGCAAGAACAAAGGTGG + Intergenic
1064577958 10:16765133-16765155 CATTGCCACCAGAAGAAAGATGG + Intronic
1065269544 10:24013471-24013493 CATTGCTCCTAGAGGAAATACGG - Intronic
1065725805 10:28666997-28667019 CAGCGCTCCTGAAAGACAGATGG + Intergenic
1065864593 10:29903092-29903114 CAGTGCGGCTAGAACAAAGCGGG - Intergenic
1067438651 10:46295904-46295926 CAGTCCTCCTGGATGAAGGAGGG - Intronic
1067797371 10:49330493-49330515 GAGTCCACCTAGAAGTAAGAGGG - Intergenic
1068237403 10:54256102-54256124 CAGTGCTCTTACAAGACAGTGGG - Intronic
1068744636 10:60516397-60516419 CAGTACCCCTGGAAGAGAGAGGG + Intronic
1069614639 10:69799271-69799293 CAGGGCTCCCAGAAGAAAGGGGG - Intergenic
1071722847 10:88164738-88164760 CAGTACTCCCAGCACAAAGAGGG - Intergenic
1073445468 10:103577728-103577750 CAGTGCTGGTACAAGGAAGAGGG + Intronic
1073986162 10:109211745-109211767 GAGTTCTCATAGGAGAAAGAGGG - Intergenic
1074213672 10:111362776-111362798 CAATGATCTTAGAAGAAATAAGG + Intergenic
1075293816 10:121254680-121254702 CAGTGCTCCGAGGAGAAAGGAGG - Intergenic
1076845874 10:133069329-133069351 CAGTGCTTCTAGAAAAACGTCGG - Intergenic
1077668280 11:4135616-4135638 CAGAGATCCTAGAAGCAATAAGG - Intronic
1077782678 11:5348668-5348690 CAGGGCGGCTAGAAGAAAGCAGG - Intronic
1078768168 11:14319662-14319684 CTGTGCTCTTAGAAGACAGAGGG - Intronic
1078784433 11:14474753-14474775 CTTAGCTCCCAGAAGAAAGAAGG + Intronic
1078925208 11:15868663-15868685 CAGTGATGCTAGAATAAAGCAGG - Intergenic
1079172215 11:18106767-18106789 CATTGCTCCTACAACAAAGCTGG - Intergenic
1080969244 11:37250513-37250535 CAGTGCAACATGAAGAAAGATGG - Intergenic
1081321576 11:41698087-41698109 CAGAGCTGCTGGAAGAAAGATGG + Intergenic
1082820038 11:57538505-57538527 CTGTGCACCTAGAAGAAAGAGGG + Intergenic
1083529975 11:63411249-63411271 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
1084628956 11:70333027-70333049 CAGAGCTCCCAGAAGACAAAAGG - Intronic
1085646961 11:78230590-78230612 ATGTGCTCCTAGAAGGCAGAGGG + Intronic
1085912419 11:80843767-80843789 TAGTGGTCCTGGAAGAAACAGGG - Intergenic
1085916884 11:80900833-80900855 CATTTGTCCTAGAAGGAAGAAGG + Intergenic
1086033967 11:82394587-82394609 CAGGGTTCCCAGAAGAAAGATGG + Intergenic
1087408357 11:97757690-97757712 CAGAGCTTCAAGAAGATAGAGGG + Intergenic
1087899904 11:103628767-103628789 CATTCCTCCTCGAGGAAAGAAGG + Intergenic
1088830508 11:113532481-113532503 CAGTGTTCTTAGAATAAAGCTGG - Intergenic
1089201524 11:116727373-116727395 CAGGGCTCCTAGCAGTAAGGTGG - Intergenic
1090451310 11:126808787-126808809 CAGTGCTTCTAGAAAAGATAAGG + Intronic
1090900104 11:131022749-131022771 TAGAACTCCTAGAAGAAAGCAGG + Intergenic
1091083384 11:132694632-132694654 AGGTTCTCTTAGAAGAAAGAAGG - Intronic
1091099233 11:132854876-132854898 CTGTGAGGCTAGAAGAAAGATGG - Intronic
