ID: 912956299

View in Genome Browser
Species Human (GRCh38)
Location 1:114156001-114156023
Sequence TTCTCAATCTAGCAGTGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912956296_912956299 2 Left 912956296 1:114155976-114155998 CCGGCAGCAGCTCCGGACCTGGC 0: 1
1: 0
2: 4
3: 33
4: 315
Right 912956299 1:114156001-114156023 TTCTCAATCTAGCAGTGTGAAGG 0: 1
1: 0
2: 1
3: 7
4: 136
912956293_912956299 4 Left 912956293 1:114155974-114155996 CCCCGGCAGCAGCTCCGGACCTG 0: 1
1: 0
2: 1
3: 17
4: 233
Right 912956299 1:114156001-114156023 TTCTCAATCTAGCAGTGTGAAGG 0: 1
1: 0
2: 1
3: 7
4: 136
912956294_912956299 3 Left 912956294 1:114155975-114155997 CCCGGCAGCAGCTCCGGACCTGG 0: 1
1: 0
2: 4
3: 38
4: 342
Right 912956299 1:114156001-114156023 TTCTCAATCTAGCAGTGTGAAGG 0: 1
1: 0
2: 1
3: 7
4: 136
912956297_912956299 -10 Left 912956297 1:114155988-114156010 CCGGACCTGGCATTTCTCAATCT 0: 1
1: 0
2: 3
3: 31
4: 235
Right 912956299 1:114156001-114156023 TTCTCAATCTAGCAGTGTGAAGG 0: 1
1: 0
2: 1
3: 7
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912956299 Original CRISPR TTCTCAATCTAGCAGTGTGA AGG Intergenic
900878791 1:5365754-5365776 TCCTCAATGTAGCAGTTAGAGGG + Intergenic
903448575 1:23437590-23437612 CTCTCAAGCTAGGAGTGGGAAGG + Intronic
904443151 1:30545233-30545255 TCCTCATTGTAGCACTGTGAAGG - Intergenic
906244334 1:44262532-44262554 CTCACAATCTAGCAGAGTGGGGG + Intronic
909050274 1:70758245-70758267 TTCTCAAACTATCTGTGTGAAGG + Intergenic
912144485 1:106775302-106775324 ATCTCAATCTACTAGTATGAAGG + Intergenic
912956299 1:114156001-114156023 TTCTCAATCTAGCAGTGTGAAGG + Intergenic
916409603 1:164532713-164532735 ATTTCAACCTACCAGTGTGATGG - Intergenic
916651149 1:166835829-166835851 TTCTCCATCTGCCAGAGTGAAGG - Intergenic
920816604 1:209340329-209340351 TTCTCAATTAAGCACTGTGGTGG - Intergenic
921110254 1:212029467-212029489 TTCTAAATCAGACAGTGTGAAGG + Intronic
922040577 1:221892350-221892372 TTCTCAGTTGGGCAGTGTGATGG - Intergenic
923956455 1:239027850-239027872 TTATCAATTTAGCAGTGAAAAGG - Intergenic
1064218529 10:13420085-13420107 TTCTCAAACTATCAGTGGTAAGG + Intergenic
1068577947 10:58706066-58706088 TTCTCAATCTAAGAGTCAGAAGG - Intronic
1071263100 10:83938981-83939003 CTCTCTATGTAGCAGTGTGCTGG + Intergenic
1073922591 10:108476364-108476386 TTCTTTATCTATCAGTGTGCGGG + Intergenic
1076757026 10:132577862-132577884 TTCTCAAACCAGGAGTCTGACGG - Intronic
1077699575 11:4428966-4428988 TTCTTAACCTAGCAGTGAAATGG - Intergenic
1078946161 11:16070852-16070874 GCCTCAGTCTAGAAGTGTGATGG - Intronic
1079650792 11:22926418-22926440 TTCTCAATCTTGCAAAGTGCTGG - Intergenic
1082691301 11:56308059-56308081 TTCTCATGCTGGCAGTATGATGG + Intergenic
1086982174 11:93209959-93209981 TTCTCACTCAAGCAGTGAGTGGG - Intergenic
1090717350 11:129442196-129442218 TTCTGGATTTAGCAGTGTGATGG + Intronic
