ID: 912956020

View in Genome Browser
Species Human (GRCh38)
Location 1:114154440-114154462
Sequence CCGCATGTTGCTATGGCGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 33}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912956013_912956020 1 Left 912956013 1:114154416-114154438 CCGCAATCCTGCGGTCCGCGGTA 0: 1
1: 0
2: 0
3: 1
4: 16
Right 912956020 1:114154440-114154462 CCGCATGTTGCTATGGCGACGGG 0: 1
1: 0
2: 1
3: 2
4: 33
912956011_912956020 8 Left 912956011 1:114154409-114154431 CCGAGCTCCGCAATCCTGCGGTC 0: 1
1: 0
2: 0
3: 1
4: 52
Right 912956020 1:114154440-114154462 CCGCATGTTGCTATGGCGACGGG 0: 1
1: 0
2: 1
3: 2
4: 33
912956014_912956020 -6 Left 912956014 1:114154423-114154445 CCTGCGGTCCGCGGTACCCGCAT 0: 1
1: 0
2: 0
3: 1
4: 7
Right 912956020 1:114154440-114154462 CCGCATGTTGCTATGGCGACGGG 0: 1
1: 0
2: 1
3: 2
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912956020 Original CRISPR CCGCATGTTGCTATGGCGAC GGG Intergenic
904847550 1:33431223-33431245 CCGCCCGTTGCCATGGCCACCGG - Intergenic
907440351 1:54474890-54474912 CCGCGCGTTGCCATGGGGACGGG + Intergenic
912956020 1:114154440-114154462 CCGCATGTTGCTATGGCGACGGG + Intergenic
915381563 1:155445987-155446009 CCCCATGTTGCTAGGACTACAGG + Intronic
918241403 1:182623459-182623481 CCTCCTGTTGCCATGGCTACTGG - Intergenic
924232366 1:241972835-241972857 CCTCATGCTGCCATGGCAACGGG + Intergenic
1071523390 10:86344768-86344790 CCTCCTGTTGCTGTGGTGACTGG + Intronic
1096521066 12:52185009-52185031 CCACATGTTGCTCTGGCAATGGG - Intronic
1098285157 12:68899348-68899370 CCGCATGTTGCCATGAGGGCAGG + Intronic
1101771064 12:107751519-107751541 CAGGAGGTTGCTATGGGGACAGG - Exonic
1103522478 12:121545697-121545719 CCTCTTGTTGCTATGGGGATTGG - Intronic
1104437997 12:128771188-128771210 CCGCATGTTGCTGGGACTACAGG - Intergenic
1114554811 14:23555927-23555949 CCGCCCGTCGCTATGGCGACAGG - Intronic
1115154455 14:30322061-30322083 CAGCATGTTGCTCCGGTGACTGG - Intergenic
1121743362 14:96269171-96269193 CCTGATGTTGCAATGGCCACAGG + Intergenic
1122639512 14:103150098-103150120 CCGCCTGTAGCTAGGGCTACAGG + Intergenic
1124625494 15:31305224-31305246 CCTGTTGTTGCTATGGTGACTGG + Intergenic
1137055890 16:35746538-35746560 CCTCAGGCTGCTATGGCGCCCGG - Intergenic
1137056208 16:35747774-35747796 CCTCAGGCTGCTATGGCGCCTGG - Intergenic
1137056430 16:35748548-35748570 CCTCATGTTGCTATGATGCCCGG - Intergenic
1137056840 16:35750062-35750084 CCTCAGGTTGCTATGGCGCTCGG - Intergenic
1142826200 17:2512880-2512902 CCACTTGTTGCTATGACCACTGG - Intergenic
1143400800 17:6640714-6640736 GCGCCTGTTGCTATGGCGACTGG - Exonic
1162033236 19:7926153-7926175 GCGGCTGTTCCTATGGCGACGGG + Exonic
1162438618 19:10679196-10679218 AGGCATGTTGCTGTGGCTACTGG + Intronic
1170947227 20:20902067-20902089 CCTCATGTTCCCATGGGGACAGG - Intergenic
1172967390 20:38846879-38846901 CCGCAAGTTGCTAAGACCACAGG - Intronic
1184551919 22:45209178-45209200 CGGCTGGTTGCTATGGCAACCGG + Intronic
954274839 3:49535357-49535379 CCTCCAGTTGCTATGGCAACAGG - Exonic
959924172 3:111903394-111903416 CCCCAGGTTACTATGGCAACTGG + Intronic
961094156 3:124140537-124140559 CAGCATCTTGCTATAGAGACAGG - Intronic
973663429 4:53132767-53132789 AAGGATGTTGCTATGGCAACTGG - Intronic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
1034001544 7:147418644-147418666 TAGCATGTTGCTATGGCAAAAGG + Intronic
1047771463 8:128033475-128033497 CCGCAGGTTGCTATCGCCACAGG + Intergenic
1058547640 9:106077845-106077867 CTCCCTGTTGCTATGGCTACAGG + Intergenic
1187481932 X:19664694-19664716 CTGCATGTTGATATTGTGACAGG + Intronic