1091181041 11:133605041-133605063 CACTGTGCCTGGAAGAAAGAGGG + Intergenic
1092923558 12:13253856-13253878 CAGTGGTCCCACACGAAAGAAGG + Intergenic
1094057737 12:26283847-26283869 CAGTGCGGCTAGAACAAAGCAGG + Intronic
1095711575 12:45294410-45294432 CACTGCTTCTAAAACAAAGAAGG - Intronic
1095951061 12:47782203-47782225 CACTGAGCCTAGAAGAGAGAAGG - Exonic
1096735438 12:53649661-53649683 CAGTGCAGCTAGAACAAAGCAGG - Intronic
1100161667 12:91867777-91867799 CAGTGGTTCTAGAATCAAGAAGG - Intergenic
1100708667 12:97229579-97229601 CAGGGTTCCTAGGAGAAACATGG + Intergenic
1102088093 12:110160511-110160533 CAGTGCTGCTAGAACAAGGCAGG - Intronic
1102306506 12:111808792-111808814 GACTGCTCCAAGGAGAAAGATGG + Intronic
1102650426 12:114438421-114438443 AGGAGCTCCTAGAACAAAGATGG + Intergenic
1102671679 12:114624708-114624730 CAGTGCACTTAGAAGAGAGGCGG - Intergenic
1104538621 12:129642053-129642075 CAGTATTCCTAGCAGAGAGACGG + Intronic
1105884452 13:24629936-24629958 TAGTAATCCTAGAATAAAGAAGG + Intergenic
1106685806 13:32057552-32057574 CAGTCCTCCCAGAAGCAACAAGG + Intronic
1108029451 13:46213816-46213838 CATTTCTCCTGGAAGAAATATGG - Intronic
1108315830 13:49236257-49236279 CTGTGAACCTAGAAGCAAGACGG + Intergenic
1109713126 13:66184633-66184655 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
1111047271 13:82830161-82830183 CAGTCCTCCTAGAGAAAACAAGG - Intergenic
1111786231 13:92790087-92790109 CAGTGCTGCTAGAATAAAGCAGG - Intronic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112591814 13:100770351-100770373 CAGGACTCCCAGAAGGAAGAGGG - Intergenic
1113068284 13:106393478-106393500 CAGTGCTGCTAGAATAAGGCAGG + Intergenic
1113090372 13:106611822-106611844 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
1117001831 14:51377979-51378001 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
1117459074 14:55926948-55926970 GAATGCTCCTAGAACAAAGCAGG - Intergenic
1119161429 14:72455888-72455910 CAGTGCTCTTGGAAGAGAAAAGG - Intronic
1119189405 14:72670203-72670225 CCGTGCTTCTGGAAGATAGAAGG - Exonic
1119693400 14:76694240-76694262 CACAGCCCCCAGAAGAAAGAAGG - Intergenic
1120423087 14:84313471-84313493 CAGTGCTGCTAAAACAAAGCAGG + Intergenic
1120667279 14:87321685-87321707 CATTCCTCCTACAAGAAAGTGGG - Intergenic
1120882592 14:89425740-89425762 CATTGCTCCTAGGGGAAATATGG + Intronic
1121469782 14:94143838-94143860 CAGTGCTCCTCAGAGAATGAAGG - Intergenic
1123932379 15:25178098-25178120 CAGTGCACCTTGAGGAAAGGAGG + Intergenic
1124855084 15:33380023-33380045 CAGTGCGGCTAGAACAAAGCAGG - Intronic
1125815416 15:42580162-42580184 CATTCCTCCCAGAGGAAAGAAGG + Intronic
1129852010 15:78798788-78798810 CAGGGCTCCAACAGGAAAGAAGG + Intronic
1130250989 15:82300299-82300321 CAGGGCTCCAACAGGAAAGAAGG - Intergenic
1130730996 15:86492070-86492092 AAGTGCTCCTAGAATAGTGAGGG + Intronic