1098624354 12:72644387-72644409 AGCACAATCTAGCCGTGTGAGGG + Intronic
1107731932 13:43357426-43357448 TTGAAAATCTAGCAGTGAGAAGG - Intronic
1109060092 13:57605602-57605624 TTCACAATATAGGACTGTGAAGG + Intergenic
1109746774 13:66634219-66634241 TGCACAATCTATCAGTCTGATGG + Intronic
1110590231 13:77248179-77248201 TTCCCAATCTAGTGTTGTGAAGG - Intronic
1112902246 13:104372063-104372085 TTCTAAATCTAGCAAGGTAATGG - Intergenic
1114300446 14:21371877-21371899 TTCTCGTATTAGCAGTGTGATGG + Exonic
1116772387 14:49142659-49142681 TTCTGAGTCTACAAGTGTGAAGG - Intergenic
1116997369 14:51337672-51337694 TTCTGAAGCTAGCAGTAAGATGG - Intergenic
1120726630 14:87949428-87949450 TTCACTCTGTAGCAGTGTGATGG + Intronic
1124222149 15:27860170-27860192 TTGTCAATTTAGCACTGGGAAGG + Intronic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1131852680 15:96559640-96559662 GTCTCTATCTAGCAGTTTGGTGG - Intergenic
1131936264 15:97509027-97509049 TACTGAATCTAGCAGTATGACGG - Intergenic
1133664089 16:7948134-7948156 TTCTCACTCTCTCAGTGTGTGGG - Intergenic
1135664486 16:24324586-24324608 TTCTCCATCTGGCAGCCTGAGGG + Intronic
1136532846 16:30881596-30881618 TTTTCATTCTCCCAGTGTGAAGG + Intronic
1136929659 16:34407828-34407850 TTCTCAAACTATCAGTGGTAAGG - Intergenic
1136974915 16:35003977-35003999 TTCTCAAACTATCAGTGGTAAGG + Intergenic
1137328648 16:47468267-47468289 TTCTCTGTCAAGCAGTGAGATGG + Intronic
1138913366 16:61430661-61430683 TTCTCATCCTAGCAGTGTTCAGG + Intergenic
1139860128 16:70013628-70013650 TTCTCCACCTGGCAGAGTGAGGG - Intergenic
1141143852 16:81515343-81515365 TTTTCCATCTAGAAGCGTGAGGG - Intronic
1142104129 16:88292981-88293003 ATCTCAATCTTTCTGTGTGAAGG - Intergenic
1148618215 17:49015452-49015474 TTCTCAGACTGGCAGTGGGAAGG - Intronic
1151189481 17:72387733-72387755 TTCTCACTCCTGCAGTGAGAAGG + Intergenic
1157009729 18:43632354-43632376 TACGCAAACTAGCAGTTTGAAGG - Intergenic
1158806634 18:60981448-60981470 TATTTAATCTAGTAGTGTGACGG + Intergenic
1158980650 18:62757587-62757609 TTCTGAAACTGGCAGTGTGCTGG + Intronic
1159019195 18:63129208-63129230 CACTCAATCGAGGAGTGTGACGG - Intronic
1161472531 19:4466281-4466303 TTCTCAATGTAGCAGGCTAAAGG + Intergenic
1161726337 19:5931442-5931464 TTCTCCATGCAGCAGTGTCAGGG + Exonic
1161890715 19:7034354-7034376 TTTTCACTCTAGCAGAGTTAGGG + Intergenic
1161890735 19:7036377-7036399 TTTTCACTCTAGCAGAGTTAGGG - Intergenic
1161892800 19:7053089-7053111 TTTTCACTCTAGCAGAGTTAGGG + Intergenic
1161892820 19:7054841-7054863 TTTTCACTCTAGCAGAGTTAGGG - Intergenic
1165830137 19:38726549-38726571 TTCTCAAGCTACCAATATGACGG - Intronic
1166247659 19:41540514-41540536 TTCTCATACTGGCAGTGTGTAGG - Intergenic
1166571892 19:43802284-43802306 TTCTGAATCCAGTAGTGAGAAGG - Intronic
1166862734 19:45819228-45819250 TTCTCCATATAGCAGCCTGAAGG + Intronic