1130829682 15:87586671-87586693 CAGTGCTCCCAGCAGCAAGAAGG + Intergenic
1132408638 15:101560582-101560604 TTGTGCTTGTAGAAGAAAGAGGG - Intergenic
1132417541 15:101633553-101633575 CAGTCCTTGAAGAAGAAAGATGG - Intronic
1134074969 16:11284230-11284252 CAGGGCTCCTAGAAAGGAGAAGG + Intronic
1136064757 16:27751174-27751196 GAGTGCTCCTAGGAGAAACCTGG + Intronic
1138033887 16:53583058-53583080 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
1138529903 16:57629396-57629418 CAGTGCTCCTACTACACAGATGG + Intronic
1138612033 16:58132810-58132832 CAGTGCTGCTATAATGAAGATGG + Intergenic
1139032488 16:62901894-62901916 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
1141342196 16:83213421-83213443 CAGACCTTCTAGAAGAAACAAGG - Intronic
1141523452 16:84596650-84596672 CAGTGCTCTGAGAACCAAGATGG - Intronic
1142285618 16:89170378-89170400 CACTGCTCCAAGATGAGAGAGGG - Intergenic
1142738214 17:1915090-1915112 CTGTTCTCCTAGGAGAAAGCAGG - Intergenic
1142869531 17:2811073-2811095 CAGGGCTCTTAGTGGAAAGAGGG - Intronic
1144308935 17:13994590-13994612 CAGTGTTCCAAGAGGAAAGAAGG + Intergenic
1145996279 17:29106685-29106707 CATTCCTCCTAGAAGGAAGGTGG - Intronic
1146430662 17:32790899-32790921 CAGGGCTCCTTGAAGAAAAGCGG + Intronic
1146478801 17:33185693-33185715 CAGTACTCCATGAAGAATGAAGG - Intronic
1146974959 17:37103271-37103293 CTGTTCTCCTGAAAGAAAGAAGG + Intronic
1147275912 17:39316436-39316458 CAGGGCTCCTTGGAGAAATAGGG + Intronic
1149772735 17:59333481-59333503 CCATGCTCCTAGAGGGAAGAAGG - Intronic
1149801178 17:59569004-59569026 CACTGCTCCCAGCAGAAAGGTGG + Intronic
1150225950 17:63524482-63524504 CAAGGCCCCTAGAAGAAACAGGG - Intronic
1151114358 17:71717154-71717176 CAGTGCTCCAATAATAATGAAGG + Intergenic
1151149467 17:72071837-72071859 CAGTGCTTTGAGAAGAGAGATGG + Intergenic
1154025265 18:10701533-10701555 CAGTACTACTAGAAGAAGGGAGG + Intronic
1154145211 18:11861266-11861288 CAGGGACCCTAGAAGGAAGAAGG - Intronic
1157021456 18:43787850-43787872 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
1157905854 18:51569428-51569450 CATTGCTCCTAAAATAAACATGG - Intergenic
1158057595 18:53300481-53300503 CAGTGTTCCTAAGAGCAAGAAGG + Intronic
1158691158 18:59662080-59662102 TAGTGCTCCTAAATGCAAGAAGG - Intronic
1158946087 18:62448090-62448112 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
1159349140 18:67249192-67249214 CATTGCTCCTAGAATAACGACGG - Intergenic
1159367971 18:67494322-67494344 TAGTGTTCCTAGACTAAAGAAGG + Intergenic
1159559309 18:69976830-69976852 CAATGTTCCTAGAAGTAAAATGG - Intergenic
1159709243 18:71734011-71734033 CAGTGCTCCTGGAATACAGATGG + Intronic
1160337285 18:78053826-78053848 CAGTGCTCCAAGCAGGGAGAGGG + Intergenic
1164880167 19:31726268-31726290 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
1166554095 19:43686641-43686663 CAGTGCTCCCAGGAGCAACAGGG - Intergenic