930702227 2:54469815-54469837 TTGTCAATCTTGCTGTGAGAAGG - Intronic
931641426 2:64383924-64383946 TTCTCTTTCTTGGAGTGTGAAGG + Intergenic
933687782 2:85157294-85157316 TTCTCAATCTAGCAGTAGTTCGG - Intronic
935666147 2:105514734-105514756 TTCTGAATCTACTAGTGGGAGGG - Intergenic
939513711 2:143140208-143140230 TTCTCAATACAGCTGTGTGGGGG + Intronic
942043104 2:172084102-172084124 TTCATAATTTAGCGGTGTGACGG - Intergenic
943034945 2:182731735-182731757 TTTTCAATATAGCAGCATGAAGG - Intronic
943241286 2:185387394-185387416 TTCTCAATCTATCATTTTGGGGG + Intergenic
945510923 2:210701924-210701946 TTTTCCATCTAGCAGTGGAAAGG + Intergenic
945780383 2:214164049-214164071 ATCACAATGTAGCATTGTGAGGG - Intronic
1169702043 20:8457511-8457533 GTGTTACTCTAGCAGTGTGATGG - Intronic
1170534411 20:17325794-17325816 TTCTCAAGCCACCAGTGGGATGG + Intronic
1171044569 20:21797984-21798006 CTCTCTAGGTAGCAGTGTGAGGG + Intergenic
1171400538 20:24870739-24870761 TTCTCAGTGGAGCAGTGTTAGGG - Intergenic
1173242305 20:41308110-41308132 TACTCAACCGATCAGTGTGATGG - Intronic
1173807172 20:45933814-45933836 TTCTCAAGCTAGCACTGGAAGGG + Intergenic
1174257043 20:49264525-49264547 TTCTCCATCTTGGATTGTGAAGG + Intronic
1175438862 20:58976470-58976492 TTCTCCAAACAGCAGTGTGATGG - Intergenic
1177844354 21:26271552-26271574 TTCTCAGTCTTCCAGTGTGTGGG - Intergenic
1181054633 22:20254920-20254942 TTCTCAATCCTGCCGTGGGATGG - Intronic
1184948069 22:47818356-47818378 CTCTCAATCCTGCAGAGTGATGG + Intergenic
952108246 3:30093263-30093285 TTCTCAACCTCTGAGTGTGACGG + Intergenic
952665172 3:35895426-35895448 TACTCACTCTAACAGTGTCAGGG - Intergenic
955125592 3:56107737-56107759 TTCTCAATCTAACAAAGTAAGGG + Intronic
962014767 3:131428480-131428502 TGCTAAATCTAGTACTGTGATGG + Intergenic
965059627 3:163768692-163768714 TGCTCAAACTAGCAGTTTTATGG + Intergenic
966109362 3:176379987-176380009 TTCTTTCTCCAGCAGTGTGATGG + Intergenic
966138585 3:176729376-176729398 TTCTCAATATAACATTGTGAGGG + Intergenic
970001177 4:11367612-11367634 TTCTCAATCGTTCATTGTGAAGG - Intergenic
970729362 4:19084738-19084760 TTCTCAGTTTAGGAGCGTGAAGG + Intergenic
971085436 4:23269591-23269613 TTCTCAACAGAGCAGTGTTATGG + Intergenic
971156152 4:24085480-24085502 TGGTCAATCTAGAAGTGAGAAGG - Intergenic
971777268 4:30982557-30982579 TTCTCAAATTAGGAGTCTGAGGG - Intronic
972039824 4:34579114-34579136 TTCTGAAACTAGCAGTTGGATGG - Intergenic
974018209 4:56669055-56669077 TTCTTAATCTAGAAAAGTGAAGG + Intronic
975772546 4:77743296-77743318 TCCTAAATATAGCAGTTTGAAGG - Intronic
976901580 4:90183747-90183769 GTCACAATCTGGCAGTGTTAAGG + Intronic
978826000 4:113024493-113024515 TTTTTAATCTAGCACTGTCAAGG + Intronic
980900256 4:138898267-138898289 TTCTGAATTTACCATTGTGAAGG - Intergenic
983378167 4:166956784-166956806 TTCTCAACTTAGCATGGTGAGGG - Intronic
983813902 4:172098798-172098820 GTCACAATCTAATAGTGTGATGG + Intronic
983902486 4:173150718-173150740 TTCTCATTTTTGCAGTATGATGG + Intergenic
984079930 4:175235445-175235467 TTCTCACTCTCTCATTGTGATGG + Intergenic
991998881 5:72416561-72416583 TTCCAAATCAAGCAGTGTTATGG + Intergenic
994571089 5:101514945-101514967 TTCTGAAACAAGCAGAGTGAAGG - Intergenic
999531103 5:152464368-152464390 TTCTCAAACTAGCGGTAAGATGG + Intergenic
1001781779 5:174375036-174375058 TTCCCTATCTTGCAGTGAGATGG - Intergenic
1003781308 6:9430194-9430216 TGCTCAATCTAAGAGTGGGAAGG + Intergenic
1005575075 6:27182885-27182907 TTCTGACTCTACCACTGTGAGGG - Intergenic
1009308166 6:62118519-62118541 TTCTTAAAATACCAGTGTGATGG + Intronic
1011247964 6:85339987-85340009 TTCTCAATCTGGCTGTATGATGG - Intergenic
1011263865 6:85495928-85495950 TTCTCATTTTAGGGGTGTGAGGG - Intergenic
1011723371 6:90182631-90182653 TTCTCAATCTCACAGTTTCATGG - Intronic
1011872456 6:91912908-91912930 GGCTCAATCTATCAGTATGAAGG - Intergenic
1012177663 6:96108883-96108905 TTCACAATCTAGAAGTGGAAGGG - Intronic
1014403480 6:121019946-121019968 TTGCCAATCTATCACTGTGATGG + Intergenic
1016736494 6:147485517-147485539 TTCTTTATCTAGCAGTCTCAGGG - Intergenic
1019274016 7:166487-166509 TTCTCAAGAAAACAGTGTGAGGG + Intergenic
1020993435 7:15231176-15231198 TCCTAAATATATCAGTGTGATGG + Intronic
1022199313 7:28100962-28100984 TTCTCCATCTAACAGTGAGCTGG + Intronic
1022511482 7:30937474-30937496 TTCTCTATCCAGCCCTGTGAGGG - Intergenic
1028462410 7:91110001-91110023 TTCTCAATCTCCCATTGTGATGG - Intronic
1028867465 7:95730458-95730480 TGCTCAATTTAGCAGTGGTAAGG - Intergenic
1029298636 7:99560889-99560911 TTCTCAAATAAGCAGAGTGATGG + Intronic
1029358806 7:100073068-100073090 CTCTCATTCTAGCAGAGAGATGG + Intronic
1030546525 7:110903040-110903062 TTCTGAAACTAGCAGCCTGAGGG + Intronic
1040795402 8:51285064-51285086 TTCTCTATTCAGCACTGTGATGG + Intergenic
1043163660 8:76876105-76876127 TGCTAAATCTGGCAGTGTCAAGG - Intergenic
1043226600 8:77740008-77740030 TTCTCAATCTACCATTGTGAGGG - Intergenic
1045842280 8:106594197-106594219 TTCTCCAGCTAGCAGTGTAAAGG + Intronic
1050134997 9:2453276-2453298 TTCTCTATGTAACAGTGTGCTGG - Intergenic
1051579264 9:18653143-18653165 TCCTAAACCTAGCTGTGTGATGG - Intronic
1055912553 9:81368973-81368995 TTTTCAATGTAGCAATGAGAAGG - Intergenic
1060780331 9:126407592-126407614 GTCTCAATCTGTCAGTGTGGGGG - Intronic
1187955598 X:24514929-24514951 TCCCCAATCTAGCTGTGTGTGGG - Intronic
1190396825 X:49993580-49993602 TTGTGTATCTAGCATTGTGAAGG + Intronic
1192356315 X:70407470-70407492 TTCTGAATCTAGGAATGTGTTGG + Intronic
1195880025 X:109583565-109583587 TCATCAATCTTGCAGTGTTAAGG - Intergenic
1196803013 X:119560370-119560392 TTCTCTAACTGGCAGTCTGAAGG + Exonic
1198495412 X:137187229-137187251 TTTCAAATCTAGCAGTATGAGGG + Intergenic
1200387685 X:155909500-155909522 ATCTAAAGCTAGCAGTGGGAAGG - Intronic