925244066 2:2363958-2363980 CTGCACTCCAAGAAGAAAGAGGG - Intergenic
926421136 2:12700691-12700713 CAGTGACCCCACAAGAAAGATGG + Intergenic
926647218 2:15302822-15302844 CAGTGTGCCTAGAATAAAGCAGG + Intronic
927077594 2:19595550-19595572 CAGTGCGGCTAGAAAAAAGCCGG + Intergenic
927316478 2:21689054-21689076 CAGTTCTGGTAGGAGAAAGAAGG + Intergenic
927350026 2:22100190-22100212 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
927473433 2:23393978-23394000 CAAAGCTCCTAGAAGCAAGTTGG + Intronic
927495070 2:23546599-23546621 CAGCGATCCTAGAAGAGAGCTGG + Intronic
928280968 2:29946050-29946072 CATTGCTCCTAGGAGAAATATGG - Intergenic
928326372 2:30322745-30322767 CAGTGCTCTGAGAAGAGAGAAGG - Intronic
928490161 2:31775081-31775103 CAGTGCGGCTAGAATAAAGCAGG + Intergenic
929411913 2:41706616-41706638 GAGAGCTCCTTGAGGAAAGAAGG + Intergenic
930117759 2:47733276-47733298 CAGTCCTCAGAGAAGATAGATGG - Intronic
930422684 2:51174514-51174536 CAGTGATCCTCTAAGAAAGCAGG - Intergenic
932752627 2:74380947-74380969 TTGTGCTACAAGAAGAAAGAAGG - Intronic
932916101 2:75859750-75859772 CAGAGCTCCTAGCAGGAAGAGGG + Intergenic
932956998 2:76363857-76363879 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
933067787 2:77819633-77819655 CAGTGCTGCTAGGAGAAAGCAGG + Intergenic
935331105 2:101978716-101978738 CAGTGCCCACAGCAGAAAGAGGG - Intergenic
936789180 2:116130193-116130215 GAGTGATCCTAGCAGACAGAGGG - Intergenic
937773922 2:125753366-125753388 CAGTAGTGCTAGAAGAAAAAGGG - Intergenic
939227068 2:139377690-139377712 CAGTGCAGCTAGAACAAAGTAGG - Intergenic
939832495 2:147089373-147089395 CAGTGCAACTAGAACAAAGCAGG - Intergenic
940722963 2:157301706-157301728 CACTGCTTTCAGAAGAAAGAAGG - Intronic
941588937 2:167394566-167394588 AATTGCTCCTAGTAAAAAGATGG - Intergenic
942252365 2:174058202-174058224 TAGAGCTCCTAGAAGAATGCTGG - Intergenic
942341822 2:174957152-174957174 CAGTGTTCCTAAGAGCAAGAAGG - Intronic
944745417 2:202650831-202650853 CAGTGCGGCTAGAATAAAGCAGG - Intronic
945571481 2:211473295-211473317 CAGGGCTTCTAGAAGAGAGTAGG + Intronic
946174702 2:217915429-217915451 CAGTGCTTCTTGAAGACAGACGG - Intronic
946688386 2:222293485-222293507 CTGTACCCCTAGAAGACAGAGGG + Intronic
947038561 2:225888192-225888214 CAGTGCAGCTAGAACAAAGCTGG + Intergenic
947067206 2:226241116-226241138 CAGTGCATCTAGAATAAAGCAGG + Intergenic
1170084590 20:12514688-12514710 GAGTGCTCTTAGGAGAAAGGCGG + Intergenic
1171262642 20:23747612-23747634 CAGGGCTATTAGAAGCAAGAAGG + Exonic
1173371244 20:42438222-42438244 CAGTTGTCCTAGGAGAGAGAAGG - Intronic
1174219591 20:48943021-48943043 CAGTGTTCCTAACAGCAAGAAGG - Intronic
1175485775 20:59345026-59345048 CAGTGTTCCTGAAAGAAAAAAGG + Intergenic
1177849007 21:26324463-26324485 CAGTGCAGCTAGAACAAAGCAGG + Intergenic
1178159422 21:29894488-29894510 CAGTGCAGCTAGAATAAAGCAGG - Intronic
1179366490 21:40763423-40763445 CACTGCTCAAAGAAAAAAGAGGG + Intronic
1179477482 21:41657014-41657036 TAGTGCTCCCAGAAGAGAGATGG - Intergenic
1179720154 21:43311714-43311736 CAGTGTTCTTAGAAGAGAGGGGG - Intergenic
1182535043 22:30994760-30994782 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
1183124334 22:35761230-35761252 CAGTGCCCCTATCAGGAAGAGGG - Exonic
1183355196 22:37355080-37355102 CAGAGCGCCGAAAAGAAAGAGGG - Intergenic
1184497360 22:44849700-44849722 TAGTGCTCCAAGAAGAAAGGAGG - Intronic
950423727 3:12913587-12913609 CAGGGCTCCTAGAGGAGAGCTGG - Intronic
950698388 3:14722232-14722254 TAGTGCCCCTGGAAGAAGGAGGG + Intronic
951825137 3:26859865-26859887 CAGTCCTCCTGGAGGAGAGAGGG + Intergenic
951915957 3:27801034-27801056 CACTGCTCCTTGAAGAACCATGG - Intergenic
953586761 3:44208029-44208051 CAGTGGGCCTAGAAGAAAGTGGG - Intergenic
955036391 3:55272320-55272342 CAGTGCAGCTAGCAAAAAGAAGG - Intergenic
955944410 3:64178735-64178757 CATTCCTCCTAGGAGAAATATGG + Intronic
956623229 3:71241483-71241505 GAGTGTTCCTTTAAGAAAGAAGG - Intronic
956931082 3:74043635-74043657 AAGTGCTCCTAGAAGACTGCTGG - Intergenic
957388530 3:79530822-79530844 CAGTGTTCTTAGAATAAAGATGG + Intronic
957951425 3:87132188-87132210 CAGTGCAACTAGAATAAAGCAGG - Intergenic
957960683 3:87247377-87247399 CAGTGTTCCTAAGTGAAAGAAGG - Intronic
958119995 3:89273860-89273882 CAGTGTTCCTAAATGCAAGAAGG - Intronic
959044493 3:101457636-101457658 AACTGCTCGTAGAAGGAAGAAGG - Intronic
959791226 3:110364519-110364541 GAGTGCTATTAGAACAAAGATGG + Intergenic
960009519 3:112818251-112818273 CAGTGGCCCTAGAAGATACAAGG + Intronic
962244609 3:133782004-133782026 CATTTCTCCAAGAAGAAAAATGG + Intergenic
963913736 3:150838930-150838952 CAGTGCCACTAGAACAAAGCAGG - Intergenic
964066826 3:152590204-152590226 AAGTTCTCCTTGATGAAAGAAGG + Intergenic
964196792 3:154074658-154074680 CAGTGCAGCTAGAACAAAGCAGG + Intergenic
964421662 3:156510382-156510404 CAGAGCCCCTAGAGGTAAGAAGG - Intronic
964960620 3:162419200-162419222 CAGTGCTTCTTGAAGAAAATTGG - Intergenic
967602061 3:191401829-191401851 CAGTGCGCCTAGAACAAAGCGGG - Intergenic
969394327 4:6910437-6910459 CAGGGCTCCGAGATGAAAGGGGG - Intronic
969837962 4:9858869-9858891 CAGTGCTGCTAGAATAAAGCAGG + Intronic
970293057 4:14597587-14597609 CAGAGCTCAGAGAAGAAAGAAGG - Intergenic
970570069 4:17371412-17371434 CAGTTCTCCTATCTGAAAGATGG + Intergenic
971664117 4:29459750-29459772 CAGTGTGGCTAGAAGAAAGCAGG + Intergenic
971975565 4:33681662-33681684 CTGTGAGGCTAGAAGAAAGATGG + Intergenic
972102763 4:35443495-35443517 CAGTGCCTCTAGAAGAATTAAGG - Intergenic
973585049 4:52382040-52382062 CACTGCTCCAAGAAATAAGAAGG + Intergenic
974289367 4:59911088-59911110 CAGTGTTCCTAGAAGTGAAATGG + Intergenic
974588607 4:63915720-63915742 CAGTGCGGCTAGAATAAAGCAGG + Intergenic
976117097 4:81739396-81739418 CTTTGCTCCAAGAAGAAAGAGGG - Intronic
976134556 4:81921750-81921772 CAGTGCTATTACCAGAAAGAAGG - Intronic
976288328 4:83391525-83391547 CACTACTCCTAAAAGAAATAAGG + Intergenic
976795815 4:88931174-88931196 CATTGCTCCAAGGAGAGAGAGGG - Intronic
977182629 4:93896076-93896098 CTGAGCTACTAGAAGAATGAAGG + Intergenic
977987638 4:103402752-103402774 CAGTGCCCCAAGAAGTAAGATGG - Intergenic
978238986 4:106492906-106492928 CAGTGATCCTATGAGAAAGGCGG + Intergenic
979026588 4:115585084-115585106 GAGGACTACTAGAAGAAAGAGGG - Intergenic
980475145 4:133304652-133304674 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
980887496 4:138779291-138779313 CAGTGCAGCTAGAACAAAGCAGG + Intergenic
981638736 4:146911434-146911456 CAGAGCTCATAGAACAAAGACGG + Intronic
982299360 4:153863641-153863663 CAGTGATCCTACAAGCTAGAAGG - Intergenic
983410434 4:167389516-167389538 AAGTGCTCCAAGAAAAAAAAAGG - Intergenic
983415171 4:167443275-167443297 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
983844076 4:172494806-172494828 CAGTGCGGCTAGAATAAAGCAGG - Intronic
984879940 4:184401867-184401889 CGTTGCTCCTAACAGAAAGAGGG + Intronic
984957208 4:185057389-185057411 CAGAGCTTCTAGAGGAAAGGAGG - Intergenic
986284173 5:6347813-6347835 CAGTGGTCCCTGAAGAACGAAGG + Intergenic
986981063 5:13448511-13448533 CAGGGTGCCTAGAATAAAGAAGG - Intergenic
988679290 5:33469075-33469097 CAGTGCAGCTAGAACAAAGCGGG + Intronic
988950173 5:36248263-36248285 CAGTGATTCTAGAAGAAATATGG - Intergenic
989356697 5:40551524-40551546 CAGTTCTGCTAGAATAAAGGAGG + Intergenic
990921596 5:60974159-60974181 CAGTGCTGCTAGATTAAAGCAGG + Intronic
992227787 5:74635577-74635599 CTGTCCTCCCAGAAGGAAGAGGG + Exonic
993069393 5:83140438-83140460 CAGTGCGGCTAGAACAAAGCAGG - Intronic
993804386 5:92386304-92386326 CACTTATCTTAGAAGAAAGAAGG - Intergenic
994076707 5:95659941-95659963 CAGTGTTCAAAGAAGGAAGAGGG - Intronic
995584710 5:113636315-113636337 CAGTGCCGCTAGAACAAAGCAGG + Intergenic
995647498 5:114329385-114329407 CAGTGCGGCTAGAATAAAGTAGG + Intergenic
996413539 5:123184863-123184885 GAGTTCTCCTTGAGGAAAGAAGG - Intronic
996909168 5:128635706-128635728 CAGTGCGGCTAGAAGAAAGCAGG - Intronic
998681276 5:144470356-144470378 CAGTGCTCCTAGAAAAGATATGG + Intronic
1000001399 5:157142415-157142437 AACTGCTCCCAGAAGAAGGAAGG + Intronic
1000695661 5:164378614-164378636 TAGTGCTGCTATAAAAAAGAGGG + Intergenic
1001294330 5:170488620-170488642 CAGAGCTCCGAGAAGCAAGCAGG + Intronic
1005421478 6:25655784-25655806 CACTGTTCCTAGAGGAAAAAAGG - Intronic
1009263894 6:61530114-61530136 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
1009711676 6:67330222-67330244 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
1009876089 6:69507111-69507133 CAGAGCTGCTAGAACAAAGCAGG - Intergenic
1009974441 6:70657997-70658019 CAGTGCTGCTAGAAGAAGGGAGG + Intergenic
1010013566 6:71078164-71078186 AAGTGCCCCTAGAAGAAAAGTGG + Intergenic
1010617654 6:78031970-78031992 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
1011105573 6:83776494-83776516 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
1012345310 6:98178834-98178856 CATTCCTCCCAGAAGCAAGAAGG + Intergenic
1013573225 6:111451131-111451153 CAGAGGTCATAGAAGAAAAAGGG + Intronic
1014829347 6:126083278-126083300 CAGTACTCCAGGCAGAAAGAAGG - Intergenic
1015284679 6:131472070-131472092 CATTGATACTAGAAGTAAGATGG + Intergenic
1015685285 6:135852167-135852189 CAGTTCGCCTAGAAAAAGGAAGG - Intronic
1015685925 6:135859942-135859964 CAATGCTCCTGGAAAAAAAATGG - Intronic
1016190066 6:141254345-141254367 CAGTGCAACTAGAACAAAGCAGG + Intergenic
1017018352 6:150119271-150119293 GAGAGCTCCTAGGAGAAAGTGGG + Intergenic
1018196372 6:161359124-161359146 CAGTGCTCCTAGAAAATGAAGGG - Intronic
1018534718 6:164807893-164807915 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
1020057059 7:5125046-5125068 CAGAGCTTCTCGAAGAAACACGG + Intergenic
1025228024 7:57180387-57180409 AGGTGCTCCTTGAAGAAACAGGG - Intergenic
1025929498 7:65982513-65982535 AGGTGCTCCTTGAAGAAACAGGG - Intergenic
1026507886 7:71002128-71002150 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
1026658464 7:72277735-72277757 CATTTCTCCCAGAAGGAAGATGG - Intronic
1028204382 7:87998923-87998945 CAATGCTCCCAGCAGAATGAAGG - Intronic
1028865534 7:95707106-95707128 TAGTGCTCCTAAAAGAGAGGGGG + Intergenic
1030360199 7:108587636-108587658 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
1030556882 7:111036638-111036660 CAGTGCTTCTAGAAGCAAACTGG + Intronic
1030906420 7:115189051-115189073 CAGAGCTCCTTGAACAAAGTAGG - Intergenic
1031454951 7:121967936-121967958 CAGTGCTCCTAGGGAAAAGAAGG - Exonic
1032431041 7:131861785-131861807 CAGGGCTACTAGAAGCAGGAAGG - Intergenic
1032712459 7:134472574-134472596 CAGTGATCCTAAAAGTAAGGTGG - Intergenic
1033545017 7:142391853-142391875 CAATGCTCCTATCAGGAAGAAGG + Intergenic
1034851634 7:154499322-154499344 CTGTGCTCCTAGAAGGCAGGGGG - Intronic
1035206189 7:157295381-157295403 CAGGGCTCCCAGAAGAAAGCAGG - Intergenic
1036010120 8:4712758-4712780 CAGTGGTCCCAAAAGAAAGAAGG - Intronic
1036397264 8:8379848-8379870 TAGTGACCCTAGAAGAAAGCTGG + Intronic
1038675410 8:29618370-29618392 CTTTTCTCCTGGAAGAAAGATGG + Intergenic
1039531648 8:38268510-38268532 TCGTGCTCCTACAGGAAAGAGGG + Intronic
1039990083 8:42480165-42480187 CAGTGATCCTAGGTGAAACATGG + Intronic
1041210784 8:55549022-55549044 CAGTGCAGCTAGAACAAAGCAGG + Intergenic
1043062904 8:75527419-75527441 GACTGCTCCTAGGAGAAATAGGG - Intronic
1043951111 8:86310112-86310134 CAGTGGTGCTAGAACAAAGCAGG + Intronic
1044027466 8:87191342-87191364 CAGTGCAGCTAGAACAAAGCTGG - Intronic
1044154025 8:88820452-88820474 CAGAACTCCTAGAACAAACAGGG - Intergenic
1044704521 8:94995612-94995634 CAGTGCTTTTAGAATAAAGTCGG - Intronic
1044725885 8:95193811-95193833 CAGGGTTGCTATAAGAAAGAAGG + Intergenic
1047188715 8:122658777-122658799 CAGTTGTCCTAGCAGCAAGATGG + Intergenic
1047435580 8:124833215-124833237 CAGAGCCCCTAGAATAAAGGAGG + Intergenic
1047816971 8:128475284-128475306 CAGTGTTCCCAGAAGAAACCAGG + Intergenic
1049291937 8:141808009-141808031 CAGTGCTCCTGGAATTAAGGGGG - Intergenic
1050416539 9:5423603-5423625 GAGTGTTTCAAGAAGAAAGAAGG - Intronic
1051498439 9:17750965-17750987 CAGGCTTCCTAGAAGAGAGAGGG + Intronic
1052295758 9:26894735-26894757 GAGGGCTCCCAGATGAAAGAGGG - Intergenic
1053430241 9:38037430-38037452 CAGTGATCAGAGAAGAGAGAAGG - Intronic
1055659430 9:78487902-78487924 CAGTACTCTTAGAGCAAAGATGG + Intergenic
1056768480 9:89459921-89459943 AAGTGCTCCTAGAAAACAGCAGG + Intronic
1058370926 9:104266681-104266703 CACTGCTCCTAGGGGAAATATGG - Intergenic
1058381305 9:104379830-104379852 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
1058820637 9:108726133-108726155 CAGTTCACCCAGAAGAAAGCAGG + Intergenic
1059356107 9:113700705-113700727 CTGTGTGCCAAGAAGAAAGATGG + Intergenic
1059520656 9:114938442-114938464 CAATGCTTTGAGAAGAAAGAAGG - Intergenic
1060460017 9:123843114-123843136 AAGTTCTCCAAGAAGAATGATGG - Intronic
1060704456 9:125785349-125785371 CAGTGCAGCTAGAACAAAGCAGG + Intronic
1061467275 9:130791542-130791564 CAGTGCAGCTAGAACAAAGCAGG + Intronic
1062495578 9:136830055-136830077 CAAGGCTCCTAGAAGAACGAGGG + Intronic
1186684133 X:11906811-11906833 GAGTGCTAGAAGAAGAAAGAAGG - Intergenic
1188228320 X:27629308-27629330 CAGAACTCCTAGAAGAAAACAGG - Intronic
1188368952 X:29345312-29345334 CAGTGCTTCCAAAAGATAGAGGG - Intronic
1188387185 X:29575526-29575548 CAGTGCAGCTAGAACAAAGCAGG - Intronic
1190566846 X:51739147-51739169 CAGTGATGCTAGATGTAAGATGG + Intergenic
1190949954 X:55133733-55133755 AAGTGTTTCTGGAAGAAAGAGGG + Intronic
1191226139 X:58045087-58045109 CAGCGCACCTAGAATAAAGCAGG + Intergenic
1192751181 X:73993260-73993282 CAGTGGTGCTAGAAGATAAATGG - Intergenic
1193461741 X:81798271-81798293 CAGTGCAACTAGAATAAAGCAGG + Intergenic
1194911428 X:99649715-99649737 CAGTGCAGCTAGAACAAAGCAGG - Intergenic
1195020956 X:100828025-100828047 CATTCCTCCTAGAAGATAAAGGG - Exonic
1195128903 X:101836076-101836098 CTGTGCTCCTAGGAGAGGGAGGG + Intronic
1195252081 X:103058872-103058894 CAGTGCTATTAGAGGAAACATGG - Intergenic
1196885157 X:120237371-120237393 TAGTGCTGCTAGAAGCAAGAGGG + Intergenic
1199304513 X:146251699-146251721 CAGTGCAGTTAGAAGAAAGCAGG + Intergenic
1202021445 Y:20468815-20468837 CACACCTCCTAGAAGAAAAAAGG + Intergenic